Poplar calcium modulin binding protein PdeCAMBP in regulating plant organ formation and biomass

Abstract

The application discloses application of a poplar calmodulin binding protein PdeCAMBP in regulating plant organ formation and biomass. The poplar calmodulin binding protein PdeCAMBP is PdeCAMBP-1 protein and / or PdeCAMBP-2 protein. The PdeCAMBP-1 protein is a protein with an amino acid sequence shown in sequence 1, and the PdeCAMBP-2 protein is a protein with an amino acid sequence shown in sequence 4. The application firstly finds that the poplar calmodulin binding protein PdeCAMBP can regulate the formation and quantity of new plant organs and biomass, and has important guiding significance for artificially controlling the balance between plant organ formation and quantity, internode quantity and internode length, and biomass and target traits of a plant in directional cultivation.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the application of poplar calmodulin-binding protein PdeCAMBP in regulating plant organ formation and biomass. Background Technology

[0002] Woody plants are able to occupy ecological niches and larger living spaces in dense forests because of their well-developed vascular systems. These systems not only provide strong support but also serve as crucial sites for the transport of nutrients and water. The development of a plant's vascular system mainly consists of three stages: primary growth, secondary growth, and the transition from primary to secondary growth. Primary growth enables the plant to grow longitudinally and is the main source of new plant organs such as leaves, flowers, and branches. Simultaneously, the continuously dividing meristematic cells provided during primary growth provide the cells for secondary growth. In the secondary growth stage, the cells resulting from meristematic cell division further differentiate, with inward differentiation forming xylem and outward differentiation forming phloem, causing the plant to thicken radially. The vascular system of plants is of great importance to their survival. Nutrients produced by photosynthesis in leaves are transported to various parts of the plant, such as roots, stems, flowers, and fruits, through the vascular system of the leaves. This is a vital nutrient transport system that enables plants to accumulate substances and reproduce. At the same time, the vascular system of the stem, especially the xylem of woody plant stems, is a major source of timber, bioenergy, and fossil fuels. Forests are also the largest carbon sink on land. Therefore, studying the development of the vascular system of trees and cultivating superior forest trees is one of the important ways to solve the energy crisis and the environmental crisis. Summary of the Invention

[0003] The technical problem to be solved by this invention is how to regulate the formation of new plant organs and biomass-related traits in order to cultivate superior trees.

[0004] To address the aforementioned technical problems, the present invention first provides a protein named PdeCAMBP-2, derived from the hybrid poplar 'Nanlin 895' (Populus deltoides × P. euramericana). The PdeCAMBP-2 protein is as shown in a), b), c), or d) below:

[0005] a) The amino acid sequence is that of the protein shown in sequence 4;

[0006] b) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein shown in Sequence 4;

[0007] c) Proteins with the same function obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in Sequence 4.

[0008] d) Proteins that have 75% or more of the same amino acid sequence as shown in Sequence 4 and have the same function.

[0009] In the protein described in b) above, the tag refers to a polypeptide or protein fused with the target protein using in vitro DNA recombination technology for expression, detection, tracing, and / or purification of the target protein. The tag may be a Flag tag, His tag, MBP tag, HA tag, myc tag, GST tag, and / or SUMO tag, etc.

[0010] In the protein described in c) above, the substitution and / or deletion and / or addition of one or more amino acid residues is as follows: substitution and / or deletion and / or addition of no more than 10 amino acid residues, or substitution and / or deletion and / or addition of no more than 9 amino acid residues, or substitution and / or deletion and / or addition of no more than 8 amino acid residues, or substitution and / or deletion and / or addition of no more than 7 amino acid residues, or substitution and / or deletion and / or addition of no more than 6 amino acid residues, or substitution and / or deletion and / or addition of no more than 5 amino acid residues, or substitution and / or deletion and / or addition of no more than 4 amino acid residues, or substitution and / or deletion and / or addition of no more than 3 amino acid residues, or substitution and / or deletion and / or addition of no more than 2 amino acid residues, or substitution and / or deletion and / or addition of no more than 1 amino acid residue.

