Application of apple MdAP2-like gene in regulating fruit softening and fruit size simultaneously

Abstract

The application discloses application of an apple MdAP2-like gene in simultaneously regulating fruit softening and fruit size, analyzes an expression mode of the MdAP2-like gene in ethylene and 1-MCP treated apple fruits in a postharvest storage process, and verifies the role of the MdAP2-like gene in regulating fruit softening by using a tomato transgenic technology, finds that compared with wild type, ethylene release of tomato fruits overexpressing the MdAP2-like gene is significantly increased, fruit hardness is significantly reduced, fruit coloring and mature softening are advanced, and meanwhile, the MdAP2-like gene makes the fruit size of the tomato fruits smaller. It is indicated that the gene can simultaneously regulate fruit mature softening and fruit size, and has important theoretical guiding significance for cultivating new apple varieties with large fruit size and storage and transportation resistance.

Description

Technical Field

[0001] This invention belongs to the field of biological breeding technology, specifically involving the application of the MdAP2-like gene in simultaneously regulating fruit softening and fruit size. Background Technology

[0002] Apple (Malus domestica) is a typical climacteric fruit, and its ripening and senescence are closely related to the plant hormone ethylene (Li et al., 2017; An et al., 2018). Currently, crisp and delicious apples are more favored by consumers in the market. However, the texture of apple fruits is prone to softening / becoming mushy during post-harvest storage, which greatly affects the taste, shortens the shelf life, and reduces the commercial value of the fruit. In addition, apple fruit size is also an important agronomic trait, affecting not only the appearance quality and yield of the fruit, but also consumer choice and commercial value. Therefore, exploring the key factors that simultaneously regulate apple fruit texture and size has important theoretical guiding significance for breeding new large-fruited apple varieties that are resistant to storage and transportation.

[0003] AP2 / ERF is the most downstream element in the ethylene signaling pathway and one of the largest transcription factor families in plants. Based on its domains, AP2 / ERF can be divided into four subclasses: AP2, ERF, RAV, and Soloist. The ERF subclass is the main component of the AP2 / ERF family, and can be further divided into the CBF / DREB and ERF subfamilies based on the domains it recognizes (Sakuma et al., 2002). The AP2 subfamily contains two repeated AP2 / ERF domains; the ERF and DREB subfamilies each contain only one AP2 / ERF domain; the RAV subfamily contains one AP2 / ERF domain and one B3 domain; the Soloist subfamily is the most distantly related to other subfamilies and has the fewest members, with only one member reported in Arabidopsis thaliana (Licausi et al., 2013; Nakano et al., 2006). Corresponding to the wide range of biological functions of the plant hormone ethylene, the AP2 / ERF gene has a broad range of functions in plants. Currently, AP2 / ERF genes have been reported to participate in the regulation of plant growth and development (Karlova et al., 2014; Ye et al., 2020), various biotic and abiotic stresses (Dong et al., 2015; Nie et al., 2018), chlorophyll degradation (Yin et al., 2016), and fruit ripening, senescence, and quality formation (Liu et al., 2014; Wang et al., 2021). However, no AP2 / ERF members that can regulate both fruit softening and fruit size have been reported. Summary of the Invention

[0004] The purpose of this invention is to provide the application of the apple MdAP2-like gene in simultaneously regulating fruit ripening and softening and fruit size.

[0005] To achieve the above objectives, the technical solution adopted by this invention is summarized as follows:

[0006] The MdAP2-like gene used in this invention has the nucleotide sequence shown in SEQ ID NO.1, or is a derivative gene with equivalent function that has been substituted, deleted and / or added to the nucleotide sequence shown in SEQ ID NO.1.

[0007] The protein encoded by the MdAP2-like gene mentioned above is selected from,

[0008] (1) Its amino acid sequence is shown in SEQ ID NO.2; (2) A protein derived from (1) having the protein function of (1) formed by substituting, deleting or adding one or more (e.g., 1-30; preferably 1-20; more preferably 1-10; e.g., 5, 3) amino acid residues of the amino acid sequence of SEQ ID NO.2; or

[0009] (3) A protein derived from (1) that has 80% (preferably more than 90%, such as 95%, 98%, 99% or higher) homology to the protein sequence defined in (1) and has the function of the protein in (1).

[0010] In other words, the function of the gene protected by this invention includes not only the MdAP2-like gene mentioned above, but also the function of homologous genes with high homology to SEQ ID NO.1 (e.g., higher than 80%; more preferably higher than 90%; more preferably higher than 95%; more preferably higher than 98%) in regulating fruit ripening and softening and fruit size.

