Application of Blastobotrys adeninivorans MB89 strain in degradation of citrinin

Abstract

The application belongs to the technical field of microorganisms, and discloses a strain isolated from Liupu tea, which can effectively degrade citrinin. After the strain is added to a Liupu tea sample, the content of citrinin is reduced to 5.29 μg / kg on the third day, and no citrinin is detected on the seventh day and the tenth day. The strain MB89 isolated from Liupu tea has strong degradation capacity for citrinin in a complex tea matrix, and is expected to be applied to the production process of Liupu tea to control the content of citrinin in finished tea, reduce the safety risk of tea drinking, and also can be used for the prevention and treatment of citrinin risk in the production of food, feed and the like.

Description

Technical Field

[0001] This invention belongs to the field of microbial technology, and more specifically, relates to the application of the adenine-producing Botrytis cinerea strain MB89 in the degradation of citrinin. Background Technology

[0002] Citrinin (CIT) is a polyketide fungal toxin initially isolated from cultures of *Penicillium citrinum*. CIT promotes the synthesis of reactive oxygen species and superoxide anions in the respiratory chain, thereby inducing lipid peroxidation and apoptosis associated with mitochondrial dysfunction. The imbalance between oxidation and antioxidation induced by CIT is considered the main mechanism of its biotoxicity. CIT has been shown to be nephrotoxic and hepatotoxic in humans, causing functional and structural kidney damage and impaired liver metabolism, and has negative effects on the reproductive system. However, its carcinogenicity and genotoxicity remain uncertain. The International Agency for Research on Cancer (IARC) classifies CIT as a Group 3 carcinogen.

[0003] CIT is mainly produced by the genera *Penicillium*, *Aspergillus*, and *Monascus*, and these microorganisms can be found in a wide variety of foods and feeds under almost all climatic conditions. CIT is widely present in harvested grains, as well as in spoiled dairy products, fruit and vegetable juices, spices, legumes, herbs, and fruits. Scholars have found that the detection rate of CIT in rice from different countries ranges from 13.3% (n=100) to 33.3% (n=30), with contents ranging from 0.42 to 92 μg / kg. 80% of red yeast rice samples tested positive for CIT (n=12). Studies on CIT content in samples of fermented bean curd (n=12), cooked food (n=15), and ham (n=23) showed that 40.4% of the samples were positive, with fermented bean curd samples showing the highest frequency (91.7%) and ham samples showing the highest average concentration (190 μg / kg). CIT content determination in 23 grape juice samples revealed that 9% of the samples contained CIT, with concentrations ranging from 2.5 to 3.5 ng / g. The consumption of CIT-contaminated food and feed by humans and animals has caused serious health problems globally.

[0004] To address the problem of citrinin contamination, various detoxification methods have been proposed, each reducing CIT contamination to some extent. Physical methods include peeling, washing, heating, ultrasound, high hydrostatic pressure, and cold atmospheric pressure plasma. Chemical detoxification methods require the introduction of chemicals, such as ozone, flavonoids, and medium-chain fatty acids during processing, to induce oxidation, reduction, hydrolysis, or other chemical reactions in citrinin, thereby reducing its toxicity. However, these methods are difficult to completely remove the toxin and have drawbacks and limitations, including expensive equipment unsuitable for practical production, loss of food nutrients, and chemical contamination residues. Biological detoxification refers to using microorganisms to alter the original structure of fungi, transforming them into products with lower or even completely non-toxic properties. In recent years, biocontrol has proven to be a feasible, safe, and non-toxic method for degrading citrinin. Researchers isolated a yeast strain, Cryptococcus podzolicus Y3, which can degrade CIT at a concentration of 20 μg / mL, 10 times the EU recommended limit. A manganese peroxidase (MrMnP) from Moniliophthora roreri can completely degrade 10 mg / L of citrinin within 72 hours, with reduced toxicity of the degradation products.

[0005] Microbial detoxification is a specific, effective, irreversible, and environmentally friendly detoxification strategy. With the development of biological detoxification technology, the use of microorganisms to reduce citrinin contamination in food and feed has shown promising application prospects. Summary of the Invention

[0006] The technical problem to be solved by the present invention is to overcome the above-mentioned problems existing in the prior art. First, the present invention provides the adenine-producing budding botrytis cinerea strain MB89.

[0007] A second objective of this invention is to provide the application of the adenine-producing budding botrytis cinerea strain MB89.

[0008] A third objective of this invention is to provide a biological agent containing the adenine-producing Botrytis cinerea strain Blastobotrysadeninivorans MB89.

[0009] The objective of this invention is achieved through the following technical solution:

[0010] Application of *Blastobotrys adeninivorans* MB89 strain in the degradation of citrinin. The *Blastobotrys adeninivorans* MB89 strain was deposited at the Guangdong Provincial Microbial Culture Collection Center on October 8, 2023, with accession number GDMCC No. 63862.