[0011] In the protein described in d) above, the identity refers to the identity of the amino acid sequence. The identity of the amino acid sequence can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambdaratio to 11, 1, and 0.85 (default values) respectively, and performing an identity search on a pair of amino acid sequences, the identity value (%) can then be obtained.

[0012] The proteins described in a), b), c), or d) above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0013] To address the aforementioned technical problems, this invention provides biomaterials related to the PdeCAMBP-2 protein.

[0014] The biomaterial related to the PdeCAMBP-2 protein provided by this invention is any one of the following A1) to A8):

[0015] A1) Nucleic acid molecules encoding the PdeCAMBP-2 protein;

[0016] A2) An expression cassette containing the nucleic acid molecules described in A1);

[0017] A3) A recombinant vector containing the nucleic acid molecules described in A1);

[0018] A4) A recombinant vector containing the expression cassette described in A2);

[0019] A5) Recombinant microorganisms containing the nucleic acid molecules described in A1);

[0020] A6) Recombinant microorganisms containing the expression cassette described in A2);

[0021] A7) Recombinant microorganisms containing the recombinant vector described in A3);

[0022] A8) Recombinant microorganisms containing the recombinant vector described in A4).

[0023] In the above-mentioned biological materials, the nucleic acid molecule described in A1) is a gene as shown in 1), 2), or 3) below:

[0024] 1) Its coding sequence is the DNA molecule shown in sequence 5 or sequence 6;

[0025] 2) DNA molecules that have 75% or more identity with the nucleotide sequence defined in 1) and encode the PdeCAMBP-2 protein;

[0026] 3) DNA molecules that hybridize to the nucleotide sequences defined in 1) or 2) under strict conditions and encode the PdeCAMBP-2 protein.

[0027] The nucleic acid molecule can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA.

[0028] Those skilled in the art can readily mutate the nucleotide sequence encoding the PdeCAMBP-2 protein of this invention using known methods, such as directed evolution and point mutation. Artificially modified nucleotides that possess 75% or higher identity with the PdeCAMBP-2 nucleotide sequence isolated according to this invention, provided they encode the PdeCAMBP-2 protein and have the same function, are derived from and are equivalent to the nucleotide sequence of this invention.

[0029] The term "identity" as used herein refers to sequence similarity to a natural nucleic acid sequence. "Identity" includes nucleotide sequences that have 75% or higher, 80% or higher, 85% or higher, 90% or higher, or 95% or higher identity with the nucleotide sequence of a protein constituting the amino acid sequence shown in Sequence 1 of this invention. Identity can be evaluated visually or using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0030] In the aforementioned biological materials, the expression cassette (PdeCAMBP-2 gene expression cassette) containing a nucleic acid molecule encoding the PdeCAMBP-2 protein, as described in A2), refers to DNA capable of expressing PdeCAMBP-2 in host cells. This DNA may include not only promoters that initiate PdeCAMBP-2 transcription but also terminators that terminate PdeCAMBP-2 transcription. Furthermore, the expression cassette may also include enhancer sequences. Promoters that can be used in this invention include, but are not limited to: constitutive promoters; tissue-, organ-, and development-specific promoters; and inducible promoters. Suitable transcription terminators include, but are not limited to: Agrobacterium carmine synthase terminator (NOS terminator), cauliflower mosaic virus CaMV 35S terminator, tml terminator, and pea rbcS E9 terminator.