[0011] The nucleotide sequence shown in SEQ ID NO.1 is 1092 bp, which is the CDS sequence. Its gene encodes a protein of 363 amino acids, the sequence of which is shown in SEQ ID NO.2.

[0012] The present invention also constructs a series of plant expression vectors, and the functions of expression vectors, recombinant vectors or transgenic plant lines containing the above-mentioned genes, as well as host cells containing the vectors, in this respect also fall within the protection scope of the present invention.

[0013] This invention discloses the application of the MdAP2-like gene in simultaneously regulating fruit ripening and softening as well as fruit size. This was primarily verified through transient overexpression and silencing of the apple MdAP2-like gene, and overexpression of the MdAP2-like gene in tomato. The verification results show that the MdAP2-like gene can promote fruit ripening and softening while inhibiting fruit enlargement. The indicators related to fruit ripening and softening include: fruit firmness, ethylene release rate, and color.

[0014] Specifically, the firmness of apples overexpressing the MdAP2-like gene was significantly lower than that of the unloaded control fruit on day 9, the ethylene release rate of apples overexpressing the MdAP2-like gene was significantly higher than that of the unloaded control fruit on day 9, and the overexpression of the MdAP2-like gene promoted the color change of apples from green to yellow.

[0015] Apples with silenced MdAP2-like genes had significantly higher fruit firmness on day 9 than unloaded control fruits. The ethylene release from apples with silenced MdAP2-like genes was significantly lower than that from unloaded control fruits. Furthermore, silencing MdAP2-like genes inhibited the color change of apples from green to yellow.

[0016] Tomatoes overexpressing MdAP2-like were significantly smaller than wild-type tomatoes; the ethylene release rate of tomatoes overexpressing MdAP2-like was significantly higher than that of wild-type tomatoes; and overexpression of the MdAP2-like gene promoted the color change of tomatoes from green to red.

[0017] Based on its function, plants with early-ripening / softening fruit and smaller fruit size can be obtained through transgenic methods. Specifically, transgenic plants can be obtained by introducing the MdAP2-like gene into the target plant.

[0018] Specifically, the MdAP2-like gene can be introduced into the target plant via the recombinant expression vector. In this method, the recombinant expression vector can be used to transform plant cells or tissues using conventional biological methods such as Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electroporation, and Agrobacterium-mediated transformation, and the transformed plant tissues can be cultured into plants.

[0019] In order to improve the superior traits of plants, the present invention also protects a new plant breeding method, the method being (1) or (2) or (3) as follows:

[0020] (1) By increasing the activity of MdAP2-like protein in the target plant, plants with earlier fruit ripening and softening and smaller fruit size were obtained.

[0021] (2) By promoting the expression of the MdAP2-like gene in the target plant, plants with earlier fruit ripening and softening and smaller fruit size were obtained.

[0022] (3) By inhibiting the expression of the MdAP2-like gene in the target plant, plants with delayed fruit ripening and softening and fruits larger than the target plant were obtained.

[0023] The methods to achieve "promoting the expression of MdAP2-like genes in target plants" can be as follows (1) or (2) or (3):

[0024] (1) Introduce the MdAP2-like gene into the target plant;

[0025] (2) Introduce strong promoters and / or enhancers;

[0026] (3) Other common methods in this field.

[0027] The target plants described in this invention are apples and tomatoes.

[0028] Target genes, also known as gene transfer genes, are genes used in genetic engineering design and manipulation to recombine genes, alter recipient cell traits, and obtain desired expression products. They can originate from the organism itself or be derived from different organisms.

[0029] To study gene function, sometimes the method of "inhibiting the expression of MdAP2-like genes in target plants" is used. The method of "inhibiting the expression of MdAP2-like genes in target plants" is to knock out, silence or mutate the MdAP2-like gene.

[0030] The knockout process involves using DNA homologous recombination, Cre / LoxP, or CRISPR / Cas9 technology to knock out the MdAP2-like gene, thereby obtaining transgenic plant lines. This invention verifies that apple overexpression lines obtained by overexpressing the MdAP2-like gene demonstrate that the firmness of fruits overexpressing the MdAP2-like gene was significantly lower than that of unexpressed control fruits at day 9, the ethylene release rate of fruits overexpressing the MdAP2-like gene was significantly higher than that of unexpressed control fruits at day 9, and that overexpression of the MdAP2-like gene promoted the color change of apple fruits from green to yellow; thus illustrating that overexpression of the MdAP2-like gene can promote the ripening and softening of apple fruits. Furthermore, this invention obtained apple silent lines by silencing the MdAP2-like gene to verify that the firmness of the fruit with the silent MdAP2-like gene was significantly higher than that of the unloaded control fruit on day 9, the ethylene release rate of the fruit with the silent MdAP2-like gene expression was significantly lower than that of the unloaded control fruit, and the silence of the MdAP2-like gene inhibited the color change of apple fruit from green to yellow; thus demonstrating that the silence of the MdAP2-like gene can delay the ripening and softening of apple fruit.

