A dCAPS molecular marker co-segregated with wheat scab resistance gene Fhb5 and application thereof

CN117660684BActive Publication Date: 2026-09-18NANJING AGRICULTURAL UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202311682912.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-12-07
Publication Date
2026-09-18
Estimated Expiration
2043-12-07

AI Technical Summary

Benefits of technology

[0031]This invention is the first in the world to obtain WGRB1585, which co-segregates with Fhb5. It can accelerate the application of the disease resistance gene Fhb5 in wheat disease resistance breeding and can also be used for cloning the Fhb5 gene.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117660684B_ABST
    Figure CN117660684B_ABST
Patent Text Reader

Abstract

The application belongs to the field of crop breeding and relates to a dCAPS molecular marker co-segregated with a wheat scab resistance gene Fhb5 and application thereof. The dCAPS molecular marker WGRB1585 is co-segregated with the Fhb5 gene, the upstream primer sequence of the molecular marker is shown as SEQ ID NO. 1, and the downstream primer sequence is shown as SEQ ID NO. 2. The product amplified by the primer is 188bp after RsaI enzyme digestion, which indicates that the wheat to be detected contains Fhb5. If the product amplified by the primer is two bands of 23bp and 165bp after RsaI enzyme digestion, it indicates that the wheat to be detected does not contain Fhb5. The Fhb5 gene is detected by the marker primer pair, the presence and state of Fhb5 can be determined, the scab resistance of wheat can be predicted, and then the plant carrying Fhb5 is quickly screened and used for breeding of disease-resistant varieties.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of crop breeding, specifically relating to a dCAPS molecular marker co-segregated from the wheat Fusarium head blight resistance gene Fhb5 and its application. Technical Background

[0002] Fusarium head blight is a highly devastating disease in wheat production (Dean et al. 2012; Figueroa et al. 2018). In recent years, due to abundant inoculum in the field, improved water and fertilizer conditions, and hot and humid weather during the susceptible period (flowering stage), the occurrence of Fusarium head blight in wheat worldwide has become increasingly serious (Ma et al. 2020). Currently, 80% of wheat-producing areas in my country are threatened by Fusarium head blight, with frequent outbreaks in major wheat-producing areas, causing annual direct economic losses of billions of yuan, making it the most serious disease affecting wheat production in my country (Cheng et al. 2012; Zhang et al. 2018; Ma et al. 2020). The breeding and application of disease-resistant varieties is the most economical and effective method for controlling Fusarium head blight. The discovery of disease-resistant genes is the prerequisite and foundation for disease-resistant breeding, and the development of molecular markers closely linked to disease-resistant genes is the key to the application of disease-resistant genes.

[0003] There are five main types of wheat resistance to Fusarium head blight (Mesterhazy 1995), among which resistance to infection (Type I) and resistance to spread (Type II) (Schroeder and Christensen 1963) are the two most important types. Type I resistance mainly reflects wheat's resistance to the initial infection of the pathogen and is the first line of defense against Fusarium head blight, playing a crucial role in the resistance response.

[0004] More than 500 QTLs for resistance to Fusarium head blight have been identified to date. Among them, the QTL for resistance to Fusarium head blight infection located on chromosome 5A exists in multiple resistant germplasms, and its expression is stable and has a strong effect (Buerstmayr et al. 2009; Ma et al. 2020). Our laboratory precisely mapped and named it Fhb5 (Xue et al. (2011); further, by expanding the population, it was finely mapped to a genetic region of 0.09 cM (Jia et al. (2018)). In near-isogenic lines of Fhb5, this QTL can reduce the incidence of diseased ears by more than 70%. Dr. Buerstmayr Hermann's laboratory in Austria also finely mapped a major resistance QTL, Qfhs.ifa-5Ac, in the Fhb5 corresponding region of the Sumai No. 3 derivative line CM82036 (Steiner et al. (2019)). In addition, many studies have shown that this Fusarium head blight resistance region is linked to many adverse agronomic practices (Buerstmayr et al. 2019). Therefore, screening for SNPs cosegregating with Fhb5 and developing easily detectable molecular markers are of great significance for the rational and efficient use of Fhb5 in breeding for resistance to Fusarium head blight. Summary of the Invention

[0005] The purpose of this invention is to address the above-mentioned shortcomings of the prior art by providing a molecular marker co-segregated with the wheat scab resistance gene Fhb5.