[0031] Recombinant vectors containing the PdeCAMBP-2 gene expression cassette can be constructed using existing expression vectors. These plant expression vectors include binary Agrobacterium vectors and vectors suitable for plant microbombardment, such as pAHC25, pBin438, pCAMBIA1302, pCAMBIA2300, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa, or pCAMBIA1391-Xb (CAMBIA). The plant expression vectors may also contain the 3′ untranslated region of the exogenous gene, i.e., containing a polyadenylated signal and any other DNA fragment involved in mRNA processing or gene expression. The polyadenylated signal can guide the addition of polyadenylated acid to the 3′ end of the mRNA precursor; similar functions exist for the untranslated regions transcribed at the 3′ ends of Agrobacterium crown gall-inducing (Ti) plasmid genes (such as the nosine synthase gene) and plant genes (such as the soybean storage protein gene). When constructing plant expression vectors using the genes of this invention, enhancers, including translational enhancers or transcriptional enhancers, can also be used. These enhancer regions can be ATG start codons or adjacent region start codons, etc., but must be identical to the reading frame of the coding sequence to ensure correct translation of the entire sequence. The translation control signals and start codons are widely available and can be natural or synthetic. The translation initiation region can originate from the transcription initiation region or structural genes. To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be processed. This can involve adding genes that can be expressed in plants, encoding enzymes or luminescent compounds that produce color changes (GUS genes, luciferase genes, etc.), antibiotic marker genes (such as the nptII gene for resistance to kanamycin and related antibiotics, the bar gene for resistance to the herbicide phosphinic acid, the hph gene for resistance to the antibiotic hygromycin, the dhfr gene for resistance to methotrexate, and the EPSPS gene for resistance to glyphosate), or chemical reagent resistance marker genes (such as herbicide resistance genes), and mannose-6-phosphate isomerase genes that provide the ability to metabolize mannose. From a safety perspective, transgenic plants can be screened directly under stress without adding any selective marker genes.

[0032] In the aforementioned biological materials, the carrier may be a plasmid, a granule, a bacteriophage, or a viral vector.

[0033] In the above-mentioned biological materials, the microorganisms may be yeast, bacteria, algae or fungi; the bacteria may be Agrobacterium, specifically strain GV3101.

[0034] To address the aforementioned technical problems, this invention also provides new uses for the PdeCAMBP-2 protein or related biomaterials.

[0035] This invention provides the application of the above-mentioned PdeCAMBP-2 protein or the above-mentioned related biological materials in any of the following B1)-B8):

[0036] B1) Regulate (e.g., promote) plant growth and development;

[0037] B2) Regulate (e.g., promote) the formation or production of plant organs;

[0038] B3) Regulating (e.g., increasing) the number of plant organs;

[0039] B4) Regulating (e.g., increasing) plant biomass;

[0040] B5) Regulate (e.g., increase) plant height;

[0041] B6) Regulating (e.g., increasing) the number of plant taproots;

[0042] B7) Regulating (e.g., increasing) the number of plant leaves;

[0043] B8) Genetically modified plants with increased number of organs and / or biomass.

[0044] To address the aforementioned technical problems, this invention also provides new uses for PdeCAMBP-1 and PdeCAMBP-2 proteins.

[0045] This invention provides the use of PdeCAMBP-1 and PdeCAMBP-2 proteins in any of the following C1)-C13):

[0046] C1) Regulates (e.g., promotes) plant growth and development;

[0047] C2) Regulates (e.g., promotes) the formation or production of plant organs;

[0048] C3) Regulates (e.g., increases) the number of plant organs;

[0049] C4) Regulates (e.g., increases) plant biomass;

[0050] C5) Regulates (e.g., increases) the number of plant taproots;

[0051] C6) Regulates (e.g., increases) the length of the plant's taproot;

[0052] C7) Regulates (e.g., increases) the number of plant leaves;

[0053] C8) Regulates (e.g., increases) plant height;

[0054] C9) Regulates (e.g., increases) the number of plant internodes;

[0055] C10) regulates (e.g., reduces) plant internode length;

[0056] C11) regulates (e.g., increases) plant dry weight;

[0057] C12) Transgenic plants with increased organ number and / or biomass;

[0058] C13) Cultivating transgenic plants with altered tree shapes (such as selectively cultivating trees whose shapes meet actual production needs).

[0059] To address the aforementioned technical problems, this invention also provides novel uses for substances that inhibit the activity of PdeCAMBP-1 and PdeCAMBP-2 proteins in plants or substances that reduce the content of PdeCAMBP-1 and PdeCAMBP-2 proteins in plants.

