Mutated DNA polymerase
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2019-01-29
- Publication Date
- 2026-08-11
AI Technical Summary
由于蛋白质结构的复杂性,一些远离活性位点的氨基酸也有可能对酶的整体结构产生影响,因此只对特定几个活性中心位点的氨基酸进行突变,难以从整体上对酶进行改造
[0047]应理解,在本发明范围内中,本发明的上述各技术特征和在下文(如实施例)中具体描述的各技术特征之间都可以互相组合,从而构成新的或优选的技术方案。限于篇幅,在此不再一一累述。
Smart Images

Figure BDA0004597891890000111 
Figure BDA0004597891890000121 
Figure BDA0004597891890000131
Abstract
Description
[0001] This application is a divisional application of the invention patent application filed on January 29, 2019, with application number 201910083410.X and invention title "A thermostable DNA polymerase mutant with high amplification activity". Technical Field
[0002] This invention belongs to the field of biotechnology. Specifically, this invention relates to a thermostable DNA polymerase mutant with high amplification activity. Background Technology
[0003] Taq polymerase is a thermostable DNA polymerase derived from the thermostable bacterium *Thermus aquaticus*, with a molecular weight of 94 kDa. Its optimal reaction temperature is 75-80°C in the presence of magnesium ions, and its active half-life at 95°C is 40 minutes. It possesses 5'-3' exonuclease activity. Due to its thermostable properties, it is widely used in polymerase chain reaction (PCR) and is the enzyme of choice for nucleic acid amplification and detection. Commercially available Taq polymerase is cloned and expressed using an *E. coli* prokaryotic expression system. Modern molecular biology detection technologies place increasingly higher demands on the sensitivity, accuracy, and robustness of PCR reactions, and wild-type Taq polymerase cannot fully meet the needs of practical applications.To better adapt it for specific technologies, many attempts have been made to mutate and modify the Taq enzyme sequence, such as adding a DNA-binding domain to enhance its elongation activity (Wang Y (2004). A novel strategy to engineer DNA polymerases for enhanced processivity and improved performance in vitro. Nucleic Acids Res 32, 1197–1207); and using site-directed mutagenesis and deletion of domains to achieve higher fidelity (Suzuki M, Yoshida S, Adman ET, Blank A, Loeb LA (2000). Thermus Aquaticus DNA polymerase I mutants with altered fidelity. Interacting mutations in the O-Helix. J Biol Chem 275: 32728–32735) and higher DNA polymerization activity (Mutant Taq DNA polymerases with improved elongation ability as a useful reagent for genetic engineering. Front Microbiol). 5:461.doi:10.3389 / fmicb.2014.00461), tolerance to high concentrations of inhibitors (Zhang Z, Kermekchiev MB, Barnes WM (2010) Direct DNA amplification from crude clinical samples using a PCR enhancer cocktail and novel mutants of Taq. J Mol Diagn 12:152–161), and reduced 5'-3' exonuclease activity (Vainshtein I, Atrazhev A, Eom SH, Elliott JF, Wishart DS, Malcolm BA (1996) Peptide rescue of an N-Terminal truncation of the Stoffel fragment of Taq DNA polymerase. Protein Sci 5:51785–51792).
[0004] There are several main approaches to modifying Taq polymerase: 1. Adding domains to give it new properties. For example, adding a single-stranded binding domain (SSB) or the DNA-binding protein Sso7 enhances the binding ability of Taq polymerase to primers and template DNA, giving it stronger elongation and sustained synthesis capabilities, making it suitable for amplification reactions of long DNA fragments. However, adding domains directly increases the molecular weight of Taq polymerase, which may reduce its solubility and stability, thus reducing the yield of prokaryotic expression. 2. Removing unnecessary domains from Taq polymerase. For example, deleting the 5'-3' exonuclease domain (the first 280 amino acids from the N-terminus of Taq polymerase) allows Taq polymerase to retain only the active region of the nucleic acid polymerase, reducing the possibility of high concentrations of Taq polymerase degrading primers and template DNA, thereby improving Taq polymerase polymerization activity. However, the Taq polymerase mutant obtained by this method lacks 5'-3' exonuclease activity and is not suitable for quantitative PCR reactions based on the TaqMan probe method, limiting its applicability. 3. Site-directed mutagenesis. Site-directed mutagenesis of amino acids at the active site, magnesium ion binding site, and DNA binding site can improve the affinity of each site for substrates, templates, and primers, thereby enhancing resistance to various inhibitors. However, due to the complexity of protein structures, even amino acids far from the active site can affect the overall enzyme structure. Therefore, mutating only a few amino acids at specific active sites is insufficient for modifying the enzyme as a whole. Furthermore, current computer simulation techniques struggle to predict the impact of mutations at each site on the overall structure. Preparing and screening mutants using site-directed mutagenesis is extremely labor-intensive and inefficient, and some sites that may significantly affect activity may not be identified. Summary of the Invention
[0005] The purpose of this invention is to provide a thermostable DNA polymerase mutant with high amplification activity.