[0011] This invention provides a bacterial strain isolated from Liubao tea that can effectively degrade citrinin. This strain can be used to control citrinin in Liubao tea, ensuring tea safety.

[0012] This invention also provides the application of the adenine-producing Botrytis cinerea strain MB89 in inhibiting the growth of citrinin. The adenine-producing Botrytis cinerea strain MB89 was deposited at the Guangdong Provincial Microbial Culture Collection Center on October 8, 2023, with the accession number GDMCC No. 63862.

[0013] The present invention also provides a microbial preparation containing the strain *Blastobotrys adeninivorans* MB89, which was deposited at the Guangdong Provincial Center for Microbial Culture Collection on October 8, 2023, with accession number GDMCC No. 63862.

[0014] The present invention also provides the application of the above-mentioned microbial preparation in inhibiting the growth of citrinin or degrading citrinin.

[0015] Compared with the prior art, the present invention has the following beneficial effects:

[0016] This invention provides a bacterial strain isolated from Liubao tea that can effectively degrade citrinin. When this strain was added to Liubao tea samples, the citrinin content decreased to 5.29 μg / kg on day 3, and citrinin was undetectable on days 7 and 10. This strain MB89, isolated from Liubao tea, exhibits a strong ability to degrade citrinin even in complex tea matrices. It holds promise for controlling the citrinin content in finished Liubao tea during production, reducing tea safety risks, and can also be used for the prevention and control of citrinin risks in food and feed production. Attached Figure Description

[0017] Figure 1 Image of MB89 colony morphology;

[0018] Figure 2 Microscopic image of MB89; magnification 10×100;

[0019] Figure 3 The image shows the agarose gel electrophoresis results of the PCR products of MB89.

[0020] Figure 4 Phylogenetic tree of MB89;

[0021] Figure 5 Chromatograms of citrinin content before and after MB89 addition (citrinin RT = 4.2 min);

[0022] Figure 6 The degradation ability of MB89 on citrinin within 24 hours;

[0023] Figure 7 The inhibition zone of MB89 and Penicillium citrinum in double-layer plate culture;

[0024] Figure 8 This is the standard curve for citrinin;

[0025] Figure 9 This study describes the degradation of citrinin by MB89 in tea culture medium. Detailed Implementation

[0026] The specific embodiments of the present invention will be further described below. It should be noted that these descriptions are for the purpose of aiding understanding the present invention, but do not constitute a limitation thereof. Furthermore, the technical features involved in the various embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0027] Example 1: Isolation and Identification of Strains

[0028] Includes the following steps:

[0029] (1) Microbial Culture: The Liubao tea raw material used in this experiment was taken from a premium sun-dried green tea sample, batch Y901023, from Guangxi Zhongcha Tea Factory. A multi-point sampling method was used. The sample was placed in a sample bag and then placed in a foam box. 25-30 ice packs were evenly placed around the sample bag to ensure uniform chilling. The samples were transported to the laboratory on the same day. 5g of tea sample was weighed and ground in a sterile mortar, then immediately poured into a blue-mouthed bottle containing 45mL of sterile distilled water and mixed thoroughly. This yielded 10... -1 After incubating the bacterial suspension on a shaker for 30 minutes, take 1 mL of the original solution and proceed with the following steps: -2 10 -3 10 -4 10 -5 10 -6 Serial dilutions were performed to prepare bacterial suspensions. 10 μL of the suspension was taken from a clean bench. -4 10-5 10 -6 200 μL of diluted bacterial suspension was spread onto ISP2 medium and incubated upside down in a 28°C incubator for 24–48 h.

[0030] (2) Isolation and purification: After the colonies have grown, observe their morphological characteristics daily and record the results. Based on the growth characteristics of the colonies, separate the bacteria, pick a single colony, and use the streak plate method to inoculate different morphological strains into ISP2 medium in a clean bench. Incubate at 28℃ for approximately 48 hours. Repeat the purification process at least three times until a single colony is obtained, designated MB89.

[0031] (3) Morphological identification of the strain:

[0032] The colony morphology of strain MB89 is as follows Figure 1 As shown: Colonies are white, opaque, and round, with a dry, dull surface, a raised center, and smooth edges. Microscopic observation reveals... Figure 2 As shown, the cells are oval in shape.

[0033] (4) Molecular identification:

[0034] Extracting microbial DNA: Use a sterile toothpick to pick up a very small amount of isolated and purified single bacterial colony and place it in an eight-tube containing 50 μL of sterile resin. Grind the bacterial cells thoroughly and place the eight-tube in a metal bath at 100°C for 10 min, then centrifuge for 10 min. The resulting supernatant is the template DNA.

