Dendrobium candidum extract and use thereof in preparing alcoholism-relieving preparation

Abstract

This invention relates to the field of Dendrobium nobile technology, specifically to Dendrobium nobile extract and its application in the preparation of hangover remedies. The invention involves extracting an ethanol extract from Dendrobium nobile. A fermented milk is then prepared using three probiotic strains as a culture medium and the ethanol extract as a fermentation medium. The active ingredients in this fermented milk are significantly higher than those in the ethanol extract. Furthermore, the ethanol extract has hangover-relieving and liver-protecting effects.

Description

Technical Field

[0001] This invention relates to the field of Dendrobium nobile technology, specifically to Dendrobium nobile extract and its application in the preparation of hangover remedies. Background Technology

[0002] Dendrobium devonianum Paxt., also known as toothed dendrobium or purple-skinned orchid, is a top-quality medicinal dendrobium. It possesses properties that benefit the stomach and promote the production of body fluids, as well as nourishing yin and clearing heat. This perennial epiphytic herb cannot grow in ordinary soil and typically grows on rocks or tree trunks under trees, often alongside mosses. It absorbs nutrients and moisture from the air through its exposed aerial roots. Because it prefers warm, humid, and shady environments, the deep forests of subtropical regions, with their mild winters and cool summers, high humidity, and ample diffused light, are ideal for its growth. Specifically, suitable growing conditions include: altitudes of 800–1800m, annual rainfall of 1100–1500mm, average annual temperature of 18–25℃, shade levels of 40%–50%, and air humidity of 70%–80% in mountain forests.

[0003] Reported chemical components of *Dendrobium nobile* include polysaccharides, alkaloids, phenanthrenes, bibenzyl groups, phenolic acids, flavonoids, and phenylpropanoids, as well as trace elements, amino acids, and other components. *Dendrobium nobile* exhibits antioxidant activity, which is related to its phenolic acid and acidic polysaccharide content. Studies have shown that *Dendrobium nobile* polysaccharides and water extracts possess immunomodulatory activity. A 60% ethanol extract of *Dendrobium nobile* has anti-immunofatigue effects. Previous studies have shown that the chemical components of *Dendrobium nobile*, such as polysaccharide content and trace element types, are similar to those of *Dendrobium officinale*, and it possesses similar antioxidant and immunomodulatory effects. Furthermore, Yunnan Province has now included *Dendrobium nobile* in its food management scope; therefore, foods and medicines using *Dendrobium nobile* as a main ingredient have enormous development potential. Summary of the Invention

[0004] Therefore, we should further develop products made from Dendrobium nobile and give full play to its unique advantages as a plant that can be used for both medicinal and edible purposes.

[0005] One objective of this invention is to provide a method for preparing fermented milk, comprising: obtaining an ethanol extract of Dendrobium nobile; preparing seeds containing *Meggentodoxa cuneata*, *Lactobacillus bulgaricus*, and *Streptococcus thermophilus*; preparing a fermentation culture medium containing the ethanol extract of Dendrobium nobile; inoculating the seeds into the fermentation culture medium for fermentation; and harvesting fermented milk.

[0006] In the preparation method, the preparation method of the Dendrobium nobile ethanol extract includes: preparing Dendrobium nobile coarse powder by placing dried Dendrobium nobile in an oven at 80°C and drying it at a constant temperature until constant weight, pulverizing it and passing it through a 60-mesh sieve for later use; after ultra-fine pulverization of the Dendrobium nobile coarse powder, a certain amount of Dendrobium nobile capsules from Huoshan are taken, pulverized by a pulverizer, passed through a 0.425mm sieve, and refluxed successively with petroleum ether and 80% ethanol until colorless.

[0007] In the preparation method, the ethanol extract of Dendrobium nobile contains 10.7 mg / g polysaccharide.

[0008] In the preparation method, the Dendrobium nobile ethanol extract contains 5.7 mg / kg ethyl p-hydroxycinnamate, 88.9 mg / kg N-trans-p-coumaryltyramine, 10.8 mg / kg N-coumaryl dopamine, 30.8 mg / g p-hydroxyphenylpropionic acid, 2.3 mg / kg p-hydroxycinnamic acid, 6.8 mg / kg protocatechuic acid, 11.5 mg / g p-hydroxybenzoic acid, 3.1 mg / kg citric acid, 20.1 mg / kg vanillin, 18.5 mg / kg p-hydroxybenzaldehyde, 134.8 mg / kg methyl protocatechuic acid, and 152.8 mg / kg syringic acid.

[0009] In the preparation method, the fermentation medium contains 65 g / L sucrose, 120 g / L skim milk powder, 5 g / L Dendrobium nobile ethanol extract, 1.5 g / L potassium dihydrogen phosphate, 0.5 g / L magnesium sulfate, and 0.35 g / L ammonium sulfate.

[0010] In the preparation method, the inoculum size of *Lactobacillus bulgaricus* is 3 × 10⁻⁶. 6 CFU / mL, the inoculum size of the thermophilic streptococcus was 7 × 10⁻⁶ CFU / mL. 6 CFU / mL, the inoculum size of the *Megkistrodon halys* was 1×10⁻⁶. 6 CFU / mL of Mage yeast.

[0011] In the preparation method, the fermentation conditions include: fermentation at a constant temperature of 42°C and 180 r / min until the acidity reaches 45°T.

[0012] One objective of this invention is to provide a fermented milk prepared by the aforementioned method. The fermented milk comprises...