[0006] In a first aspect of the invention, a mutant DNA polymerase is provided, said mutant DNA polymerase having a mutation at one or more sites selected from the group consisting of: V453, F495, E507, K508, T509, A518, S624, Y672, E734, R737, F749, T757, L764, H785, wherein the amino acid residues are numbered as shown in SEQ ID NO.2.
[0007] In another preferred embodiment, the activity of the mutant DNA polymerase is at least 1.5 times that of the wild-type DNA polymerase (SEQ ID NO.:2); preferably at least 2 times; more preferably at least 3 times.
[0008] In another preferred embodiment, the amino acid sequence of the wild-type DNA polymerase is shown in SEQ ID NO.:2.
[0009] In another preferred embodiment, the amino selector sequence of the mutated DNA polymerase has at least 80% homology with SEQ ID NO.2; more preferably, at least 90% homology; most preferably, at least 95% homology; such as at least 96%, 97%, 98%, or 99% homology.
[0010] In another preferred embodiment, the mutated DNA polymerase is selected from mutants 1-20 of the following group:
[0011] 1 E507A, K508L, E734E, F749K 2 K508L, V453A, R737K 3 E734G 4 F749G K508L L764K 5 E507Q、T757S 6 H785G 7 S624T F749V 8 E734F F749V 9 K508L R737W Y672R 10 E507H H785L 11 A518Q E734M 12 F495R F749T 13 K508L F749T E734F 14 R737P S624K 15 T757W V453G E507M 16 F749E H785G F495G 17 E734F Y672P 18 T509L H785K 19 E734G T757S L764Q 20 K508L V453A A518Q.
[0012] In another preferred embodiment, the number of mutation sites in the mutated DNA polymerase is 1-4, preferably 2 or 3.
[0013] In another preferred embodiment, the mutated DNA polymerase is selected from the specific mutant enzymes listed in Table 2.
[0014] In another preferred embodiment, the mutant DNA polymerase includes the mutation sites of each of the specific mutant enzymes listed in Table 2.
[0015] In another preferred embodiment, the mutated DNA polymerase is mutated based on the wild-type DNA polymerase shown in SEQ ID NO.:2, and the mutated DNA polymerase includes mutation sites selected from the group consisting of:
[0016] (1)E507A, K508L, E734E, F749K;
[0017] (2) K508L, V453A, R737K
[0018] (3)E734G
[0019] (4) F749G, K508L, L764K
[0020] (5) E507Q, T757S
[0021] (6)H785G
[0022] (7)S624T, F749V
[0023] (8)E734F, F749V
[0024] (9) K508L, R737W, Y672R
[0025] (10)E507H, H785L
[0026] (11)A518Q, E734M
[0027] (12)F495R, F749T
[0028] (13) K508L, F749T, E734F
[0029] (14) R737P, S624K
[0030] (15)T757W, V453G, E507M
[0031] (16)F749E, H785G, F495G
[0032] (17)E734F, Y672P
[0033] (18)T509L, H785K
[0034] (19) E734G, T757S, L764Q; and
[0035] (20)K508L, V453A, A518Q.
[0036] In a second aspect, the present invention provides a polynucleotide molecule that encodes the mutant DNA polymerase described in the first aspect of the present invention.