[0006] Another object of the present invention is to provide the application of the molecular marker co-segregated from the wheat Fusarium head blight resistance gene Fhb5.

[0007] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows:

[0008] In the first aspect, the present invention first protects a primer pair of dCAPS molecular markers co-separated from the wheat resistance gene Fhb5, namely WGRB1585-F: as shown in SEQ ID NO.1, and WGRB1585-R: as shown in SEQ ID NO.2.

[0009] Secondly, this invention protects the dCAPS molecular marker WGRB1585 co-segregated from the wheat resistance gene Fhb5. Genomic DNA of the target wheat variety is amplified using marker primers WGRB1585-F (SEQ ID NO.1) and WGRB1585-R (SEQ ID NO.2). The amplified product is digested with the restriction endonuclease RsaI, and then separated by electrophoresis. The digested product shows a single 188bp band, or two bands of 23bp and 165bp; this is the molecular marker WGRB1585 linked to the wheat resistance gene Fhb5. This marker is co-dominant, and the genetic distance between this marker and the Fhb5 gene was determined to be 0 cM using Mapmaker Macintosh V 3.0.

[0010] Thirdly, the present invention also protects reagents or kits containing the primer pairs described above, and / or the molecular markers described above.

[0011] Fourthly, the present invention also protects the application of the primer pairs described above, and / or the molecular markers described above, and / or the reagents or kits described above in the identification or auxiliary identification of the Fusarium head blight resistance gene Fhb5 in wheat germplasm resources.

[0012] Fifthly, the present invention also protects the use of the primer pairs described above, and / or the molecular markers described above, and / or the reagents or kits described above, in the preparation of products for the identification or auxiliary identification of the Fusarium head blight resistance gene Fhb5 in wheat germplasm resources.

[0013] Sixthly, this invention also protects a dCAPS molecular marker method for co-separating the wheat resistance gene Fhb5. The method involves PCR amplification of the wheat genomic DNA to be tested using the primers described above, digestion of the amplified product with the restriction endonuclease RsaI, and then electrophoretic separation of the digested products. If the digested product shows a 188bp band, the wheat variety being tested contains Fhb5; if the digested product shows two bands, 23bp and 165bp, the wheat variety being tested does not contain Fhb5.

[0014] Seventhly, the present invention also protects the use of the primer pairs described above, and / or the molecular markers described above, and / or the reagents or kits described above, in screening or assisting in screening wheat resistant to Fusarium head blight.

[0015] Eighthly, the present invention also protects the use of the primer pair described above in cloning the Fusarium head blight resistance gene Fhb5.

[0016] Ninthly, the present invention also protects the use of the primer pairs described above, and / or the molecular markers described above, and / or the reagents or kits described above, in the breeding or assisted breeding of wheat resistant to Fusarium head blight.

[0017] The dCAPS molecular markers co-segregated from the wheat Fusarium head blight resistance gene Fhb8 were obtained using the following method:

[0018] (I) The Fhb5 near-isogenic line R-35 and its recurrent parent PH691 F 2:3 Population creation and screening of Fhb5 segment recombinants:

[0019] (1) The F1 hybrid was obtained by crossing the Fhb5 near-isogenic line R-35 (♀) with the wheat variety PH691 (♂), and the F2 population was generated by self-pollination;

[0020] (2) Using the boundary markers GWM304 and WMC752 of Fhb5, heterozygous individuals that recombined in this segment were screened from the F2 population, and homozygous individuals that recombined in this segment were screened in the F3 generation using the same markers.