[0013] The contents of the following are listed: ethyl p-hydroxycinnamate 324.6 mg / kg, N-trans-p-coumaroyltyramine 1.06 g / kg, N-coumaroyl dopamine 896.5 mg / kg, p-hydroxyphenylpropionic acid 95.2 mg / g, p-hydroxycinnamic acid 39.5 mg / kg, protocatechuic acid 49.7 mg / kg, p-hydroxybenzoic acid 63.5 mg / g, citric acid 35.3 mg / kg, vanillin 45.9 mg / kg, p-hydroxybenzaldehyde 43.9 mg / kg, methyl protocatechuic acid 435.5 mg / kg, and syringic acid 782.5 mg / kg.

[0014] 2,3-Butanedione (diacetyl) 20.91 mg / kg, 3-hydroxy-2-butanone 14.30 mg / kg, 2-hydroxy-3-pentanone 6.82 mg / kg, 1-hydroxy-2-propanone 21.54 mg / kg, 1,2-cyclopentanedione 12.69 mg / kg, 2-nonanone 6.53 mg / kg, acetylacetone 35.63 mg / kg, dihydro-4-hydroxy-2(3H)-furanone 22.65 mg / kg, 2-methyl-3-pentanol 12.51 mg / kg, 2-furanyl... Alcohol 14.57 mg / kg, hexanal 2.85 mg / kg, furfural 57.52 mg / kg, benzaldehyde 6.52 mg / kg, 5-hydroxymethyl-2-furanaldehyde 52.49 mg / kg, acetic acid 12.54 mg / kg, butyric acid 35.58 mg / kg, hexanoic acid 52.49 mg / kg, octanoic acid 21.54 mg / kg, decanoic acid 2.86 mg / kg, methyl 2-methyl-2-acrylate 11.22 mg / kg, 2-hydroxy-γ-butyrolactone 14.77 mg / kg.

[0015] One objective of this invention is to provide a hangover remedy comprising fermented milk prepared by the aforementioned method.

[0016] One objective of this invention is to provide an application of the fermented milk prepared by the aforementioned method in the preparation of hangover remedies.

[0017] This invention involves extracting an ethanol extract from Dendrobium nobile. A fermented milk was then produced using three probiotic strains and the ethanol extract as a culture medium. The active ingredients in this fermented milk were significantly higher than those in the ethanol extract. Furthermore, the ethanol extract possesses hangover-relieving and liver-protecting properties. Attached Figure Description

[0018] Figure 1 The levels of ethanol (A) and acetaldehyde (B) in the serum of mice in each group were measured.

[0019] Figure 2 The levels of ALT and AST in the livers of mice in each group were measured.

[0020] Figure 3 The activity of ADH and ALDH in the liver of mice in each group was measured.

[0021] Figure 4 The content of P450 in the liver of mice in each group is shown.

[0022] Figure 5 The NO content in the gastric tissue of mice in each group is shown.

[0023] Figure 6 The content of PGE2 in the gastric tissue of mice in each group is shown.

[0024] Figure 7 The relative expression levels of Nrf2 and Keap1 in the liver tissue of mice in each group are shown.

[0025] Figure 8 The results show the gastric emptying rate of mice in each group.

[0026] Figure 9 The relative mRNA expression levels of c-kit and SCF in the stomach of mice in each group are shown. Detailed Implementation

[0027] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention. Reagents not specifically described in detail in this invention are all conventional reagents and are commercially available; methods not specifically described in detail are all conventional experimental methods and can be obtained from the prior art.

[0028] Example 1: Preparation of ethanol extract of Dendrobium nobile

[0029] (1) Preparation of crude powder of Dendrobium nobile: Place the dried Dendrobium nobile in an oven and dry it at a constant temperature of 80°C until it reaches a constant weight. Then crush it and pass it through a 60-mesh sieve for later use.

[0030] (2) After the coarse powder of Dendrobium nobile is ultra-finely pulverized, a certain amount of Dendrobium nobile from Huoshan is pulverized by a pulverizer, passed through a 0.425mm sieve, and refluxed with petroleum ether and 80% ethanol in turn until colorless. After air drying, it is ready for use.

[0031] (3) Particle size determination: A certain amount of ultrafine powder of Dendrobium officinale after ultrafine grinding was placed in a beaker, a certain amount of 95% ethanol was added, and then the particle size was determined by laser particle size analyzer.

[0032] (4) The polysaccharide content in the ethanol extract of *Dendrobium nobile* was determined using the phenol-sulfuric acid method. The polysaccharide extraction rate of *Dendrobium nobile* was calculated using the following formula: Polysaccharide extraction rate of *Dendrobium nobile* (mg / g) = C × V × N / M, where: C is the polysaccharide concentration calculated from the standard curve, mg / mL; V is the volume of the final volume, mL; N is the dilution factor; and M is the mass of the dried *Dendrobium nobile* powder, g. The results, obtained through testing and calculation, showed that the polysaccharide content in the *Dendrobium nobile* extract obtained in the above steps was 10.7 mg / g of the ethanol extract.

[0033] Example 2: Detection of glycoproteins in the ethanol extract of Dendrobium nobile

[0034] The ethanol extract was deproteinized using the Sevage method, precipitated with 90% ammonium sulfate for 12 hours, centrifuged at 5000 rpm for 15 minutes, dialyzed for 48 hours (with water changed every 6 hours), concentrated with polyethylene glycol 10000, and then freeze-dried under vacuum to obtain the crude glycoprotein.