[0037] A third aspect of the present invention provides a carrier containing the nucleic acid molecule described in the second aspect of the present invention.
[0038] In a fourth aspect, the present invention provides a host cell containing a vector or chromosome integrated with a nucleic acid molecule as described in the second aspect of the present invention, as described in the first aspect of the present invention.
[0039] In another preferred embodiment, the host cell is a prokaryotic cell or a eukaryotic cell.
[0040] In another preferred embodiment, the prokaryotic cell is Escherichia coli.
[0041] In another preferred embodiment, the eukaryotic cell is a yeast cell.
[0042] A fifth aspect of the present invention provides a method for preparing the mutant DNA polymerase described in the first aspect of the present invention, comprising the steps of:
[0043] (i) Under suitable conditions, the host cells described in the fourth aspect of the invention are cultured to express the mutant DNA polymerase described herein; and
[0044] (ii) Isolate the mutant DNA polymerase.
[0045] In another preferred embodiment, the temperature at which the host cells are cultured in step (i) is 20°C-40°C; preferably 25°C-37°C, such as 35°C.
[0046] In a sixth aspect, the present invention provides a kit comprising the mutant DNA polymerase described in the first aspect of the present invention.
[0047] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here. Detailed Implementation
[0048] Through extensive and in-depth research, the inventors applied directed protein evolution technology to construct a random mutant library targeting the polymerase active domain of Taq polymerase. By gradually increasing the screening pressure, unsuitable mutations were naturally eliminated, while mutations with advantageous traits gradually accumulated. Ultimately, a series of amino acid sites and their mutations that play a key role in the amplification and polymerization performance of Taq enzyme were screened out, resulting in Taq enzyme mutants with high amplification performance. Based on this, the present invention was completed.
[0049] Before describing this invention, it should be understood that the invention is not limited to the specific methods and experimental conditions described, as such methods and conditions can be varied. It should also be understood that the terminology used herein is intended only to describe particular embodiments and is not intended to be limiting; the scope of the invention will be limited only by the appended claims.
[0050] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. As used herein, when referring to a specifically enumerated numerical value, the term “about” means that the value can vary from the enumerated value by no more than 1%. For example, as used herein, the expression “about 100” includes all values between 99 and 101 (e.g., 99.1, 99.2, 99.3, 99.4, etc.).
[0051] While any methods and materials similar to or equivalent to those described herein may be used in the implementation or testing of this invention, preferred methods and materials are exemplified herein.
[0052] Taq enzyme
[0053] Taq polymerase is widely used in polymerase chain reaction (PCR) and is the enzyme of choice for nucleic acid amplification and detection. Commercially available Taq polymerase is cloned and expressed using an E. coli prokaryotic expression system.
[0054] The wild-type Taq enzyme DNA sequence is as follows:
[0055]
[0056] CAAAGAGGTAATGGAAGGCGTCTACCCCCTTGCAGTCCCGCTTGAAGTCGAAGTTGGCATAGGGGAA
[0057] GACTGGTTATCTGCGAAGGAA(SEQ ID NO.:1)
[0058] The amino acid sequence of the wild-type Taq enzyme is as follows:
[0059] (SEQ ID NO.:2)
[0060] This invention uses directed evolution to screen for amino acid sites and their mutation modes that are highly correlated with Taq enzyme amplification activity. The relevant mutated amino acid sites include: V453, F495, E507, K508, T509, A518, S624, Y672, E734, R737, F749, T757, L764, and H785, with amino acid residue numbers based on SEQ ID NO.:2. Mutating the above-mentioned amino acid sites to any other amino acid can yield Taq enzyme mutants with higher activity. Preferred mutant forms include: E507A / Q / H / M, K508L, E734G / F / M, F749K / G / V / T / E, L764K / Q, V453A / G, R737K / W / P, T757S / W, H785G / L / K, S624T / K, Y672R / P, A518Q, F495G / R, and T509L.