[0021] (II) Identification of disease-resistant phenotypes in recombinant organisms

[0022] (3) All recombinants and resistant parents were planted at the Jiangpu Experimental Base and Baima Base of Nanjing Agricultural University in 2018 and 2019, respectively. About ten days before flowering, infected wheat grains were sown in the field and the materials were inoculated with Fusarium graminearum. The disease rate of ears was investigated 15 days after inoculation.

[0023] (III) Development and Genotyping of Polymorphic dCAPS Molecular Markers

[0024] (4) DNA was extracted from the resistant parent *Wangshuibai*, the susceptible parent PH691, the F2 population, and recombinants using the SDS method; the genomes of *Wangshuibai* and PH691 were resequencing using the BGISEQ-500 sequencing platform; all high-quality sequences were aligned to the *Chinese spring* reference genome using the BWA tool, and then SNP and InDel variant detection was performed using GATK software; SNP variants located in the region containing Fhb5 were selected. Polymorphic dCAPS molecular markers were developed.

[0025] (5) The F2 population was amplified using the side-by-side SSR markers GWM304 and WMC752 in the Fhb5 region to screen for heterozygous recombinants in the Fhb5 region. The same markers were used to screen for homozygous recombinants in the Fhb5 region in the offspring of these heterozygous recombinants. The genotypes of all homozygous recombinants were detected using the polymorphic dCAPS markers among the parents.

[0026] The SSR marker was amplified using the following PCR amplification method: The PCR reaction system consisted of 12.5 μl of 10× buffer, 0.75 μl of 25 mM MgCl2, 1 μl of 2.5 mM dNTPs, 0.2 μM each of the left and right primers, 0.1 μl of Taq enzyme (5 u / μl), 50 ng of template DNA, and water added to a final volume of 12.5 μl. The PCR amplification program was as follows: 94℃ pre-denaturation for 3 min, followed by 94℃ denaturation for 30 sec, 55℃ annealing for 1 min, and 72℃ extension for 1 min, repeated 35 times, with a final extension at 72℃ for 8 min. PCR amplification was performed using a PE9700 amplification instrument. The amplified products were separated by electrophoresis on an 8% non-denaturing polyacrylamide gel, and then photographed using a UV transilluminator to record the results.

[0027] The PCR amplification method used for the dCAPS labeling was as follows: The PCR reaction system consisted of 12.5 μl of 10× buffer, 0.75 μl of 25 mM MgCl2, 1 μl of 2.5 mM dNTPs, 0.2 μM each of the left and right primers, 0.1 μl of Taq enzyme (5 u / μl), 50 ng of template DNA, and water to a final volume of 12.5 μl. The PCR amplification program was as follows: 94℃ pre-denaturation for 3 min, followed by 94℃ denaturation for 30 sec, 55℃ annealing for 1 min, and 72℃ extension for 1 min, repeated 35 times, with a final extension at 72℃ for 8 min. PCR amplification was performed on a PE9700 amplification instrument. The PCR product was then digested with enzymes. The digestion system consisted of 7 μL of PCR product, 1 μL of 10× RsaI buffer, 0.2 μL of RsaI enzyme, and ddH2O to a final volume of 10 μL. The enzyme digestion products were separated by electrophoresis on an 8% non-denaturing polyacrylamide gel, and then photographed using a UV transilluminator to record the results.

[0028] (iv) Obtaining co-separated molecular markers

[0029] (6) Combining the genotype data of all markers in each individual plant of the F2 generation, and based on the linkage recombination law, the recombination rate of each marker was calculated using r = {2 - (4 - 6 * n / N)¹ / ²} / 3 (where n is the number of recombinant plants and N is the total number of individual plants in the F2 population). The Kosambi plotting function d = ln{(1 + 2r) / (1 - 2r)} / 4 was used to convert r to map distance d, and a genetic linkage map of the Fhb5 gene segment was constructed. The genotype and Fusarium head blight resistance phenotype of the homozygous recombinant were integrated to obtain the dCAPS molecular marker co-segregating with Fhb5.