[0035] The crude glycoprotein solution (20 mg / mL) was filtered through a microporous membrane and then loaded onto a DEAECellulose-52 anion exchange column (1.6 cm × 20 cm). A linear gradient elution of 0–1.0 mol / L NaCl solution was performed at a rate of 1 mL / min, with 5 mL collected per tube. Polysaccharide elution was detected at 490 nm using the phenol-sulfuric acid method, and protein elution was detected at 280 nm using the Bradford method. The solutions from tubes showing both polysaccharide and protein detection were combined, concentrated using a stirred ultrafiltration apparatus, dialyzed, freeze-dried, and stored at 4°C to obtain the glycoprotein. The glycoprotein content, as determined by the phenol-sulfuric acid method, was 14.3 mg / g in the ethanol extract.

[0036] Example 3: Detection of active ingredients in the ethanol extract of Dendrobium nobile

[0037] 800g of the ethanol extract was suspended in water and extracted sequentially with petroleum ether, ethyl acetate and n-butanol to obtain 123.2g of petroleum ether extract, 119.4g of ethyl acetate extract and 59.3g of n-butanol extract.

[0038] (1) Component detection in petroleum ether extract

[0039] Sample preparation: The petroleum ether extract was purified using a silica gel column (200-300 mesh), eluted with a petroleum ether-ethyl acetate gradient (20:80→80:20), and the eluent was purified using Sephadex LH-20 (chloroform-methanol = 1:1). The eluent was concentrated to obtain sample solution 1. HPLC analysis was performed using a Waters Symmetry Prep C18 column (7.8 mm × 300 mm, 5 μm), with 64% methanol as the mobile phase and a flow rate of 3.0 mL / min. A standard curve was prepared using the same standard, ethyl p-hydroxycinnamate (from Huayuan.com), and the ethyl p-hydroxycinnamate content was calculated based on the standard equation fitted to the standard curve. The results showed that the ethyl p-hydroxycinnamate content in the ethanol extract of *Dendrobium nobile* was 5.7 mg / kg.

[0040] (2) Component detection in ethyl acetate extract

[0041] For sample preparation, the ethyl acetate extract was separated using a silica gel column (200-300 mesh) and eluted with a chloroform-methanol gradient system for 10 bed volumes. The eluent from the third bed volume was loaded onto a Sephadex LH-20 eluting system and eluted with a chloroform-methanol mixture of 1:1 for 3 bed volumes. The eluent from the second bed volume, after washing with methanol and chloroform, was filtered to obtain sample solution 2. The eluent from the fourth bed volume of the chloroform-methanol gradient elution was separated using a Sephadex LH-20 eluting system (chloroform-methanol = 1:1) to obtain sample solution 3. The eluent from the second bed volume of the chloroform-methanol gradient elution was eluted using a Sephadex LH-20 eluting system (chloroform-methanol = 1:1) to obtain sample solutions 4 and 5.

[0042] Sample solutions 2, 3, 4, and 5 were analyzed by HPLC using a Waters Symmetry Prep C18 column (7.8 mm × 300 mm, 5 μm) with a mobile phase of 40% methanol gradient elution to 60% methanol at a flow rate of 4.0 mL / min. The same standards N-trans-p-coumaryltyramine (CAS: 36417-86-4, purity: 98% HPLC, Wuhan Dingquan Technology Co., Ltd.), N-coumaryl dopamine (Catalog No.: 70185-64-7; purity: 99%; Wuhan Xinxin Jiali Biotechnology Co., Ltd.), p-hydroxyphenylpropionic acid (CAS: 501-97-3, purity: 98% HPLC, Nanjing Jubai Biomedical Technology Co., Ltd.), and p-hydroxycinnamic acid (Catalog No. JKB0632, Shanghai Jingke Chemical Technology Co., Ltd.) were used to perform standard curve analysis. The content of each compound was calculated based on the standard equation fitted to the standard curve.

[0043] The results showed that the content of N-trans-p-coumaryltyramine in the ethanol extract of Dendrobium nobile was 88.9 mg / kg, the content of N-coumaryl dopamine in the ethanol extract of Dendrobium nobile was 10.8 mg / kg, the content of p-hydroxyphenylpropionic acid in the ethanol extract of Dendrobium nobile was 30.8 mg / g, and the content of p-hydroxycinnamic acid in the ethanol extract of Dendrobium nobile was 2.3 mg / kg.

[0044] The eluent from the fifth bed volume of the chloroform-methanol gradient elution system was separated using a Sephadex LH-20 (chloroform-methanol = 1:1) to obtain sample solution 6. HPLC analysis was performed using a Waters Symmetry Prep C18 column (7.8 mm × 300 mm, 5 μm) with 30% methanol as the mobile phase at a flow rate of 4.0 mL / min. A standard curve was established for protocatechuic acid (CAS: 99-50-3, purity: ≥99%, Nanjing Hegu Life Biotechnology Co., Ltd.). The content of each compound was calculated based on the standard equation fitted to the standard curve. The results showed that the protocatechuic acid content in the ethanol extract of *Dendrobium nobile* was 6.8 mg / kg.

[0045] The combined Fr.(11~12) Sephadex LH-20 (chloroform-methanol = 1:1) elution fraction was sample solution 7. HPLC analysis was performed using a Waters Symmetry Prep C18 column (7.8 mm × 300 mm, 5 μm) with 42% methanol as the mobile phase at a flow rate of 4.0 mL / min. A standard curve was established using p-hydroxybenzoic acid (CAS: 99-96-7, Shandong Fantai Fine Chemicals Biotechnology Co., Ltd.). The content of each compound was calculated based on the standard equation fitted to the standard curve. The results showed that the p-hydroxybenzoic acid content in the ethanol extract of *Dendrobium nobile* was 11.5 mg / g.