[0061] This invention utilizes directed evolution technology to screen amino acid sites and their mutation modes that are highly correlated with Taq enzyme activity from a random mutation library. The number of mutants is 10 times that of site-directed mutations. 5 This method is more effective at identifying mutation sites with synergistic effects, which cannot be predicted using existing computer simulation techniques. Furthermore, based on the principles of directed evolution, the accumulated dominant traits are best adapted to the added screening conditions, thus ensuring that the resulting mutants are the optimal individuals among all mutants.
[0062] The Taq enzyme gene sequence of the present invention can be obtained by conventional methods used by those skilled in the art, such as fully artificial synthesis or PCR synthesis. A preferred synthesis method is asymmetric PCR. Asymmetric PCR uses unequal amounts of a pair of primers, resulting in a large amount of single-stranded DNA (ssDNA) after PCR amplification. This pair of primers is referred to as the non-restriction primer and the restriction primer, and their ratio is generally 50-100:1. In the first 10-15 cycles of the PCR reaction, the amplification product is mainly double-stranded DNA, but after the restriction primer (low concentration primer) is consumed, the PCR guided by the non-restriction primer (high concentration primer) will produce a large amount of single-stranded DNA. The primers used for PCR can be appropriately selected according to the sequence information of the present invention disclosed herein and can be synthesized using conventional methods. The amplified DNA / RNA fragments can be separated and purified using conventional methods such as gel electrophoresis.
[0063] The Taq enzyme of the present invention can be expressed or produced using conventional recombinant DNA technology, including the following steps:
[0064] (1) Transform or transduce suitable host cells using a polynucleotide encoding the protein of the present invention, or using a recombinant expression vector containing the polynucleotide;
[0065] (2) Culture the host cells in a suitable culture medium;
[0066] (3) Separate and purify the target protein from the culture medium or cells to obtain Taq enzyme.
[0067] Methods well known to those skilled in the art can be used to construct expression vectors containing the encoding DNA sequence of the Taq enzyme of this invention and suitable transcription / translation control signals, preferably commercially available vectors such as pET28. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombination techniques, etc. The DNA sequence can be efficiently ligated to an appropriate promoter in the expression vector to guide mRNA synthesis. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. Furthermore, the expression vector preferably contains one or more selective marker genes to provide phenotypic traits for selecting transformed host cells.
[0068] The recombinant vector includes, in the 5' to 3' direction: a promoter, a target gene, and a terminator. If desired, the recombinant vector may also include the following elements: a protein purification tag; a 3' polynucleotide signal; a non-translated nucleic acid sequence; a transport and targeting nucleic acid sequence; a selection marker (antibiotic resistance gene, fluorescent protein, etc.); an enhancer; or an operator.
[0069] The methods used to prepare recombinant vectors are well known to those skilled in the art. Expression vectors can be bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses, or other vectors. In short, any plasmid and vector can be used as long as it can replicate and remain stable within the host.
[0070] Those skilled in the art can construct vectors containing the promoter and / or target gene sequence of this invention using well-known methods. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc.
[0071] The expression vector of this invention can be used to transform suitable host cells to enable the host to transcribe target RNA or express target protein. Host cells can be prokaryotic cells, such as *Escherichia coli*, *Corynebacterium glutamicum*, *Brevibacterium flavum*, *Streptomyces*, *Agrobacterium*; or lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as plant cells. Those skilled in the art will understand how to select appropriate vectors and host cells. Transformation of host cells with recombinant DNA can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote (such as *E. coli*), it can be treated with CaCl2 or electroporation. When the host is a eukaryote, the following DNA transfection methods can be used: calcium phosphate co-precipitation, conventional mechanical methods (such as microinjection, electroporation, liposome packaging, etc.). Transformation of plants can also be performed using methods such as *Agrobacterium* transformation or gene gun transformation, for example, leaf disc transformation, embryo transformation, flower bud soaking, etc. Transformed plant cells, tissues, or organs can be regenerated into plants using conventional methods to obtain transgenic plants.
[0072] The term "operable linker" refers to linking a target gene intended for transcription and expression to its control sequence in a manner conventional in the art for expression.
[0073] Cultivation of engineered bacteria and fermentation production of target protein
[0074] After obtaining engineered cells, they can be cultured under suitable conditions to express the protein encoded by the gene sequence of this invention. Depending on the host cell, the culture medium used can be selected from various conventional media, and cultured under conditions suitable for host cell growth. Once the host cells have grown to an appropriate cell density, the selected promoter is induced using a suitable method (such as temperature change or chemical induction), and the cells are cultured for a further period.