[0060] This invention provides the use of substances that inhibit the activity of PdeCAMBP-1 and PdeCAMBP-2 proteins in plants, or substances that reduce the content of PdeCAMBP-1 and PdeCAMBP-2 proteins in plants, in any of the following D1)-D13):

[0061] D1) Inhibits plant growth and development;

[0062] D2) Inhibits the formation or production of plant organs;

[0063] D3) Reduce the number of plant organs;

[0064] D4) Reduces plant biomass;

[0065] D5) Reduce the number of taproots in plants;

[0066] D6) Reduce the length of the plant's taproot;

[0067] D7) Reduce the number of plant leaves;

[0068] D8) Reduce plant height;

[0069] D9) Reduce the number of internodes in plants;

[0070] D10) Increases plant internode length;

[0071] D11) Reduce plant dry weight;

[0072] D12) Transgenic plants with reduced organ number and / or reduced biomass and / or increased internode length;

[0073] D13) Cultivating transgenic plants with altered tree shapes (such as targeted cultivation of trees whose shapes meet actual production needs).

[0074] In the above applications, the substances that inhibit the activity of PdeCAMBP-1 and PdeCAMBP-2 proteins in plants or reduce the content of PdeCAMBP-1 and PdeCAMBP-2 proteins in plants can be substances that interfere with the expression of the PdeCAMBP-1 and PdeCAMBP-2 protein-coding genes in plants or substances that knock out the PdeCAMBP-1 and PdeCAMBP-2 protein-coding genes in plants.

[0075] Furthermore, the substance that interferes with the expression of the PdeCAMBP-1 and PdeCAMBP-2 protein-coding genes in plants may be a miRNA or an expression vector containing the miRNA that interferes with the expression of the PdeCAMBP-1 and PdeCAMBP-2 protein-coding genes in plants.

[0076] The substance used to knock out the PdeCAMBP-1 and PdeCAMBP-2 protein-coding genes in plants may be a CRISPR / Cas9 system for knocking out the PdeCAMBP-1 and PdeCAMBP-2 protein-coding genes in plants. The CRISPR / Cas9 system includes sgRNA targeting the PdeCAMBP-1 and PdeCAMBP-2 genes, or an expression cassette containing the sgRNA, or an expression vector containing the sgRNA.

[0077] Furthermore, the miRNA that interferes with the expression of the PdeCAMBP-1 and PdeCAMBP-2 protein-coding genes in the plant is specifically TAATAGGGGTGACTGTCTCGA.

[0078] The target sequences in the sgRNA targeting the PdeCAMBP-1 gene are specifically AATCAGCAAGAACTTTGGCG and TGGGAGAAACGTTCAGCTTC, and the nucleotide sequences of the expression cassette containing the sgRNA are specifically shown in sequences 7 and 8.

[0079] The target sequences in the sgRNA targeting the PdeCAMBP-2 gene are specifically GAAGATAATAGCTACGAGGC and GCAGCAAGCTCACAACATTC, and the nucleotide sequences of the expression cassette containing the sgRNA are specifically shown in sequences 9 and 10.

[0080] To address the aforementioned technical problems, the present invention also provides a method for cultivating transgenic plants with increased organ quantity and / or biomass.

[0081] The method for cultivating transgenic plants with increased organ quantity and / or biomass provided by this invention is as follows: X1) or X2):

[0082] X1) includes the step of increasing the expression level and / or activity of PdeCAMBP-2 in the recipient plant to obtain a transgenic plant; wherein the number of organs and / or biomass of the transgenic plant is higher than that of the recipient plant;

[0083] X2) includes the step of increasing the expression levels and / or activity of PdeCAMBP-1 and PdeCAMBP-2 in the recipient plant to obtain a transgenic plant; wherein the number of organs and / or biomass of the transgenic plant is higher than that of the recipient plant.

[0084] In the above method, in X1), the number of organs and / or biomass of the transgenic plant is higher than that of the recipient plant, as shown in any one of the following m1)-m3);

[0085] m1) The number of tap roots in the transgenic plant is higher than that in the recipient plant;

[0086] m2) The number of leaves in the transgenic plant is higher than that in the recipient plant;

[0087] The transgenic plant (m3) is taller than the recipient plant.