[0046] (3) Component detection in n-butanol extract

[0047] The n-butanol extract was dispersed in deionized water and sonicated to ensure uniform dispersion. It was then loaded onto a macroporous resin column (D101) and eluted sequentially with pure water, 10%, 30%, 60%, and 95% ethanol by volume. The 10% ethanol eluent and the 30% ethanol eluent were recovered under reduced pressure.

[0048] The fraction eluted with 10% ethanol was eluted with Sephadex G-15 followed by two bed volumes of pure water to obtain sample solution 8. Sample solution 8 was then eluted with a Phenomenex Synergi 4μm Hydro-RP80 A column (21.2mm × 250mm, 4μm) over 30 min using a gradient elution from 40% methanol to 60% methanol at a flow rate of 10.0 mL / min. HPLC analysis was performed, and a standard curve was established using citric acid (purity: 98.0%, Yunnan Xili Biotechnology Co., Ltd.). The results showed that the citric acid content in the ethanol extract of *Dendrobium nobile* was 3.1 mg / kg.

[0049] The 30% ethanol eluent was used as sample solution 9. The sample solution was loaded onto a Waters Symmetry Prep C18 column (7.8 mm × 300 mm, 5 μm), and eluted with a methanol-water gradient of 1:19 to 1:1 at a flow rate of 10.0 mL / min. HPLC analysis was performed, and standard curves were established using vanillin (CAS: 121-33-5, purity: 98% HPLC, Sichuan Bio-Krui Biotechnology Co., Ltd.), p-hydroxybenzaldehyde (CAS: 123-08-0, purity: 99%, Yantai Better Chemical Technology Co., Ltd.), and syringic acid (CAS: 530-57-4, purity: 99%, Changzhou Shangke Pharmaceutical Chemical Materials Co., Ltd.). The content of each compound was calculated based on the standard equation fitted to the standard curve. The results showed that the ethanol extract of Dendrobium nobile contained 20.1 mg / kg vanillin, 18.5 mg / kg p-hydroxybenzaldehyde, 134.8 mg / kg methyl protocatechuic acid, and 152.8 mg / kg syringic acid.

[0050] Example 4: Fermentation of ethanol extract of Dendrobium nobile

[0051] (1) Seed preparation

[0052] Lactobacillus bulgaricus (No.: BMZ124644, Brand: Mingzhoubio) and Streptococcus thermophilus (No.: BMZ132094, Brand: Mingzhoubio) were activated and cultured at 28℃ and 180 rpm for 2 days with 200 g / L potato starch and 20 g / L activation culture medium, respectively. Then, they were spread on solid PDA culture base and activated and cultured at 28℃ and 180 rpm for 4 days. Saccharomyces cerevisiae (No.: BMZ134170, Brand: Mingzhoubio) was activated with YM culture medium (without agar) for 2 days to obtain seed culture.

[0053] (2) Fermentation

[0054] Fermentation medium was prepared as follows: 65g sucrose, 120g skim milk powder, 5g Dendrobium officinale ethanol extract, 1.5g potassium dihydrogen phosphate, 0.5g magnesium sulfate, 0.35g ammonium sulfate, and 1000mL distilled water. The mixture was homogenized twice under a pressure of 20MPa, pasteurized at 70℃ for 30min, and then cooled to 40℃.

[0055] Experimental group: The final concentration of inoculum added to the fermentation medium was 3×10⁻⁶. 6 CFU / mL Lactobacillus bulgaricus, 7×10 6 CFU / mL Streptococcus thermophilus and 1×10 6 CFU / mL of Mickey yeast was fermented at a constant temperature of 42℃ and 180r / min until the acidity reached 45°T. Fermentation was then stopped, and the fermented yogurt was refrigerated at 4℃ overnight to obtain fermented milk.

[0056] Control group: 3 × 10⁶ cells were inoculated into the fermentation medium. 6 CFU / mL Lactobacillus bulgaricus, 7×10 6 CFU / mL Streptococcus thermophilus was used as seed culture for fermentation under the same conditions.

[0057] Determination of titratable acidity (TA): Accurately weigh 10.0 g of fermented milk sample into an Erlenmeyer flask using an electronic balance. Add 20 mL of CO2-free distilled water, shake well, add 1 mL of phenolphthalein indicator, shake well again, and titrate with 0.1 mol / L NaOH standard solution until a faint pink color appears and does not disappear within 5 seconds. Record the volume (mL) of standard NaOH solution consumed. Perform three parallel determinations for each sample.

[0058] (3) Detection of active substances in fermented milk

[0059] Fermented milk was extracted sequentially with petroleum ether, ethyl acetate, and n-butanol to obtain petroleum ether extract, ethyl acetate extract, and n-butanol extract. Sample solutions 1-9 were prepared from the petroleum ether extract, ethyl acetate extract, and n-butanol extract using the same method described above, and the content of active ingredients in each sample was determined by HPLC, thereby calculating the content of active ingredients in the fermented milk.

[0060] The test results showed that the active ingredient content in the fermented milk provided by the experimental group was as follows: ethyl p-hydroxycinnamate 324.6 mg / kg, N-trans-p-coumaryltyramine 1.06 g / kg, N-coumaryl dopamine 896.5 mg / kg, p-hydroxyphenylpropionic acid 95.2 mg / g, p-hydroxycinnamic acid 39.5 mg / kg, protocatechuic acid 49.7 mg / kg, p-hydroxybenzoic acid 63.5 mg / g, citric acid 35.3 mg / kg, vanillin 45.9 mg / kg, p-hydroxybenzaldehyde 43.9 mg / kg, methyl protocatechuic acid 435.5 mg / kg, and syringic acid 782.5 mg / kg.