[0075] In this invention, conventional fermentation conditions can be used. Representative conditions include (but are not limited to):
[0076] (a) In terms of temperature, the fermentation and induction temperature of Taq enzyme is maintained at 25-37°C;
[0077] (b) Regarding the pH value during the induction period, the pH during the induction period should be controlled between 3 and 9;
[0078] (c) Regarding dissolved oxygen (DO), DO is controlled at 10-90%, and the maintenance of dissolved oxygen can be achieved by introducing an oxygen / air mixture.
[0079] (d) In terms of feeding, the types of feeding should include carbon sources such as glycerol, methanol, and glucose, which can be fed alone or in combination;
[0080] (e) Regarding the IPTG concentration during the induction period, conventional induction concentrations can be used in this invention, typically with the IPTG concentration controlled between 0.1 and 1.5 mM;
[0081] (f) There are no particular restrictions on the induction time, which is usually 2-20 hours, preferably 5-15 hours.
[0082] The target protein, Taq enzyme, of this invention resides within E. coli cells. Host cells are collected using a centrifuge, and then the host cells are broken down using high pressure, mechanical force, enzymatic hydrolysis, or other cell disruption methods to release the recombinant protein; high pressure is preferred. The host cell lysate can be initially purified using methods such as flocculation, salting out, and ultrafiltration before further purification by chromatography or ultrafiltration, or it can be directly purified by chromatography.
[0083] Chromatographic techniques include cation exchange chromatography, anion exchange chromatography, gel filtration chromatography, hydrophobic chromatography, affinity chromatography, and other techniques. Commonly used chromatographic methods include:
[0084] 1. Anion exchange chromatography:
[0085] Anion exchange chromatography media include (but are not limited to): Q-Sepharose and DEAE-Sepharose. If the salt concentration of the fermentation sample is high, affecting its binding with the ion exchange medium, the salt concentration needs to be reduced before ion exchange chromatography. The sample can be diluted, ultrafiltered, dialyzed, or subjected to gel filtration chromatography to replace the equilibration buffer until it resembles the equilibration buffer system of the corresponding ion exchange column. Then, the sample is loaded and eluted using a gradient of salt concentration or pH.
[0086] 2. Hydrophobic chromatography:
[0087] Hydrophobic chromatography media include (but are not limited to): Phenyl-Sepharose, Butyl-Sepharose, and Octyl-Sepharose. The sample is loaded with salt by adding NaCl, (NH4)2SO4, etc., to increase the salt concentration, and then eluted by decreasing the salt concentration. Hydrophobic chromatography removes contaminating proteins with significantly different hydrophobicities.
[0088] 3. Gel filtration chromatography
[0089] Hydrophobic chromatography media include (but are not limited to): Sephacryl, Superdex, and Sephadex-type media. The buffer system can be changed during gel filtration chromatography, or further purification can be performed.
[0090] 4. Affinity Chromatography
[0091] Affinity chromatography media include (but are not limited to): HiTrap TMHeparinHPColumns.
[0092] 5. Membrane filtration
[0093] Ultrafiltration media include: organic membranes such as polysulfone membranes, inorganic membranes such as ceramic membranes, and metal membranes. Membrane filtration can achieve purification and concentration.
[0094] The main advantages of this invention are:
[0095] (1) The thermostable DNA polymerase mutant with high amplification activity of the present invention has a significantly higher product yield than wild-type Taq enzyme under the same number of PCR cycles.
[0096] (2) The thermostable DNA polymerase mutant with high amplification activity of the present invention has a significantly shorter time required to amplify and produce the same amount of product under the same conditions than wild-type Taq enzyme, thus significantly improving detection efficiency.
[0097] The present invention will be further described in detail below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions as described in *Molecular Cloning: A Laboratory Manual* by Sambrook J. et al. (translated by Huang Peitang et al., Beijing: Science Press, 2002), or as recommended by the manufacturer. Percentages and parts are by weight unless otherwise stated. Unless otherwise specified, all experimental materials and reagents used in the following embodiments are commercially available.