[0035] PCR reaction: Primer ITS1 (TCCGTAGGTGAACCTGCGG); Primer ITS4 (TCCTCCGCTTATTGATATGC). Add 100 μL of Mix enzyme, 88 μL of sterile water, 4 μL of primer ITS1, and 4 μL of primer ITS4 to an eight-tube container. Mix well and divide into eight portions (24.5 μL each). Add 0.5 μL of the template DNA to each portion to prepare a 25 μL PCR system. PCR amplification conditions: 95℃ pre-denaturation for 8 min, 94℃ denaturation for 50 s, 52℃ annealing for 45 s, 72℃ extension for 1.5 min, 30 cycles, and a final extension at 72℃ for 10 min. Store the obtained PCR products at -20℃ for later use.

[0036] PCR amplification results were detected by agarose gel electrophoresis: A 1% agarose gel was prepared and heated in a microwave oven for 30 seconds until the solution became clear and transparent. After cooling to approximately 50°C, Goldview I staining agent was added, and the gel was poured onto an assembled gel plate and polymerized for 30 minutes. 2.5 μl of sample / marker was added, and electrophoresis was performed at 110V, 400mA in 1×TAE electrophoresis buffer for approximately 25 minutes. After electrophoresis, the PCR amplification bands were observed on a gel imaging system to ensure they were clear and intact. Figure 3 The PCR products with qualified amplified bands were sent to Shanghai Paisenuo Biotechnology Co., Ltd. for sequencing.

[0037] The 16SRNA sequence of MB89 is shown in SEQ ID NO:1. Sequencing results were aligned using BLAST software on NCBI, and strains with high homology were selected. Phylogenetic analysis was performed using MEGAX software, identifying strain MB89 as *Blastobotrys adeninivorans*. The phylogenetic tree is shown below. Figure 4 .

[0038] The *Blastobotrys adeninivorans* MB89 strain was deposited at the Guangdong Provincial Center for Microbial Culture Collection on October 8, 2023, with accession number GDMCC No. 63862.

[0039] Example 2: Determination of the degradation ability of strain MB89 against citrinin

[0040] MB89 was cultured to an OD of 600 nm = 1, and then added to sterile ISP2 culture medium at a concentration of 2%. A working solution of citrinin standard stock solution was prepared with chromatographic grade methanol to a concentration of 1250 ng / mL, and filtered through a 0.22 μm sterile filter membrane. The sterile citrinin standard working solution and bacterial suspension were added to sterile culture medium to obtain a liquid culture system with a citrinin concentration of 25 ng / mL. This system was incubated at 30 °C and 200 rpm on a shaker, and samples were taken at 0 h, 8 h, 16 h, and 24 h. The samples were filtered through a 0.22 μm filter membrane, stored at -20 °C, and analyzed by HPLC-FLD. High-performance liquid chromatography-fluorescence detector (HPLC-FLD) detection conditions: Column: WATERS C18 column (250mm*4.6mm, 5um); Mobile phase: A is acetonitrile, B is water, C is glacial acetic acid, acetonitrile / ultrapure water / glacial acetic acid = 80 / 19.5 / 0.5; Needle washing solution is 50% methanol-water solution; Injection volume: 10uL; Column temperature: 30±5℃; Fluorescence detector conditions: excitation wavelength 331nm, emission wavelength 500nm.

[0041]

[0042] Chromatograms of citrinin content in the culture medium before and after co-culturing with MB89 are shown below. Figure 5 As shown, strain MB89 degraded 78.84% of citrinin at 8 hours, reached a maximum degradation rate of 81.84% at 16 hours, and maintained a degradation rate of 79.42% at 24 hours. Figure 6 This demonstrates excellent potential for degrading citrinin.

[0043] Example 3: Inhibitory effect of strain MB89 on the growth of Penicillium citrinum

[0044] Using the double-layer agar plate method, pour ISP2 into a petri dish as the lower layer. After solidification, use a sterile bamboo skewer to pick up a single MB89 colony and streak two parallel lines 2-3 cm long on the plate. Incubate at 28℃ for 24-36 hours until mycelial growth occurs. Add a 10% concentration of Penicillium citrinum spores... 6 Pour PDA semi-solid medium (number of cells / mL) into a petri dish, cover it with the lower layer of medium containing MB89, and incubate at 28°C for 48-170 h. Figure 7 It can be seen that a 36mm inhibition zone appears around the MB89 bacterial moss, indicating that the growth of strain MB89 is not affected by Penicillium citrinum and has a certain degree of ability to inhibit the growth of Penicillium citrinum in the surrounding area.