[0031] Furthermore, since apples are perennial woody fruit trees with a long growth cycle, and the trees also have a juvenile stage, obtaining stable transgenic apple fruits is very difficult and time-consuming. This invention also verifies its function by overexpressing MdAP2-like in tomato plants. The results showed that the size of tomatoes overexpressing MdAP2-like was significantly smaller than that of wild-type tomatoes; the ethylene release rate of tomatoes overexpressing MdAP2-like was significantly higher than that of wild-type tomatoes; and the overexpression of the MdAP2-like gene promoted the color change of tomato fruits from green to red. It can be seen that the MdAP2-like gene can promote the ripening of tomato fruits and inhibit the enlargement of tomato fruits.

[0032] In practical applications, gene expression can be suppressed to cultivate new varieties of large-fruited apples and tomatoes that are resistant to storage and transportation, depending on actual needs.

[0033] In this invention, there are no particular limitations on the plants suitable for gene transformation, as long as they are suitable for gene transformation operations, such as various crops, flowering plants, or forestry plants. The plants may be (but are not limited to): dicotyledons, monocotyledons, or gymnosperms.

[0034] As a preferred approach, the term "plant" includes, but is not limited to, apples and tomatoes; any plant possessing the gene or a homologous gene is applicable.

[0035] The term "plant" as used in this invention includes the whole plant, its parent and offspring plants, and different parts of the plant, including seeds, fruits, buds, stems, leaves, roots (including tubers), flowers, tissues, and organs, all of which contain our target gene or nucleic acid. The term "plant" also includes plant cells, suspension cultures, callus tissue, embryos, meristematic regions, gametophytes, sporophytes, pollen, and microspores; similarly, each of these objects contains the target gene / nucleic acid.

[0036] This invention includes any plant cell, or any plant obtained or obtainable by the methods described herein, as well as all plant parts and their propagules. This patent also includes transfected cells, tissues, organs, or whole plants obtained by any of the foregoing methods. The only requirement is that the offspring exhibit the same genotype or phenotypic characteristics, and that offspring obtained using the methods of this patent have identical characteristics.

[0037] This invention also extends to the harvestable parts of the plants as described above, but is not limited to seeds, leaves, fruits, flowers, stems, roots, rhizomes, tubers, and bulbs. It further relates to other derivatives of the plant after harvest, such as dried granules or powders, oils, fats and fatty acids, starches, or proteins. This invention also relates to foods or food additives obtained from the relevant plants.

[0038] Advantages of this invention:

[0039] This invention analyzed the expression pattern of the MdAP2-like gene during postharvest storage of apple fruits treated with ethylene and 1-MCP. Using tomato transgenic technology, it verified the role of the MdAP2-like gene in regulating fruit firmness / ripeness softening and fruit size. The results showed that, compared to wild-type tomatoes, those overexpressing the MdAP2-like gene exhibited a significantly higher ethylene release rate, significantly lower fruit firmness, and earlier coloring and ripening. Furthermore, overexpression of the MdAP2-like gene resulted in smaller tomato fruits. This indicates that the gene can simultaneously regulate fruit firmness / ripeness softening and fruit size, providing important theoretical guidance for breeding new large-fruited apple varieties that are resistant to storage and transportation. Attached Figure Description

[0040] Figure 1 The effects of ethylene and 1-MCP treatments on postharvest softening of Delonix regia fruit;

[0041] Figure 2 This is an electrophoresis image of the full-length PCR amplification of the MdAP2-like gene;

[0042] Figure 3 This is an analysis of conserved domains of apple MdAP2-like structures across different species;

[0043] Figure 4This is an analysis of the expression levels of the MdAP2-like gene in the fruit of the Golden Delicious.