[0098] Example 1: Construction of random mutant plasmids for Taq enzyme
[0099] The DNA sequence of the polymerase activity domain of Taq polymerase (amino acid sequences 423-831) was amplified using low-fidelity PCR (Error-PCR), with a mutation rate of 0.3%. This sequence was then ligated with the remaining coding sequences of Taq polymerase (amino acid sequences 1-423) and cloned into the pET28a prokaryotic expression vector to obtain a random mutant plasmid of Taq polymerase. The specific steps are as follows:
[0100] 1) Using Taq-pET28a plasmid as a template, primers T(1-423) were designed to amplify the Taq(1-423) fragment.
[0101] Taq(1-423) DNA Seq
[0102]
[0103] T1-423_PF:5'ATATCATATGGCGTGGCATGCTGCCGCTTTT 3'(SEQ ID NO.:4)
[0104] T1-423_PR:5'GCATGAATTCCGTCTCCTCTCCCTCTAAGC 3'(SEQ ID NO.:5)
[0105] PCR reaction system and procedure:
[0106]
[0107] PCR program: 25 cycles of 95℃ for 3 minutes, (95℃ for 30 seconds, 60℃ for 30 seconds, 72℃ for 1 minute), 72℃ for 3 minutes, store at 4℃.
[0108] The PCR product was purified and recovered using a DNA gel extraction kit, digested with NdeI and XhoI enzymes, ligated into the pET28a vector, and sequenced to confirm the correct sequence. The resulting plasmid was named Taq(1-423)-pET28.
[0109] 2) Using Taq-pET28a plasmid as a template, Clontech... PCR RandomMutagenesis Kit (Dalian Takara Bio PT3393-2), primers designed (TMu_F / R) to amplify Taq (423-822) fragments.
[0110] Taq(423-832) DNA Seq
[0111]
[0112] TMu_F:5'GGAGAGGAGCGCCTGTTGTGGTTGT 3'(SEQ ID NO.:7)
[0113] TMu_R:5'TTATTCCTTCGCAGATAACCAGTCT 3'(SEQ ID NO.:8)
[0114] PCR reaction system and procedure:
[0115]
[0116] 95℃ for 3 minutes, (95℃ for 30 seconds, 60℃ for 30 seconds, 68℃ for 2 minutes) x 25 cycles, 68℃ for 5 minutes, store at 4℃
[0117] The PCR products were digested with BsmBI and XhoI, and then ligated into the Taq(1-423)-pET28 plasmid digested with BsmBI and XhoI. The ligation product was transformed into BL21(DE3) expression host bacteria, and the number of transformants was counted.
[0118] Example 2: Expression and directed evolution screening of Taq enzyme mutants
[0119] The Taq enzyme mutant plasmid was transformed into the BL21(DE3) expression strain to induce the expression of the Taq enzyme mutant library. The BL21(DE3) strain containing the Taq enzyme mutant library was dispersed and encapsulated in an emulsion PCR system, and PCR was performed to amplify DNA containing the Taq enzyme mutant fragment. The DNA fragment amplified by emulsion PCR was then subjected to high-fidelity PCR amplification using Taq enzyme-specific primers. The amplified DNA product was then re-cloned into the pET28a expression vector, completing one screening process. This process of emulsion PCR-second high-fidelity PCR-cloning into the pET28a expression vector was repeated, with the extension time of the emulsion PCR gradually shortened in each screening step to accumulate a mutant population with high extension and amplification activity. The specific steps are as follows:
[0120] 1) The transformants obtained in Example 1 were inoculated into LB medium and cultured with shaking at 37°C for 6 hours. Isopropyl galactothioglycoside (IPTG) was added to a final concentration of 0.1 mM, and the culture was induced at 37°C for 3 hours. The bacterial cells were collected by centrifugation, washed twice with ddH2O, and finally resuspended in ddH2O. The absorbance of the bacterial solution at 600 nm (OD600 value) was measured, and the final concentration was diluted with ddH2O to OD600 = 1.0.