[0061] The fermented milk prepared in the control group contained 6.4 mg / kg of ethyl hydroxycinnamate, 85.9 mg / kg of N-trans-coumaroyltyramine, 15.9 mg / kg of N-coumaroyldopamine, 32.4 mg / g of p-hydroxyphenylpropionic acid, 1.8 mg / kg of p-hydroxycinnamic acid, 5.9 mg / kg of protocatechuic acid, 6.2 mg / g of p-hydroxybenzoic acid, 4.6 mg / kg of citric acid, 15.8 mg / kg of vanillin, 16.8 mg / kg of p-hydroxybenzaldehyde, 46.3 mg / kg of methyl protocatechuic acid, and 89.4 mg / kg of syringic acid. All of these levels were lower than those in fermented milk prepared by simultaneous fermentation with Lactobacillus bulgaricus, Streptococcus thermophilus, and Saccharomyces megacephala.

[0062] (4) Detection of other flavor compounds in fermented milk

[0063] Sample preparation: Take 5g of each fermented milk sample, place it in a 25mL extraction bottle, add 5mL of ultrapure water and 2g of NaCl, mix thoroughly, heat to 45℃, and salt out for 30min before testing.

[0064] GC detection, TRACEDSQ GC / MS coupled instrument, extraction head (50 / 30μm DVB / CAR / PDMS), manual solid phase microextraction (SPME) injector, Supelco, USA; DB-WAX (30m×0.25mm×0.25μm) flexible quartz capillary column, Agilent Technologies, USA.

[0065] Connect the solid-phase microextraction (SPE) head to the injector, insert the extraction head syringe into the gas chromatograph injection port, advance the handle to extend the extraction fiber head, and age it at 270℃ for about 1 hour until no chromatographic peaks appear and the baseline is stable. Then retract the fiber head. Insert the aged extraction head into the sample in the extraction flask, push the extraction fiber head in 1 cm for headspace adsorption extraction (headspace volume approximately 10 mL), and magnetically heat and stir at 45℃ for 40 minutes. For sample injection and analysis: retract the fiber head after adsorption and extraction, rapidly inject the sample, extend the fiber head, and perform thermal desorption at 250℃ for 5 minutes before analysis.

[0066] GC conditions: Temperature programmed ramp from room temperature to 40°C, held for 2.5 min, ramped at 5°C / min to 200°C, then ramped at 10°C / min to 240°C, held for 5 min; injection port temperature 250°C; transfer line temperature 230°C; carrier gas: He, flow rate 1.0 mL / min; splitless injection. MS conditions: Ionization mode: EI, 70 eV; ion source temperature: 250°C; mass scan range: 35–400 amu; emission current: 100 μA; detection voltage: 1.4 kV.

[0067] Mass spectrometry data of each component were automatically retrieved using a randomly carried Xcalibur workstation with the NIST2002 standard library, and the relative content of each component was calculated using the peak area normalization method.

[0068] The results are shown in Table 1, with " / " indicating no detection. The fermented milk prepared in the experimental group contained abundant flavor compounds, including ketones, alcohols, aldehydes, acids, and esters, and the content was higher than that in the control group.

[0069] Table 1. Results of the detection of flavor substances in fermented milk

[0070] 2,3-Butanedione (Diacetyl) 4.24 20.91 6.05 3-Hydroxy-2-Butanone 12.01 14.30 / 2-Hydroxy-3-pentanone 13.84 6.82 / 1-Hydroxy-2-propanone 12.43 21.54 18.36 1,2-Cyclopentanedione 23.85 12.69 6.17 2-Nonone 14.49 6.53 / Acetylacetone 5.92 35.63 22.48 Dihydro-4-hydroxy-2(3H)-furanone 38.31 22.65 16.45 2-Methyl-3-pentanol 13.45 12.51 4.35 2-Furfural methanol 21.39 14.57 9.25 Hexanal 6.45 2.85 / furfural 16.67 57.52 41.96 benzaldehyde 18.21 6.52 / 5-Hydroxymethyl-2-furanaldehyde 37.18 52.49 / Acetic acid 16.39 12.54 / butyric acid 20.68 35.58 28.45 hexanoic acid 25.50 52.49 36.69 bitter 29.74 21.54 / n-decanoic acid 33.64 2.86 / 2-Methyl-2-acrylate 4.71 11.22 9.48 2-Hydroxy-γ-Butyrolactone 32.05 14.77 10.42

[0071] Example 5

[0072] 1. Laboratory animals and test samples

[0073] Healthy mice, weighing 20g–30g, were all clean animals, quarantined, and provided with free access to water. They were supplied by Wuhan Hualianke Biotechnology Co., Ltd. The ambient temperature was (23±2)℃, the humidity was 40%–60%, and the light-dark cycle was 12h.

[0074] The fermented milk provided by the experimental group and control group above were used as test samples for the experimental group and control group I, respectively, and the ethanol extract was used as the test sample for control group II.

[0075] 2. Establishment of a mouse model of alcohol intoxication

[0076] Seventy-five Kunming mice were selected. Before the experiment, the animals were fasted for 12 hours and randomly divided into five groups of 15 mice each. The mice were administered 56° Red Star Erguotou (a type of Chinese liquor) by gavage at doses of 0.1, 0.2, 0.3, 0.4, and 0.5 mL / 10g body weight, respectively. After gavage, the mice were immediately placed on a vertical wire mesh. The climbing time, tolerance time, intoxication time, intoxication rate, and mortality rate were recorded. The dose with the highest intoxication rate and the lowest mortality rate was 0.4 mL / 10g body weight for the acute alcohol poisoning experiment in mice (see Liang J, Li Q, Lin B, et al. Comparative studies of oral administration of marine collagen peptides from Chum Salmon (Oncorhyn chusketa) pre-and post-acuteetha NO lintoxication in female Sprague Dawleyrat[J]. Food Funct, 2014, 5(9): 2078-2085).