[0044] Figure 5 The effect of transient overexpression of the MdAP2-like gene on the ripening and softening of 'Golden Delicious' fruit;

[0045] In the figure: A, appearance of 'Golden Delicious' fruit overexpressing the MdAP2-like gene, scale bar = 2cm; B, expression level analysis of the MdAP2-like gene in transgenic fruit; C, determination of ethylene release rate during post-harvest storage; D, determination of firmness; E, determination of color difference, L* represents brightness, a* represents the color change from green (-) to red (+), b* represents the color change from blue (-) to yellow (+);

[0046] Figure 6 This study investigates the effect of silencing the MdAP2-like gene on the ripening and softening of 'Golden Delicious' fruit. Figure A shows the appearance of 'Golden Delicious' fruit with silenced MdAP2-like gene expression. Scale bar = 2cm. Figure B shows the expression level analysis of the MdAP2-like gene in transgenic fruit. Figure C shows the determination of ethylene release rate during post-harvest storage. Figure D shows the determination of firmness. Figure E shows the determination of color difference, where L* represents brightness, a* represents the color change from green (-) to red (+), and b* represents the color change from blue (-) to yellow (+).

[0047] Figure 7 This is the phenotype of tomato plants overexpressing the MdAP2-like gene; In the figure: A, Analysis of the expression level of the MdAP2-like gene in transgenic tomato plants; B, Phenotype of plants overexpressing MdAP2-like gene.

[0048] Figure 8 This study measured the size-related indicators, phenotypic comparisons, and size-related gene level analysis of MdAP2-like tomato fruits compared to wild-type fruits. Figures show: A. Comparison of fruit cross-sections; B. Single fruit weight; C. Fruit longitudinal diameter; D. Fruit transverse diameter; E. Analysis of fruit size-related gene expression levels. Error bars represent three biological replicates (*p < 0.05; **p < 0.01; ***p < 0.001).

[0049] Figure 9 This study compares the phenotypes of MdAP2-like tomato fruits and wild-type tomatoes at different time stages.

[0050] Figure 10This study measured the maturity-related indicators of MdAP2-like tomato plants and wild-type plants. In the figure: A. Ethylene; B. Firmness; C. Soluble solids content; D. Color difference. L* represents brightness, a* represents the color change from green (-) to red (+), and b* represents the color change from blue (-) to yellow (+). Error bars represent three biological replicates (*p < 0.05; **p < 0.01; ***p < 0.001). Detailed Implementation

[0051] The present invention will now be described in detail through specific embodiments. These embodiments are provided so that this invention will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art.

[0052] Unless otherwise specified, the techniques used in the embodiments are conventional methods well known to those skilled in the art. Unless otherwise specified, the experimental methods in the following embodiments are all conventional methods. Unless otherwise specified, the reagents and materials used are commercially available.

[0053] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as are familiar to those skilled in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be used in this invention. The preferred embodiments and materials described herein are for illustrative purposes only.

[0054] Unless otherwise stated, the present invention will be practiced using conventional botanical techniques, microbiological techniques, tissue culture techniques, molecular biology techniques, chemical techniques, biochemical techniques, DNA recombination techniques, and bioinformatics techniques that are readily apparent to those skilled in the art. These techniques are fully explained in the published literature, and except for the methods used in the embodiments described below, all methods disclosed in the prior art can be employed.

[0055] As used herein, the terms “nucleic acid,” “nucleic acid sequence,” “nucleotide,” “nucleic acid molecule,” or “polynucleotide” mean, but are not limited to, isolated DNA molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., messenger RNA), naturally occurring, mutant, synthetic DNA or RNA molecules, DNA or RNA molecules composed of nucleotide analogs, and single-stranded or double-stranded structures. These nucleic acids or polynucleotides include, but are not limited to, gene coding sequences, antisense sequences, and regulatory sequences of non-coding regions. These terms include a gene. “Gene” or “gene sequence” is broadly used to refer to a functional DNA nucleic acid sequence. Therefore, a gene may include introns and exons in a genomic sequence, and / or include coding sequences in cDNA, and / or include cDNA and its regulatory sequences. In particular embodiments, such as concerning isolated nucleic acid sequences, cDNA is preferred by default.

[0056] Example 1: Analysis and Cloning of MdAP2-like Genes

[0057] Golden Delicious fruit was treated with ethylene and 1-MCP respectively. Compared with the control fruit, ethylene (100 μL·L⁻¹) significantly reduced the ethylene content. -1 Treatment with 1-MCP (1 μL·L⁻¹, 20℃, 24h) can advance the peak of ethylene release during postharvest storage of Golden Delicious fruit, promote a decrease in fruit firmness, and accelerate its postharvest softening process; while 1-MCP (1 μL·L⁻¹) treatment can accelerate the ethylene release peak during postharvest storage of Golden Delicious fruit, promote a decrease in fruit firmness, and accelerate the softening process. -1 Treatment at 20℃ for 24 hours can effectively inhibit the release of ethylene and the decrease in fruit firmness during the storage of Golden Delicious fruit, and effectively delay the occurrence of postharvest softening. Figure 1 ).