[0030] Beneficial effects

[0031] This invention is the first in the world to obtain WGRB1585, which co-segregates with Fhb5. It can accelerate the application of the disease resistance gene Fhb5 in wheat disease resistance breeding and can also be used for cloning the Fhb5 gene.

[0032] 1. WGRB1585, which co-segregates with Fhb5, was obtained, which can help transfer this gene to promoted varieties and aggregate with other disease resistance genes.

[0033] 2. Convenient identification. This molecular marker is a co-dominant marker, offering advantages such as convenient detection, stable amplification, and simplicity. Detecting the Fhb5 gene using the WGRB1585 marker can determine the presence and state of Fhb5, predict wheat resistance to Fusarium head blight, and rapidly screen for Fhb5-carrying plants for breeding resistant varieties. Furthermore, using this molecular marker for laboratory testing avoids the influence of environmental factors on the variety.

[0034] 3. Improve the efficiency of disease-resistant variety selection and identification, and save costs. Traditional Fusarium head blight resistance breeding is time-consuming, labor-intensive, difficult, and costly. By detecting molecular markers co-segregating with the Fusarium head blight resistance gene Fhb5, the work of phenotypic identification can be greatly reduced, and individual plants carrying the disease-resistant gene Fhb5 can be identified at the seedling stage, thereby eliminating non-target plants. This not only saves breeding costs but also greatly improves the efficiency of disease-resistant variety selection.

[0035] 4. Reduce linkage burden. Since wheat resistance to Fusarium head blight is often correlated with some undesirable agronomic traits, early marker-assisted selection of Fusarium head blight-resistant lines carrying Fhb5 generally exhibited long ears and tall stems. This may be due to the relatively large initial QTL mapping interval, leading to a large selection interval and some linkage burden. Utilizing molecular markers co-segregating with the Fusarium head blight resistance gene Fhb5 can reduce linkage burden during selection and improve selection efficiency.

[0036] 5. It can be used for cloning the Fusarium head blight resistance gene Fhb5. Map-based cloning of the Fhb5 gene requires obtaining a molecular marker that co-segregates with Fhb5. Among all known molecular markers, WGRB1585 has the strongest linkage to Fhb5. Attached Figure Description

[0037] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the accompanying drawings used in the description of the specific embodiments will be briefly introduced below.

[0038] Figure 1. Distribution of disease incidence in 126 homozygous recombinants. The data are the average disease incidence rates for 2018 and 2019.

[0039] Figure 2The banding pattern of WGRB1585. M stands for PUC19 / MspI. The left side shows the molecular weight marker band size (bp). The amplification products of materials 2, 4, 6, 8, 10, 11, 17, 18, 19, 21, 23, and 24, after RsaI digestion, are 188bp, indicating varieties containing Fhb5. The amplification products of the remaining materials, after RsaI digestion, are 165bp and 23bp (bands too small to be displayed), indicating varieties not containing Fhb5. The black arrows indicate the product bands of the amplification products in the disease-resistant materials after enzyme digestion.

[0040] Figure 3 Genetic linkage map of WGRB1585, GWM304, and WMC752 with wheat Fusarium head blight resistance gene Fhb5. The right side shows the markers on the genetic linkage map, and the left side shows the genetic distance between the markers.

[0041] Figure 4 Effect analysis of WGRB1585 in a population of 230 local varieties. Numbers in parentheses represent sample size; *** indicates significance at the 0.001 level. Detailed Implementation

[0042] The technical solution of the present invention will now be described in detail with reference to the accompanying drawings and embodiments. The following embodiments are only used to more clearly illustrate the technical solution of the present invention and are therefore merely examples, not intended to limit the scope of protection of the present invention. Unless otherwise stated, the technical or scientific terms used in this application should have the ordinary meaning understood by those skilled in the art. As a professional agricultural research institution, the applicant has long preserved relevant germplasm materials, and the relevant wheat varieties are all publicly available on the market or in existing germplasm banks.