[0077] 3. Group Experiment

[0078] Intoxicated mice were divided into a model group, an experimental group, a control group I, and a control group II. The experimental group mice were administered the test substance provided by the experimental group via gavage at 0.4 g / kg body weight. Control group I mice were administered the test substance provided by control group I via gavage at the same dose of 0.4 g / kg body weight. Control group II mice were administered the test substance provided by control group II via gavage at the same dose of 0.4 g / kg body weight. The model group was administered the same volume of physiological saline via gavage. In addition, normal mice were used as the normal control group.

[0079] In the above grouped experiments, after the initial gavage, mice in each group were administered the same dose of the test substance three times consecutively, with each gavage interval of 2 hours. Simultaneously, they were administered 3 mL / kg of semi-solid nutritional rice paste (10g sodium carboxymethyl cellulose, 16g whole milk powder, 8g starch, 2g charcoal powder, and 200g distilled water). Eight hours later, the mice were sacrificed, the cardia and pylorus were ligated, and the entire stomach was harvested. The total stomach weight was measured, and the stomach tissue was cut along the greater curvature. After rinsing the stomach contents, the net stomach weight was measured. The gastric emptying rate (%) was calculated as: [weight of solid paste - (total stomach weight - net stomach weight) / weight of solid paste] × 100%. Additionally, the expression of relevant genes in the gastric tissue was detected, as shown below.

[0080] 4. Serum biochemical preparation and detection

[0081] Two hours after gavage, blood was collected from the eyeballs of mice, and serum was separated. The concentrations of ethanol and acetaldehyde in the serum were determined by gas chromatography (Deng Q, Zhou X, Chen H. Optimization of enzyme-assisted extraction of Fructus Moripolysaccharides and its activities on antioxidant and alcoholdehydrogenase[J]. Carbohydr Polym, 2014, 111:775-782). The results are as follows: Figure 1 As shown, the experimental group was able to significantly reduce the levels of ethanol and acetaldehyde in the serum of intoxicated mice, while the control groups I and II were not.

[0082] 5. Liver assembly preparation and detection

[0083] In addition, mice were euthanized by cervical dislocation, and the liver was removed. After the liver surface was blotted clean with filter paper to remove water and blood, a 10% homogenate was prepared with 9 times the mass of physiological saline. The homogenate was centrifuged at 4°C for 15 min (3000 r / min), and the supernatant was collected. The aspartate aminotransferase (AST), alanine aminotransferase (ALT), alcohol dehydrogenase (ADH), aldehyde dehydrogenase (ALDH), and cytochrome P450 (CYP7A1) in the liver were measured according to the kit instructions (Shanghai Youxuan Biotechnology Co., Ltd.) kit (catalog number: XYEB053Hu, Shanghai Xinyu).

[0084] like Figure 2 As shown, ALT and AST levels in the model group mice were significantly higher than those in the normal group (P<0.05), indicating that alcohol caused some damage to liver function. In contrast, ALT and AST levels in the experimental group mice were significantly lower than those in the model group (P<0.05), while no significant changes were observed in control groups I and II. This suggests that the fermented milk provided in the experimental group has a certain protective effect against hepatocellular damage caused by acute alcohol poisoning.

[0085] The liver is both the largest gland in the human body and an extremely important metabolic organ. 90% of the ethanol in the blood is metabolized in the liver. When the ethanol concentration in the liver is low, it is mainly metabolized by alcohol dehydrogenase (ADH) and aldehyde dehydrogenase (ALDH). ADH converts ethanol to acetaldehyde, which, with the participation of ALDH, is converted to acetic acid, and finally oxidized to carbon dioxide and water, which are then excreted from the body. When the ethanol concentration exceeds 10 mM, the ethanol oxidation system is activated as the main alcohol metabolism pathway. In the presence of cytochrome P450 and the participation of nicotinamide adenine dinucleotide phosphate (NADPH), ethanol is converted to acetaldehyde. P450 is mainly distributed in the endoplasmic reticulum and mitochondria, with the highest concentration found in liver microsomes.

[0086] like Figure 3 , 4 As shown, compared with the model group mice, the contents of ADH, ALDH, and P450 in the liver tissue homogenate of the experimental group mice were significantly increased (P < 0.05), while there were no significant changes in control groups I and II. The results indicate that the fermented milk provided in the experimental group can increase the contents of ADH, ALDH, and P450 in the liver, thereby accelerating alcohol metabolism and exerting a sobering effect.

[0087] 6. Detection of biochemical indicators in gastric tissue

[0088] The NO and PGE2 content in mouse gastric tissue homogenate were determined by enzyme-linked immunosorbent assay (ELISA) (reagent kit: Zhengzhou Weier Biotechnology Co., Ltd.), and the operation was strictly performed in accordance with the reagent kit instructions.

[0089] NO is an important defense factor for the gastric mucosa, possessing free radical chemical properties. It is a messenger molecule and neurotransmitter released by non-adrenergic neurons in the gastrointestinal tract. The protective effect of NO on the gastric mucosa may be related to its ability to regulate gastroduodenal mucosal blood flow, basal tone of the gastric vascular system, and gastric acid-base balance, maintaining gastric mucosal integrity and normal microvascular barrier function, improving vascular permeability, and reducing inflammatory responses. Furthermore, NO can reduce peroxidase activity in the gastric mucosa and promote gastric mucus secretion, thus contributing to the protective effect on the gastric mucosa. Figure 5 It was found that the NO content in the gastric mucosa and serum of the model group mice was significantly lower than that of the normal group mice (P < 0.01), indicating that the formation of the alcohol-induced gastric mucosal injury model was related to the low NO content. In contrast, the NO content in the gastric tissue of the experimental group mice was significantly higher than that of the model group (P < 0.01), while there was no significant difference between control groups I and II and the model group. This suggests that increasing the NO content in the gastric mucosa is one way the fermented milk in the experimental group prevents alcohol-induced gastric mucosal injury.