[0058] RNA was extracted from Golden Delicious apple fruits using the CTAB method and then processed using a reverse transcription kit. Single-stranded cDNA was obtained using the 1st StrandcDNA Synthesis Kit (Vazyme, China). Using the single-stranded cDNA as a template and the following sequence as primers...

[0059] MdAP2-like-FP: ATGGCGAAAACCTCACAGCA;

[0060] MdAP2-like-RP: TTATGCATCAAGTTCACAGT;

[0061] PCR (kit) The full-length sequence of the MdAP2-like gene was obtained using Flash Master Mix (purchased from Nanjing Novizan Biotechnology Co., Ltd.). The PCR amplification electrophoresis image is shown below. Figure 2 As shown in the image. The ligation was then recovered and transformed into *E. coli* DH5α. Plasmids were extracted from bacterial cultures with correct sequencing results. The full-length sequence of this gene is shown in SEQ ID NO.1, totaling 1092 bp and encoding 363 amino acids. Multiple sequence alignment of the apple MdAP2-like amino acid sequence with those of peach, strawberry, grape, and tomato ERF family members is shown in the image. Figure 3 As shown. From Figure 3 It can be seen that apple MdAP2-like and other species in the ERF family contain a conserved AP2 / ERF domain.

[0062] Example 2: MdAP2-like gene expression analysis

[0063] Quantitative real-time PCR steps: Total RNA was extracted from *Delonix regia* fruits treated with different methods (control, ethylene, and 1-MCP) using the CTAB method, and then converted to real-time RNA using a reverse transcription kit. III. cDNA was synthesized using the 1st Strand cDNA Synthesis Kit (Vazyme, China), and then used as a template for SYBR Green synthesis. TM Select PCR Master Mix (Applied Biosystems, USA) kit, and perform qRT-PCR detection using CFX96 (BIO-RAD, USA) real-time PCR instrument.

[0064] Total reaction volume 20 μL: including 10.0 μL SYBR. TM Select PCR Master Mix (Applied Biosystems, USA), 1.0 μL template cDNA, 2 μL forward and reverse primers (primer concentration 10 μmol·L⁻¹). -1 ), 7.0 μL ddH2O.

[0065] Reaction program: 95℃ for 10 min; 95℃ for 15 s, 60℃ for 30 s, 40 cycles; 95℃ for 15 s; then decrease to 60℃ at a rate of 0.5℃ per minute.

[0066] The quantitative primer sequences are as follows:

[0067] Positive Q MdAP2-like-FP: GCGTCATCTGCACTAGGACT;

[0068] Inverse Q MdAP2-like-RP: CCGCAATGCTGTTCAAGTCT;

[0069] The expression levels of the MdAP2-like gene during postharvest storage of *Aureomarginata* fruit under different treatments (control, ethylene, and 1-MCP) were analyzed using qRT-PCR. MdACT (Actin-FP: GGATTTGCTGGTGATGATGCT, Actin-RP: AGTTGCTCACTATGCCGTGC) was selected as an internal reference gene, and 2... -ΔΔCt The formula for calculating relative gene expression levels (Livak and Schmittgen, 2001) yields the following results: Figure 4 As shown. From Figure 4 It can be seen that, compared with the control group, the expression level of the MdAP2-like gene was significantly induced and upregulated in apple fruits that softened rapidly under ethylene treatment, while its expression level was significantly inhibited in apple fruits that maintained good firmness (the softening process was effectively delayed) under 1-MCP treatment.

[0070] Example 3: Functional verification of MdAP2-like gene regulating apple fruit ripening and softening

[0071] To investigate the role of the MdAP2-like gene in regulating fruit ripening and softening, its function was analyzed and identified by transient overexpression or silencing of the gene in Golden Delicious fruit.

[0072] 3.1 Constructing a Recombination Carrier

[0073] (1) Construction of hyperexpression vector

[0074] Specific primers with restriction enzyme sites were designed to amplify the CDS sequence of the MdAP2-like gene. The MdAP2-like gene was then integrated into the overexpression vector pRI-101 using homologous recombination to construct a 35S::MdAP2-like recombinant plasmid, which was subsequently transformed into Agrobacterium GV3101 via electroporation. The primer sequences are as follows:

[0075] MdAP2-like-pRI101-FP:TCTTCACTGTTGATACATATGATGGCGAAAACCTCACAGC;

[0076] MdAP2-like-pRI101-RP:CGATCGGGGAAATTCGAGCTCTTATGCATCAAGTTCACAGT.