[0121] 2) Preparation of oil phase solution
[0122] Tween-80 200ul
[0123] Triton X-100 25ul
[0124] Mineral oil 10ml
[0125] Combine the above three reagents and mix thoroughly.
[0126] 3) Preparation of aqueous reaction solution
[0127] Dilute the bacterial resuspension prepared in step 1) with ddH2O 100 times to prepare the following reaction solution.
[0128]
[0129]
[0130] pET28_F primer: TACGGTTAACCCTTTGAATCA (SEQ ID NO.:9)
[0131] pET28_R primer: GTTACCTGGTTAAACTGTACT (SEQ ID NO.:10)
[0132] 4) Preparation of emulsion systems
[0133] Mix 200 μL of aqueous phase and 400 μL of oil phase in a 2 mL tube, and vortex at high speed for 10 minutes. Divide the mixture into 5 PCR tubes, aliquoting 100 μL into each tube. The PCR program is: 95°C for 5 minutes, followed by 25 cycles of (95°C for 30 seconds, 55°C for 30 seconds, 72°C for 2 minutes), then 72°C for 5 minutes, and finally 4°C at ∞.
[0134] 5) Transfer the emulsion PCR product to a 1.5 ml tube, add 166 μl of water-saturated ether, vortex for 30 seconds, centrifuge at 12000 rpm for 10 minutes, transfer the lower liquid phase, let stand at room temperature for 10 minutes to allow the ether to evaporate, extract and purify the liquid phase product using the phenol-chloroform method, and then precipitate with ethanol overnight to recover the product.
[0135] 6) High-fidelity PCR secondary amplification products
[0136] Using the product from step 4) as a template, perform a second PCR amplification.
[0137]
[0138] The PCR program is as follows: 95℃ for 5 minutes, 20 cycles X (95℃ for 30 seconds, 62℃ for 30 seconds, 72℃ for 2 minutes) 72℃ for 5 minutes, 4℃ for ∞
[0139] Taq_F primers: ATGCGTGGCATGCTGCCGCTTTTCGAGCCTAAGGGACG (SEQ ID NO.:11)
[0140] Taq_R primers: TTCCTTCGCAGATAACCAGTCTTCCCCTATGCCAACTTCGAC (SEQ ID NO.:12)
[0141] 7) The PCR product was purified using a DNA product purification and recovery kit, and then re-ligated into the pET28a expression vector. This completes one round of screening.
[0142] 8) Repeat steps (1)-(6) with the transformants re-ligated to the pET28a vector, changing the conditions of emulsion PCR according to the procedure in the table below, and gradually adding selection pressure to the mutant library.
[0143] Second round of screening: 95℃ for 5 minutes, (95℃ for 30 seconds, 55℃ for 30 seconds, 72℃ for 1.5 minutes) x 25 cycles, 72℃ for 5 minutes, 4℃∞
[0144] Third round of screening: 95℃ for 5 minutes, (95℃ for 30 seconds, 55℃ for 30 seconds, 72℃ for 1 minute) x 20 cycles, 72℃ for 5 minutes, 4℃∞
[0145] Fourth round of screening: 95℃ for 5 minutes, (95℃ for 30 seconds, 55℃ for 30 seconds, 72℃ for 30 seconds) x 15 cycles, 72℃ for 5 minutes, 4℃∞
[0146] After four rounds of screening, the obtained Taq enzyme mutant transformants were subjected to high-throughput screening in Example 3. Example 3: High-throughput screening of Taq enzyme mutants
[0147] 384 single clones were randomly selected from the mutant library obtained in Example 2. After culture and induced expression, their amplification activity was tested by high-throughput PCR, and 20 mutants with high amplification activity were selected. The specific steps are as follows:
[0148] 1) Select 384 single clones, inoculate them into LB medium, and incubate at 37°C for 6 hours. Add isopropyl thiogalactoside (IPTG) to a final concentration of 0.1 mM, and induce incubation at 37°C for 3 hours.
[0149] 2) After centrifugation, collect the induced bacterial cells, add lysis buffer containing 0.1 mg / ml lysozyme (50 Mm Tris, 50 Mm NaCl, 5% glycerol, pH 8.5), resuspend the cells, incubate at 37°C for 10 minutes, and heat at 75°C for 30 minutes. Then centrifuge at 12000 rpm for 10 minutes and collect the supernatant.