[0043] Example 1: Obtaining the co-segregated dCAPS molecular marker of the wheat Fusarium head blight resistance gene Fhb5

[0044] (I) The Fhb5 near-isogenic line R-35 and its recurrent parent PH691 F 2:3 Population creation and screening of Fhb5 segment recombinants:

[0045] (1) The F1 hybrid was obtained by crossing the Fhb5 near-isogenic line R-35 (♀) with the wheat variety PH691 (♂), and the F2 population containing 8573 individual plants was generated by self-pollination.

[0046] (2) DNA was extracted from the F2 population using the SDS method; 26 heterozygous individuals that underwent recombination in this segment were screened from the F2 population using the boundary markers GWM304 and WMC752 of Fhb5, and 26 homozygous individuals that underwent recombination in this segment were screened from the F3 generation using the same markers.

[0047] (II) Identification of disease-resistant phenotypes in recombinant organisms

[0048] (3) The Fhb5 near-isogenic line R-35 and the susceptible parent PH691, along with all recombinants, were planted at the Jiangpu Experimental Base and Baima Base of Nanjing Agricultural University in 2018 and 2019, respectively. About ten days before flowering, susceptible wheat grains were sown in the field and inoculated with Fusarium graminearum. The disease incidence rate was investigated 15 days after inoculation. The results showed that these recombinants exhibited significant segregation of resistance. Figure 1 ).

[0049] (III) Development and Genotyping of Polymorphic dCAPS Molecular Markers

[0050] (4) DNA was extracted from the resistant parent *Wangshuibai*, the susceptible parent *PH691*, the F2 population, and recombinants using the SDS method; the genomes of *Wangshuibai* and *PH691* were re-sequencing using the BGISEQ-500 sequencing platform. All high-quality sequences were aligned to the Chinese *Spring* reference genome using the BWA tool, and SNP and InDel variant detection was performed using GATK software; SNP variants located within the Fhb5 region were selected. Sequence analysis results showed that *Wangshuibai* and *PH691* had one SNP variant at nucleotide 230929378 on chromosome 5A of the Chinese *Spring* reference genome (T for *Wangshuibai*, C for *PH691*). Based on this SNP, a polymorphic dCAPS molecular marker WGRB1585 was developed. Figure 2 ).

[0051] (5) Marker genotype data of the F2 population were obtained by amplifying the side-side SSR markers GWM304 and WMC752 in the Fhb5 region; heterozygous single plants that recombined in the GWM304-WMC752 region were screened; homozygous single plants that recombined in the GWM304-WMC752 region were screened from the self-crossed progeny of these heterozygous single plants; and the genotype of homozygous recombinants was detected using WGRB1585.

[0052] in:

[0053] WGRB1585-F: TAGTTGTGTGGCATAATTGAGTA, as shown in SEQ ID NO.1;

[0054] WGRB1585-R: CTTCTTGGCATCTCCTTCG, as shown in SEQ ID NO.2;

[0055] GWM304-F: AGGAAACAGAAATATCGCGG, as shown in SEQ ID NO.3;

[0056] GWM304-R: AGGACTGTGGGGAATGAATG, as shown in SEQ ID NO.4;

[0057] WMC752-F: CCGATTGTAGATCAAAAGCC, as shown in SEQ ID NO.5;

[0058] WMC752-R: TCTAGAGAGTCTTTTTCCCGAGC, as shown in SEQ ID NO.6.

[0059] The SSR marker was amplified using the following PCR amplification method: The PCR reaction system consisted of 12.5 μl of 10× buffer, 0.75 μl of 25 mM MgCl2, 1 μl of 2.5 mM dNTPs, 0.2 μM each of the left and right primers, 0.1 μl of Taq enzyme (5 u / μl), 50 ng of template DNA, and water added to a final volume of 12.5 μl. The PCR amplification program was as follows: 94℃ pre-denaturation for 3 min, followed by 94℃ denaturation for 30 sec, 55℃ annealing for 1 min, and 72℃ extension for 1 min, repeated 35 times, with a final extension at 72℃ for 8 min. PCR amplification was performed using a PE9700 amplification instrument. The amplified products were separated by electrophoresis on an 8% non-denaturing polyacrylamide gel, and then photographed using a UV transilluminator to record the results.