[0077] (2) Construction of VIGS vector

[0078] Specific primers with restriction enzyme sites were designed to amplify a 200-400 bp fragment of the non-conserved region of the MdAP2-like gene cDNA. The amplified fragment was then inserted into the TRV2 vector using homologous recombination to construct the pTRV2-MdAP2-like recombinant plasmid, which was subsequently transformed into Agrobacterium GV3101 via electroporation. The primer sequences are as follows:

[0079] MdAP2-like-TRV-FP:ATTCTGTGAGTAAGGTTACCGAATTCCGGGCCTAACGGCG

[0080] MdAP2-like-TRV-RP:TCTTCGGGACATGCCCGGGCCTCGAGGACGTATCTCTGGC

[0081] 3.2 Effects of transient overexpression of MdAP2-like genes on apple fruit ripening and softening

[0082] 'Golden Delicious' apples used for transient expression analysis were harvested two weeks before maturity. The OD value of Agrobacterium tumefaciens suspension containing the 35S::MdAP2-like recombinant plasmid was adjusted to 0.8. Using an injection method, 2 mL of the Agrobacterium tumefaciens suspension containing the recombinant plasmid was injected into the pulp from the top of the fruit. Fruits injected with Agrobacterium tumefaciens suspension containing the pRI-101 empty vector served as a control. The injected apples were then stored post-harvest in a 20°C cold storage facility. Fruit firmness, ethylene release, and color difference, among other fruit ripening and softening-related indicators, were measured on days 3, 6, 9, and 12 post-injection to analyze storage tolerance.

[0083] Transient overexpression of the MdAP2-like gene resulted in the following phenotype of Golden Delicious fruit: Figure 5 As shown in Figure A, at day 9 of postharvest storage, the transgenic fruit was significantly more yellow than the unloaded control, indicating that overexpression of the MdAP2-like gene promoted apple fruit ripening. The gene expression analysis of MdAP2-like is as follows: Figure 5 As shown in B. The results of the ethylene release rate measurement of apple fruit are as follows. Figure 5 As shown in C, fruits overexpressing the MdAP2-like gene showed significantly higher ethylene release levels than control fruits on post-harvest storage days 3 and 9; apple fruit firmness test results are as follows. Figure 5 As shown in D, the firmness of fruits overexpressing the MdAP2-like gene was significantly lower than that of control fruits at 3 and 9 days of postharvest storage; the results of fruit color difference measurement are as follows. Figure 5 As shown in E, the L*, a*, and b* values ​​of fruits overexpressing the MdAP2-like gene were significantly higher than those of the control, indicating that overexpression of the MdAP2-like gene promoted the process of apple fruit color changing from green to yellow.

[0084] 3.3 VIGS-induced silencing of the MdAP2-like gene in apple fruit

[0085] The method for inducing gene silencing in apple fruits using VIGS (virus-induced gene silencing) was based on methods described in (Wu et al., 2020. Plant Biotechnology Journal, 19, 1022-1037; Hu et al., 2020. The Plant Journal, 103, 937-950). The OD values ​​of Agrobacterium-mediated silencing expression vectors pTRV2-MdAP2-like and pTRV1 were adjusted to 0.8. The bacterial solutions were then mixed in a 1:1 ratio and injected into the fruit pulp from the top using an injection method, with 2 mL of bacterial solution injected into each fruit. Fruits injected with an equal volume mixture of pTRV1 and pTRV2 served as controls. Injected apple fruits were stored post-harvest in a 20℃ cold storage facility. Fruit firmness, ethylene release rate, and color difference, among other fruit ripening and softening indicators, were measured on days 3, 6, 9, and 12 post-injection to analyze storage tolerance.

[0086] The phenotype of Golden Delicious fruit after VIGS-induced silencing of the MdAP2-like gene is as follows: Figure 6 As shown in Figure A, at day 9 of postharvest storage, the transgenic fruit was significantly greener than the untransplanted control, indicating that silencing the MdAP2-like gene delayed apple fruit ripening. MdAP2-like gene expression analysis is shown below. Figure 6 As shown in B. The results of the ethylene release rate measurement of apple fruit are as follows. Figure 6 As shown in Figure C, at 3, 6, and 9 days post-harvest storage, the ethylene release rate of fruits with silenced MdAP2-like gene expression was significantly lower than that of control fruits; the results of apple fruit firmness testing are as follows. Figure 6 As shown in Figure D, the firmness of fruits with silenced MdAP2-like gene expression was significantly higher than that of control fruits at days 3 and 9; the TSS content of fruits with silenced MdAP2-like gene expression was slightly lower than that of control fruits; the results of fruit color difference measurement are as follows. Figure 6 As shown in E, the a* and b* values ​​of apple fruits with silenced MdAP2-like genes were significantly lower than those of control fruits at day 6, indicating that silencing the MdAP2-like gene inhibited the process of apple fruit color changing from green to yellow.