[0150] 3) Take a 96-well PCR plate and add the following reaction components to each well.
[0151]
[0152] PCR program: 95℃ for 5 minutes, 20 cycles X (95℃ for 30 seconds, 62℃ for 30 seconds, 72℃ for 60 seconds), 4C∞
[0153] 5 μL of PCR product was subjected to agarose gel electrophoresis. The yields of PCR products in the supernatants prepared from each monoclonal sample were compared, and the 20 monoclonal samples with the highest yields were selected. The amplification yield of each mutant was 1.2 to 2 times that of the wild-type.
[0154] Example 4: Identification of the mutation site in the dominant Taq enzyme mutant
[0155] DNA sequence sequencing was performed on the Taq enzyme mutants selected in Example 3 to determine the mutation status of their amino acid sequences, and high-frequency mutation sites and their mutation forms were statistically analyzed.
[0156] Table 1
[0157]
[0158]
[0159] Twenty mutants with good amplification activity were sequenced, and their amino acid mutations were statistically analyzed as shown in the table above. It can be seen that V453, F495, E507, K508, T509, A518, S624, Y672, E734, R737, F749, T757, L764, and H785 appeared frequently and repeatedly in the 20 mutants, proving that their mutations have a significant impact on the amplification activity of Taq enzyme.
[0160] Example 5: Comparison of the mutant Taq enzyme and the wild-type Taq enzyme
[0161] Taq mutant 1 was expressed and purified, and then subjected to the following amplification capacity tests with wild-type Taq enzyme:
[0162]
[0163]
[0164] PCR program: 95℃ for 5 minutes, n cycles X (95℃ for 15 seconds, 55℃ for 15 seconds, 72℃ for 10 seconds), 4C∞
[0165] The above reaction solution was prepared, and PCR amplification was performed for 15, 20, 25, and 30 cycles. The PCR products were purified by ethanol precipitation, and the absorbance of the products at 260 nm was measured. The total amount of PCR product (ng) corresponding to each cycle number was calculated. The results are as follows:
[0166] Table 2
[0167]
[0168]
[0169] The results above show that Taq enzyme mutants 1 to 20 significantly increased the product yield compared to wild-type Taq enzyme under the same number of PCR cycles. Specifically, the product yield of mutant 1 after 20 cycles was comparable to that of wild-type Taq enzyme after 30 cycles; and under the same 30-cycle amplification condition, mutant 1 yielded more than 2.5 times the product yield of wild-type Taq enzyme.
[0170] All documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference. Furthermore, it should be understood that after reading the foregoing teachings of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims.
Claims
1. A mutant DNA polymerase, characterized in that, The mutated DNA polymerase is based on the wild-type DNA polymerase shown in SEQ ID NO.2, and the mutation is: the 734th amino acid residue is mutated to F and the 749th amino acid residue is mutated to V.
2. A polynucleotide molecule, characterized in that, The polynucleotide molecule encodes the mutated DNA polymerase of claim 1.
3. A carrier, characterized in that, The carrier contains the polynucleotide molecule as described in claim 2.
4. A host cell, characterized in that, The host cell contains the vector of claim 3 or the chromosome is integrated with the polynucleotide molecule of claim 2.
5. The host cell as described in claim 4, characterized in that, The host cell is a prokaryotic cell or a eukaryotic cell.
6. The host cell as described in claim 5, characterized in that, The prokaryotic cells are Escherichia coli cells.
7. The host cell as described in claim 5, characterized in that, The eukaryotic cells are yeast cells.
8. A method for preparing the mutant DNA polymerase of claim 1, characterized in that, Including the following steps: (i) Under suitable conditions, the host cell of claim 4 is cultured to express the mutant DNA polymerase described herein; and (ii) Isolate the mutant DNA polymerase.
9. A reagent kit, characterized in that, The kit contains the mutated DNA polymerase as described in claim 1.
Citation Information
Patent Citations
DNA Polymerases
US20130034879A1