[0090] like Figure 6 As shown, the serum PGE2 level in the model group mice was significantly lower than that in the normal group mice (P < 0.05), indicating that the formation of the alcohol-induced gastric mucosal model in mice is related to the low PGE2 level. Compared with the model group, the PGE2 level in the gastric mucosa of the experimental group mice was significantly higher (P < 0.05), while there was no significant difference between the control groups I and II and the model group. This suggests that increasing the PGE2 level in the gastric mucosa and serum is one way that the fermented milk in the experimental group prevents alcohol-induced gastric mucosal damage.

[0091] The results of this experiment suggest that the fermented milk in the experimental group has anti-drunkenness and hangover-relieving effects. It inhibits alcohol absorption, reduces serum ethanol concentration, alleviates alcohol damage to the gastric mucosa, and increases the levels of ADH, ALDH, and P450. Through the alcohol dehydrogenase and alcohol oxidase systems, it accelerates alcohol metabolism, thus exerting its anti-drunkenness and hangover-relieving effects. Therefore, the fermented milk provided in the experimental group achieves its anti-drunkenness and hangover-relieving effects by regulating the intestinal microbiota and protecting the gastric mucosa.

[0092] 7. Immunoblotting detection

[0093] Immunoblotting was used to detect the expression levels of Nrf2 and Keap1 proteins in liver tissue. Liver tissue preserved in liquid nitrogen was minced, transferred to a grinder, homogenized with PBS, and pre-cooled RIPA lysis buffer was added. The mixture was then injected into a centrifuge tube and centrifuged at 4°C for 15 min (10,000 r / min, r = 12 cm). The supernatant was collected, and the protein was quantified using the BCA method. Take 50 μg of protein sample, mix it with 5 times the amount of loading buffer, boil in a water bath for 5 min, centrifuge and collect the supernatant, separate by electrophoresis and transfer to a membrane using a wet method, add 5% skim milk, block at room temperature for 2 h, mix with rabbit anti-rat Nrf2 and Keap1 primary antibodies (rabbit anti-rat Nrf2 and Kelch-like ECH-associated protein-1, Keap1 primary antibody, Abcam, USA) at a volume ratio of 1:500, refrigerate overnight at 4℃, wash the membrane and add secondary antibody (horseradish peroxidase-labeled secondary antibody (Wuhan AmyJet Scientific Co., Ltd.)), incubate at room temperature for 2 h, luminescence is generated in the chemiluminescent solution, color development is performed in a dark room, and the gray values ​​of each band are scanned and analyzed using an imaging analyzer. GAPDH is used as an internal control protein to analyze the relative expression levels of Nrf2 and Keap1 proteins.

[0094] like Figure 7 As shown, compared with the normal control group, the expression level of Nrf2 protein in liver tissue of the model group was increased and the expression level of Keap1 protein was decreased (P<0.01). Compared with the model group, the expression level of Nrf2 protein in liver tissue of the experimental group was decreased and the expression level of Keap1 protein was increased (P<0.01), while there was no significant difference between control group I and control group II (ns).

[0095] The Nrf2 / ARE signaling pathway is an important regulatory pathway for oxidative stress in the body, participating in the pathological processes of nerves, blood vessels, and various organs and tissues. Nrf2 is a key mediator of cellular antioxidant activity, and Keap1 is its repressor protein. Under homeostasis, Nrf2 and Keap1 bind to form a complex isolated in the cytoplasm, participating in the formation of the actin architecture. Nrf2 activity is inhibited and degraded by ubiquitination. Under oxidative stress, Nrf2 dissociates from the complex and translocates to the nucleus, activating the nuclear ARE complex promoter, inducing the transcription of downstream related reductases, and reducing the concentration of oxygen free radicals, thereby exerting its effect of inhibiting oxidative stress damage in hepatocytes. The results of this invention's embodiments show that Nrf2 / ARE pathway activity is reduced in the liver tissue of alcohol-induced model mice, while the fermented milk provided in the experimental group can treat alcohol-induced mice by activating this pathway. In summary, the fermented milk provided by this invention can inhibit oxidative stress and improve liver function, and its mechanism of action may be related to the activation of the Nrf2 / ARE signaling pathway.

[0096] 8. Gastric emptying rate test

[0097] Intoxicated mice were administered fermented milk via gavage, followed by semi-solid nutrient rice cereal, and their gastric emptying rate was measured. Results are as follows: Figure 8 As shown, compared with the normal group, the gastric emptying rate of the model group was significantly reduced (P<0.01). The gastric emptying rate of the experimental group mice was significantly higher than that of the model group, while there was no significant difference between control groups I and II. This indicates that simultaneous gavage with the fermented milk provided in the experimental group can promote gastric emptying in intoxicated mice and has a gastric motility-enhancing effect.