[0087] 4. Functional verification of MdAP2-like gene regulating tomato fruit ripening and fruit size

[0088] To further investigate whether the MdAP2-like gene has a dual function of regulating fruit firmness / ripening and fruit size, its function was analyzed and identified by overexpressing the gene in tomato fruit.

[0089] 4.1 Constructing a Recombination Carrier

[0090] Specific primers with restriction enzyme sites were designed to amplify the CDS sequence of the MdAP2-like gene. The MdAP2-like gene was then integrated into the overexpression vector pHellsgate8 using homologous recombination to construct the recombinant plasmid MdAP2-like-pHellsgate8, which was subsequently transformed into Agrobacterium GV3101 via electroporation. The primer sequences are as follows:

[0091] MdAP2-like-pHellsgate8-FP:

[0092] CATTTGGAGAGGACACGCTCGAGATGGCGAAAACCTCACA;

[0093] MdAP2-like-pHellsgate8-RP:

[0094] TCTCATTAAAGCAGGACTCTAGATTATGCATCAAGTTCAC.

[0095] 4.2 Screening of positive transgenic tomato lines

[0096] Micro-Tom tomato was used as a model plant for functional verification of the MdAP2-like gene. The tomato transformation method was optimized according to Vinoth et al. (2013). Wild-type tomato was used as a control. Micro-Tom tomato seeds were soaked in distilled water for 30 min, then disinfected with 75% ethanol for 1 min, then surface sterilized with 50% sodium hypochlorite solution for 15 min, and finally washed 3-4 times with sterile water before being sown in 1 / 2 MS medium. Tomato plants were cultured in a tissue culture room with 16:8h light / dark, 25℃, and 70%-80% relative humidity.

[0097] Agrobacterium culture containing the MdAP2-like-pHellsgate8 plasmid was diluted to OD200 using 0.2 MS liquid medium. 600Micro-Tom tomatoes were transformed using leaf disc inoculation with a concentration of 0.1–0.3 g / mL. When infected tomato cotyledons began to produce abundant callus and buds on 2Z medium, the callus tissue with buds was transferred to 0.2Z medium for further culture to reduce bud deformity. When the buds grew to approximately 1 cm in length on 0.2Z medium, buds with intact growth points were selected, cut at the stem base, and rooted on R medium. After the seedlings matured, DNA was extracted from tomato leaves for PCR identification of positive plants. After harvesting T0 generation seeds, positive plants were screened on 1 / 2 MS medium containing kanamycin. Transgenic positive plants containing antibiotic genes were transplanted into soil after developing true leaves and taproots on antibiotic-containing medium. The differences between T1 generation transgenic tomatoes and wild-type tomatoes were observed.

[0098] Primers used for PCR identification of positive plants:

[0099] 35S-FP: GACGCACAATCCCACTATCC;

[0100] pHellsgate8-RP:AAATACGATAGTAACGGGTGAT;

[0101] RNA was extracted from leaves of positive-positive tomato plants to analyze the expression of MdAP2-like genes in these plants. Three transgenic lines with high MdAP2-like gene expression levels (OE-MdAP2-like-2, OE-MdAP2-like-4, and OE-MdAP2-like-5) were selected as representative lines for comparison with the wild type. Figure 7 ).

[0102] 4.3 Overexpression of MdAP2-like reduced the size of tomato fruits.

[0103] Tomato fruits that reached the green ripening stage (MG) were harvested and stored. Tomato fruits overexpressing MdAP2-like were significantly smaller than wild-type fruits. Figure 8 A). By measuring the single fruit weight and longitudinal and transverse diameters, the results showed that the average fruit weight of the overexpression line was only 2.66 grams, while the average fruit weight of the wild type was 5.22 grams. Figure 8 B), the longitudinal diameter and transverse diameter of the fruit are also significantly smaller than those of the wild-type fruit. Figure 8C, D). Furthermore, fw2.2 and fw3.2 have been reported as two major genes negatively regulating fruit size in tomato fruit (Frary et al., 2000; Mu et al., 2017; Beauchet et al., 2021). Real-time quantitative PCR results showed that the expression levels of both genes were significantly higher in transgenic fruits overexpressing MdAP2-like than in wild-type fruits. Figure 8 E).