[0088] Furthermore, in X1), the method for increasing the expression level and / or activity of PdeCAMBP-2 protein in the recipient plant is to overexpress PdeCAMBP-2 protein in the recipient plant.

[0089] Furthermore, the overexpression method involves introducing the gene encoding the PdeCAMBP-2 protein into a recipient plant.

[0090] To address the aforementioned technical problems, the present invention ultimately provides a method for cultivating transgenic plants with reduced organ numbers and / or reduced biomass and / or increased internode length.

[0091] The method for cultivating transgenic plants with reduced number of organs and / or reduced biomass and / or increased internode length provided by this invention is as follows: Y1) or Y2):

[0092] Y1) includes the step of reducing the expression level and / or activity of PdeCAMBP-2 protein in the recipient plant to obtain a transgenic plant; the number of organs and / or biomass of the transgenic plant is lower than that of the recipient plant;

[0093] Y2) includes the step of reducing the expression levels and / or activity of PdeCAMBP-1 and PdeCAMBP-2 proteins in the recipient plant to obtain a transgenic plant; wherein the number of organs and / or biomass of the transgenic plant is lower than that of the recipient plant.

[0094] In the above method, in Y2), the number of organs and / or biomass of the transgenic plant is lower than that of the recipient plant, as manifested in any one of the following n1)-n6);

[0095] n1) The number of tap roots in the transgenic plant is less than that in the recipient plant;

[0096] n2) The taproot length of the transgenic plant is less than that of the recipient plant;

[0097] n3) The number of leaves in the transgenic plant is less than that in the recipient plant;

[0098] n4) The height of the transgenic plant is less than that of the recipient plant;

[0099] n5) The number of internodes in the transgenic plant is less than that in the recipient plant;

[0100] (n6) The dry weight of the transgenic plant is less than that of the recipient plant.

[0101] Furthermore, in Y2), the method for reducing the expression level and / or activity of PdeCAMBP-1 and PdeCAMBP-2 proteins in the recipient plant is to introduce a substance that interferes with the expression of the PdeCAMBP-1 and PdeCAMBP-2 protein-coding genes in the recipient plant or a substance that knocks out the PdeCAMBP-1 and PdeCAMBP-2 protein-coding genes in the recipient plant into the recipient plant.

[0102] Furthermore, the substances expressed by the PdeCAMBP-1 and PdeCAMBP-2 protein-coding genes in the interfering recipient plant may be miRNAs expressed by the PdeCAMBP-1 and PdeCAMBP-2 protein-coding genes in the interfering recipient plant, or expression vectors containing the miRNAs.

[0103] The substance used to knock out the PdeCAMBP-1 and PdeCAMBP-2 protein-coding genes in the recipient plant may be a CRISPR / Cas9 system for knocking out the PdeCAMBP-1 and PdeCAMBP-2 protein-coding genes in the recipient plant. The CRISPR / Cas9 system includes sgRNA targeting the PdeCAMBP-1 and PdeCAMBP-2 genes, or an expression cassette containing the sgRNA, or an expression vector containing the sgRNA.

[0104] In a specific embodiment of the present invention, the miRNA expressed by the PdeCAMBP-1 protein-coding gene and the PdeCAMBP-2 protein-coding gene in the interference recipient plant is TAATAGGGGTGACTGTCTCGA.

[0105] The target sequences in the sgRNA targeting the PdeCAMBP-1 gene are AATCAGCAAGAACTTTGGCG and TGGGAGAAACGTTCAGCTTC, and the nucleotide sequences of the expression cassette containing the sgRNA are shown in sequences 7 and 8.

[0106] The target sequences in the sgRNA targeting the PdeCAMBP-2 gene are GAAGATAATAGCTACGAGGC and GCAGCAAGCTCACAACATTC, and the nucleotide sequences of the expression cassette containing the sgRNA are shown in sequences 9 and 10.