[0098] 9. Detection of gene expression in gastric tissue

[0099] Gastric antrum tissue was collected, and total RNA was extracted using Trizol. cDNA was synthesized using a reverse transcription kit (Nanjing Novizan Biotechnology Co., Ltd.), mixed with a fluorescent mix, and detected by quantitative real-time PCR. -ΔΔCt The expression level relative to GADPH was detected. Primers are as follows:

[0100] GADPH: ggcacagtcaaggctgagaat, SEQ ID NO.1; ggctggatttgctctttgctgttac, SEQ ID NO.2;

[0101] c-kit: atccagccccacaccctg, SEQ ID NO.3; tgtaggcaagaaccatcacaa, SEQ ID NO.4;

[0102] SCF:tgagaaagggaaagcc, SEQ ID NO.5; atggtggtgaagacgccagt, SEQ ID NO.6;

[0103] c-kit and SCF are key genes for the proliferation and differentiation of pacemaker cells in the gastric antrum. Studies have shown that the expression of c-kit and SCF genes is reduced in rats with impaired or absent gastric motility. Figure 9 As shown, the decreased gene expression of c-kit and SCF in the model group indicates that the gastric motility of the intoxicated mouse model was impaired by alcohol. In contrast, the relative expression levels of c-kit and SCF mRNA in the experimental group were significantly higher than those in the model group, while there was no significant difference between control groups I and II. This indicates that the fermented milk provided in the experimental group significantly promotes the expression of c-kit and SCF genes in the intoxicated mouse model, thereby enhancing its gastric motility. This suggests that the fermented milk provided in the experimental group may promote gastric motility enhancement through the c-kit / SCF signaling pathway. Therefore, the fermented milk provided by this invention has a prokinetic effect and can be formulated into monomeric or compound prokinetic products, greatly promoting the development of new products in the field of dietary therapy.

[0104] The above description is only a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any changes or substitutions that can be easily conceived by those skilled in the art within the scope of the technology disclosed in the present invention should be included within the scope of protection of the present invention.

Claims

1. The application of Dendrobium candidum in the preparation of fermented milk for protecting liver and relieving alcoholism, characterized in that, The applications include: An ethanol extract of Dendrobium nobile was obtained, which contained 10.7 mg / g polysaccharide, 14.3 mg / g glycoprotein, 5.7 mg / kg ethyl p-hydroxycinnamate, 88.9 mg / kg N-trans-p-coumaryltyramine, 10.8 mg / kg N-coumaryl dopamine, 30.8 mg / g p-hydroxyphenylpropionic acid, 2.3 mg / kg p-hydroxycinnamic acid, 6.8 mg / kg protocatechuic acid, 11.5 mg / g p-hydroxybenzoic acid, 3.1 mg / kg citric acid, 20.1 mg / kg vanillin, 18.5 mg / kg p-hydroxybenzaldehyde, 134.8 mg / kg methyl protocatechuic acid, and 152.8 mg / kg syringic acid. Prepare seeds containing *Meggenia megacephala*, *Lactobacillus bulgaricus*, and *Streptococcus thermophilus*. A fermentation medium was prepared, which contained 65 g / L sucrose, 120 g / L skim milk powder, 5 g / L Dendrobium nobile ethanol extract, 1.5 g / L potassium dihydrogen phosphate, 0.5 g / L magnesium sulfate and 0.35 g / L ammonium sulfate; The seeds were inoculated into the fermentation medium for fermentation. The inoculation amount of Lactobacillus bulgaricus was 3×10⁶ CFU / mL, the inoculation amount of Streptococcus thermophilus was 7×10⁶ CFU / mL, and the inoculation amount of Saccharomyces cerevisiae was 1×10⁶ CFU / mL. Fermentation was carried out at a constant temperature of 42°C and 180 r / min until the acidity reached 45°T. Fermentation was then stopped, and the fermented yogurt was placed in a refrigerator at 4°C overnight to obtain fermented milk.

2. The liver-protective fermented milk for use according to claim 1, characterized in that, Include: Ethyl p-hydroxycinnamate 324.6 mg / kg, N-trans-p-coumaryltyramine 1.06 g / kg, N-coumaryl dopamine 896.5 mg / kg, p-hydroxyphenylpropionic acid 95.2 mg / g, p-hydroxycinnamic acid 39.5 mg / kg, protocatechuic acid 49.7 mg / kg, p-hydroxybenzoic acid 63.5 mg / g, citric acid 35.3 mg / kg, vanillin 45.9 mg / kg, p-hydroxybenzaldehyde 43.9 mg / kg, methyl protocatechuic acid 435.5 mg / kg, syringic acid 782.5 mg / kg; 2,3-Butanedione (diacetyl) 20.91 mg / kg, 3-hydroxy-2-butanone 14.30 mg / kg, 2-hydroxy-3-pentanone 6.82 mg / kg, 1-hydroxy-2-propanone 21.54 mg / kg, 1,2-cyclopentanedione 12.69 mg / kg, 2-nonanone 6.53 mg / kg, acetylacetone 35.63 mg / kg, dihydro-4-hydroxy-2(3H)-furanone 22.65 mg / kg, 2-methyl-3-pentanol 12.51 mg / kg, 2-furanyl... Alcohol 14.57 mg / kg, hexanal 2.85 mg / kg, furfural 57.52 mg / kg, benzaldehyde 6.52 mg / kg, 5-hydroxymethyl-2-furanaldehyde 52.49 mg / kg, acetic acid 12.54 mg / kg, butyric acid 35.58 mg / kg, hexanoic acid 52.49 mg / kg, octanoic acid 21.54 mg / kg, decanoic acid 2.86 mg / kg, methyl 2-methyl-2-acrylate 11.22 mg / kg, 2-hydroxy-γ-butyrolactone 14.77 mg / kg.

3. A hangover remedy comprising fermented milk prepared in the application described in claim 1.

4. The use of the fermented milk obtained in the application described in claim 1 in the preparation of hangover remedies.

Images