[0060] The PCR amplification method used for the dCAPS labeling was as follows: The PCR reaction system consisted of 12.5 μl of 10× buffer, 0.75 μl of 25 mM MgCl2, 1 μl of 2.5 mM dNTPs, 0.2 μM each of the left and right primers, 0.1 μl of Taq enzyme (5 u / μl), 50 ng of template DNA, and water to a final volume of 12.5 μl. The PCR amplification program was as follows: 94℃ pre-denaturation for 3 min, followed by 94℃ denaturation for 30 sec, 55℃ annealing for 1 min, and 72℃ extension for 1 min, repeated 35 times, with a final extension at 72℃ for 8 min. PCR amplification was performed on a PE9700 amplification instrument. The PCR product was then digested with enzymes. The digestion system consisted of 7 μL of PCR product, 1 μL of 10× RsaI buffer, 0.2 μL of RsaI enzyme, and ddH2O to a final volume of 10 μL. The enzyme digestion products were separated by electrophoresis on an 8% non-denaturing polyacrylamide gel, and then photographed using a UV transilluminator to record the results.

[0061] (iv) Obtaining co-separated molecular markers

[0062] (6) Based on the genotype data of all markers in each individual plant of the F2 generation, and according to the linkage recombination law, the recombination rate of each marker is calculated using r = {2 - (4 - 6 * n / N)¹ / ²} / 3 (where n is the number of recombinant plants and N is the total number of individual plants in the F2 generation). The Kosambi plotting function d = ln{(1 + 2r) / (1 - 2r)} / 4 is used to convert r to the map distance d, and a genetic linkage map of the Fhb5 gene segment is constructed. Figure 3 Integrating the genotype and disease resistance phenotype of the homozygous recombinant, it was found that the genotype of WGRB1585 co-segregated with the Fusarium head blight resistance phenotype, indicating that this marker co-segregates with the wheat Fusarium head blight resistance gene Fhb5. Figure 3 ).

[0063] Example 2: Application of the dCAPS molecular marker co-segregated from the wheat Fusarium head blight resistance gene Fhb5

[0064] Fusarium head blight resistance was identified in a population of 234 wheat local varieties. The varieties were planted at the Jiangpu Experimental Station of Nanjing Agricultural University in 2014, 2016, 2017, and 2018, and the identification method was the same as in Example 1. Genomic DNA was extracted from the 235 varieties using SDS-PAGE and amplified by PCR using WGRB1585. The amplification method was the same as in Example 1. Results showed that among the 234 wheat local varieties, 109 varieties were found to carry Fhb5 using WGRB1585, with an average disease incidence rate of 27.95% ± 12.24% over four years; 125 varieties did not carry Fhb5, with an average disease incidence rate of 39.95% ± 13.44% over four years. The disease incidence rate of the Fhb5-carrying varieties was significantly lower than that of the non-Fhb5-carrying varieties. Figure 4 This demonstrates that the dCAPS marker WGRB1585 provided by this invention can accurately screen for materials containing the wheat scab resistance gene Fhb5, thereby greatly improving breeding selection efficiency.

[0065] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A wheat Fusarium head blight resistance gene Fhb5 The application of primer pairs containing co-separated dCAPS molecular markers in screening or assisting screening for wheat resistant to Fusarium head blight, characterized in that... The primer pairs are as follows: WGRB1585-F: as shown in SEQ ID NO.1; WGRB1585-R: as shown in SEQ ID NO.

2. The wheat genomic DNA to be tested is amplified by PCR using the primer pairs. The amplified products are digested with the restriction endonuclease RsaI, and then separated by electrophoresis. If the digested product shows a 188bp band, the wheat variety to be tested contains Fhb5, indicating the presence of the Fusarium head blight resistance gene. Fhb5 If the enzyme digestion product of a wheat variety resistant to Fusarium head blight shows two bands at 23bp and 165bp, then the wheat variety being tested does not contain the Fusarium head blight resistance gene Fhb5.