[0045] Example 4: CIT degradation ability of strain MB89 in tea matrix

[0046] The specific steps include:

[0047] (1) Sample preparation: After crushing the raw Liubao tea leaves, adjust the moisture content to about 30%, accurately weigh 100g and place it in a 250mL Erlenmeyer flask for sterilization. Expand the culture of MB89 to OD 600nm=1, and add it to the tea culture medium at a dosage of 2%. Prepare the citrinin standard stock solution into a working solution of 250ng / mL with chromatographic grade methanol, filter it through a 0.22μm sterile filter membrane and store it for later use. Add the sterile citrinin working solution and bacterial suspension to the tea culture medium, mix them evenly with a sterile bamboo stick to obtain a Liubao tea re-screening culture medium with a citrinin concentration of 25μg / kg, and incubate it in a constant temperature incubator at 28℃. During the incubation process, add an appropriate amount of sterile water according to the weight change of the culture medium to maintain the moisture. Take samples at 0d, 3d, 7d and 10d of the incubation period and store them at -20℃ for later use.

[0048]

[0049] (2) Preparation of the standard curve for citrinin content ( Figure 8): Dissolve 1 mg of citrinin standard in 1 mL of methanol to prepare a stock solution, and then prepare citrinin standard solutions with concentrations of 0.5 ng / mL, 1 ng / mL, 5 ng / mL, 10 ng / mL, 25 ng / mL, 50 ng / mL and 100 ng / mL respectively, and perform HPLC-FLD detection (detection conditions as above).

[0050] (3) Purification of nucleic acid aptamers from tea samples: Accurately weigh 4g of crushed tea sample and add 16mL of 70% methanol-water extraction buffer. First, shake at 180rpm for 15 minutes at room temperature, then sonicate for 15 minutes at room temperature, and finally shake at 180rpm for 30 minutes at room temperature to complete the extraction. After filtration, the obtained extract is stored at -20℃ for later use. The aptamer sequence of citrinin (synthesized by Sangon Biotech) is: 5-GGCCAGGCGGGGCCTGTTCGCTGGGGCCGTGTCTTCGGCTCGCTCGGTGTTGTTTGGCG-3'. The nucleic acid aptamer is diluted to 10mM with BB buffer and stored at room temperature or 4℃ for later use. Add 50 μL of diluted citrinin nucleic acid aptamer to every 50 μL of extraction buffer and mix with 400 μL of BB buffer. Incubate for 1 h (mixing gently during incubation). Transfer the liquid to an ultrafiltration tube and centrifuge at 7000×g for 20 min until the liquid is completely eluted. Discard the filtrate and replace with a clean ultrafiltration tube sleeve. Add 80 μL of citrinin elution buffer to the ultrafiltration tube and incubate for 10 min (mixing gently during incubation). Centrifuge at 7000×g for 15 min. Repeat the above elution steps twice. Filter the collected filtrate through a 0.22 μm organic filter and store at -20℃ for instrumental analysis.

[0051] from Figure 9 The results showed that the citrinin content in tea samples containing MB89 decreased to 5.29 μg / kg on day 3, and citrinin was not detected on days 7 and 10. These results indicate that strain MB89, isolated from Liubao tea, has a strong ability to degrade citrinin even in complex tea matrices, and holds promise for use in controlling the citrinin content in finished Liubao tea during production, thus reducing the safety risks associated with tea consumption.

[0052] The embodiments of the present invention have been described in detail above, but the present invention is not limited to the described embodiments. For those skilled in the art, various changes, modifications, substitutions, and variations can be made to these embodiments without departing from the principles and spirit of the present invention, and these variations still fall within the protection scope of the present invention.

Claims

1. Adenine-producing Botrytis cinerea ( Blastobotrys adeninivorans ) MB89 The application of the strain in the degradation of citrinin is characterized by, The adenine-producing Botrytis cinerea ( Blastobotrys adeninivorans ) MB89 The strain was deposited at the Guangdong Provincial Center for Microbial Culture Collection on October 8, 2023, with accession number GDMCC No. 63862.

2. Adenine-containing Botrytis cinerea ( Blastobotrys adeninivorans ) MB89 The application of the strain in inhibiting the growth of Penicillium citrinum is characterized by, The adenine-producing Botrytis cinerea ( Blastobotrys adeninivorans ) MB89 The strain was deposited at the Guangdong Provincial Center for Microbial Culture Collection on October 8, 2023, with accession number GDMCC No. 63862.

3. Contains adenine-containing Botrytis cinerea (Botrytis cinerea budding yeast) Blastobotrys adeninivorans ) MB89 The microbial preparation of the strain is characterized by, The adenine-producing Botrytis cinerea ( Blastobotrys adeninivorans ) MB89 The strain was deposited at the Guangdong Provincial Center for Microbial Culture Collection on October 8, 2023, with accession number GDMCC No. 63862.

4. The use of the microbial preparation of claim 3 in inhibiting the growth of Penicillium citrinum or degrading citrinin.

Images