[0104] 4.4 Overexpression of MdAP2-like promoted the ripening and softening of tomato fruit.

[0105] Overexpression of MdAP2-like not only reduced the size of tomato fruits but also promoted ripening and softening. Wild-type (WT) tomatoes reached MG (minimum ripening) 30 days after flowering and reached color-breaking (BR) 5 days after harvest; while tomatoes overexpressing MdAP2-like reached green-ripe stage 28 days after flowering and reached BR 3 days after harvest. Figure 9 It can be seen that the fruits of the overexpression lines were redder than those of the wild type at the BR and BR+3 stages. By measuring the changes in fruit firmness, ethylene release rate, and soluble solids (TSS) content of different tomato lines, the results showed that, compared with the wild type, the ethylene release rate of tomato fruits overexpressing MdAP2-like was significantly higher, reaching its peak at the BR+7 stage. Figure 10 A). Furthermore, compared to wild-type fruits, the firmness of the fruits from the three overexpression lines was significantly lower than that of wild-type fruits starting from the BR stage, especially in the OE-MdAP2-like-2 line, where the fruits softened rapidly starting from the BR stage. Figure 10 B) indicates that overexpression of MdAP2-like promotes tomato fruit softening. Furthermore, the soluble solids content of the overexpressing lines was significantly higher than that of the wild-type fruits starting from the MG stage. Figure 10 C). The results of fruit color difference measurement showed that, starting from the BR+3 stage, the a* value of tomato fruits overexpressing MdAP2-like was significantly higher than that of WT fruits, indicating that overexpression of MdAP2-like promoted the coloring process of tomato fruits from green to red. Figure 10 D).

[0106] In summary, overexpression of the MdAP2-like gene promotes ripening and softening of apple fruit, while silencing the MdAP2-like gene delays ripening and softening. Furthermore, overexpression of MdAP2-like not only reduces the size of tomato fruit but also promotes ripening and softening. This demonstrates that the MdAP2-like gene can simultaneously regulate both ripening and softening and fruit size.

[0107] The embodiments described above are merely preferred embodiments of the present invention and are only used to explain the present invention. They are not intended to limit the scope of the present invention. For those skilled in the art, other implementation methods can be easily made by substitution or modification based on the technical content disclosed in this specification. Therefore, all changes and improvements made on the principle of the present invention should be included within the scope of the patent application of the present invention.

Claims

1. Apple MdAP2-like The application of genes in regulating fruit softening and fruit size is characterized by, The MdAP2-like The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the regulation specifically manifests as: overexpression MdAP2- like Genes promote the ripening and softening of apple fruits, while silenced genes... MdAP2-like Genes delay the ripening and softening of apple fruits; overexpression MdAP2-like Genes promote the ripening and softening of tomato fruits, while also making the fruits smaller.

2. The application according to claim 1, characterized in that, The indicators related to fruit ripening and softening are: fruit firmness, ethylene release rate, and color.

3. The application according to claim 1, characterized in that, silence MdAP2-like The apples with the silencing gene showed significantly higher fruit firmness on day 9 compared to the unaffected control. MdAP2-like The ethylene release from apple fruits bearing the gene was significantly lower than that from unloaded control fruits, and the silenced gene... MdAP2-like Genes inhibit the color of apples from turning from green to yellow.

4. The application according to claim 1, characterized in that, overexpression MdAP2-like Tomato fruits were significantly smaller than wild-type; overexpression MdAP2-like The firmness of the tomatoes was significantly lower than that of the wild type; overexpression MdAP2-like The ethylene release rate of tomato fruits was significantly higher than that of wild-type tomatoes; overexpression MdAP2-like Genes promote the color change of tomatoes from green to red.

5. An apple breeding method, characterized in that, The method is selected from the following (1) or (2): (1) Overexpression in apple plants MdAP2-like Gene selection was used to breed apple plants whose fruit ripens and softens earlier. (2) Silent apple plants MdAP2-like Gene selection was used to breed apple plants with delayed fruit ripening and softening. The MdAP2-like The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

6. A tomato breeding method, characterized in that, The method involves overexpressing the substance in tomato plants. MdAP2-like Gene selection was used to breed tomato plants with earlier fruit ripening and softening, and smaller fruit size. MdAP2-like The nucleotide sequence of the gene is shown in SEQ ID NO.1.

Images