2. The primer pair as described in claim 1, or a reagent or kit containing the primer pair as described in claim 1, for the expression of Fusarium head blight resistance gene in wheat germplasm resources. Fhb5 Application in identification or auxiliary identification; using the primer pair described in claim 1 to amplify the genomic DNA of the wheat germplasm resource to be tested by PCR, digesting the amplification product with the restriction endonuclease RsaI, and then separating the digested product by electrophoresis; if the digested product shows a 188bp band, the wheat variety to be tested contains Fhb5, which is a gene containing resistance to Fusarium head blight. Fhb5 If the enzyme digestion product of a wheat variety resistant to Fusarium head blight shows two bands at 23bp and 165bp, then the wheat variety being tested does not contain the Fusarium head blight resistance gene Fhb5.

3. The primer pair as described in claim 1 or a reagent containing the primer pair as described in claim 1 in the preparation of wheat germplasm resources containing Fusarium head blight resistance genes. Fhb5 Applications in the identification or auxiliary identification of products; The genomic DNA of the wheat germplasm resource to be tested was amplified by PCR using the primer pair described in claim 1. The amplification product was digested with the restriction endonuclease RsaI, and then the digested product was separated by electrophoresis. If the digested product showed a 188bp band, the wheat variety to be tested contained Fhb5, which indicates the presence of the Fusarium head blight resistance gene. Fhb5 If the enzyme digestion product of a wheat variety resistant to Fusarium head blight shows two bands at 23bp and 165bp, then the wheat variety being tested does not contain the Fusarium head blight resistance gene Fhb5.

4. A gene for resistance to Fusarium head blight in a wheat germplasm resource Fhb5 The identification or auxiliary identification method is characterized by, The procedure includes the following steps: PCR amplification of the wheat genomic DNA to be tested using the primer pair described in claim 1; digestion of the amplification product using the restriction endonuclease RsaI; and electrophoretic separation of the digested product. If the digested product shows a 188bp band, the wheat variety to be tested contains the Fusarium head blight resistance gene Fhb5; if the digested product shows two bands, 23bp and 165bp, the wheat variety to be tested does not contain the Fusarium head blight resistance gene Fhb5.

5. The use of reagents or kits containing the primer pairs described in claim 1 in screening or assisting screening for wheat resistant to Fusarium head blight; The genomic DNA of the wheat variety to be tested was amplified by PCR using the primer pair described in claim 1. The amplified product was digested with the restriction endonuclease RsaI, and then the digested product was separated by electrophoresis. If the digested product showed a 188bp band, the wheat variety to be tested contained Fhb5, which indicates the presence of the Fusarium head blight resistance gene. Fhb5 If the enzyme digestion product of a wheat variety resistant to Fusarium head blight shows two bands at 23bp and 165bp, then the wheat variety being tested does not contain the Fusarium head blight resistance gene Fhb5.

6. The application of the primer pair as described in claim 1 or a reagent or kit containing the primer pair as described in claim 1 in breeding or assisted breeding of wheat resistant to Fusarium head blight; The genomic DNA of the wheat variety to be tested was amplified by PCR using the primer pair described in claim 1. The amplified product was digested with the restriction endonuclease RsaI, and then the digested product was separated by electrophoresis. If the digested product showed a 188bp band, the wheat variety to be tested contained Fhb5, which indicates the presence of the Fusarium head blight resistance gene. Fhb5 If the enzyme digestion product of a wheat variety resistant to Fusarium head blight shows two bands at 23bp and 165bp, then the wheat variety being tested does not contain the Fusarium head blight resistance gene Fhb5.

Citation Information

Patent Citations

  • Molecular marker of wheat scab infection-resistant gene Fhb5 and application thereof

    CN102690821A

  • DNA marker closely linked to wheat 7DL chromosome scab-resistant gene and application thereof

    CN110878300A