[0107] In any of the above applications or methods, the organ (or newly formed organ) may be a root and / or a leaf, the root may specifically be a principal root, and the leaf may specifically be a newly formed tender leaf.

[0108] In any of the above applications or methods, the intersegment length may be the total length of segments 1 to 5, or the length of segment 1, segment 2, segment 3, segment 4, or segment 5.

[0109] In any of the above applications or methods, the amino acid sequence of the PdeCAMBP-1 protein is as shown in Sequence 1.

[0110] In any of the aforementioned applications or methods, the plants include food crops such as rice, wheat, barley, corn, soybeans, potatoes, legumes, oats, and millet; vegetable crops such as Arabidopsis thaliana, Chinese cabbage, radish, chili pepper, strawberry, tomato, watermelon, cucumber, cabbage, cantaloupe, zucchini, leek, onion, and carrot; cash crops such as ginseng, tobacco, cotton, sesame, sugarcane, sugar beets, wild sesame, peanuts, and rapeseed; and plants such as apples, pears, dates, peaches, kiwifruit, and grapes. Fruits including oranges, persimmons, plums, apricots, and bananas; flowers including roses, gladioli, dandelions, carnations, chrysanthemums, lilies, and tulips; forage crops including ryegrass, red clover, orchardgrass, alfalfa, tall buttercup, and perennial ryegrass; and woody plants used for timber production, including poplar, willow, birch, locust, elm, dawn redwood, spruce, beech, maple, oak, chinaberry, ash, goldenrod, ironwood, rosewood, yellow sandalwood, teak, ash, and maple. Further, the plants are dicotyledonous plants. Even further, the dicotyledonous plants are dicotyledonous woody plants. In a specific embodiment of the invention, the dicotyledonous woody plant is poplar.

[0111] Experiments have shown that when poplar trees are transformed with the recombinant vector fused with the pdeCAMBP-2CDS sequence shown in sequence 6 and pCABIA2300-3×Flag, the resulting transgenic poplar trees, under normal conditions, show a 10.33% increase in height, a 39.6% increase in the number of taproots, and a significant increase in the number of newly produced young leaves compared to wild-type poplar trees. When the expression levels of pdeCAMBP-1 and pdeCAMBP-2 genes were simultaneously reduced using microRNA interference technology, or when pdeCAMBP-1 and pdeCAMBP-2 genes were simultaneously knocked out using CRISPR knockout technology, the resulting transgenic poplars, compared with wild-type poplars under normal conditions, exhibited the following reductions: taproot number decreased by 26.3% and 42.8%, taproot length decreased by 48.9% and 39.6%, respectively; the number of newly produced young leaves decreased; plant height decreased by 12.7% and 25.3%, respectively; internode number decreased by 21.5% and 52%, respectively; dry weight decreased by 62.7% and 62.9%, respectively; and internode length increased by 82.31% and 363.7%, respectively. Compared with the prior art, the beneficial effects of the present invention are as follows: The present invention can increase the number and biomass of new plant organs by increasing the expression level of pdeCAMBP-1 and / or pdeCAMBP-2 genes; it can also reduce the production of new plant organs by decreasing the expression level of pdeCAMBP-1 and / or pdeCAMBP-2 genes, or knocking out pdeCAMBP-1 and / or pdeCAMBP-2 genes. This invention can cultivate plants with target traits in a targeted manner, and has important guiding significance for artificially controlling the balance between plant organ formation and number, internode number and internode length, and biomass. Attached Figure Description

[0112] Figure 1 The expression levels of the pdeCAMBP-1 gene in different transgenic lines are shown. WT represents wild-type plants, OE represents different transgenic lines introduced with the recombinant overexpression vector p35S::pdeCAMBP-1-3×Flag, and mi represents different transgenic lines introduced with the recombinant interference vector PGWB2-R.

[0113] Figure 2 The expression levels of the pdeCAMBP-2 gene in different transgenic lines are shown. WT represents wild-type plants, OE represents different transgenic lines introduced with the recombinant overexpression vector p35S::pdeCAMBP-2-3×Flag, and mi represents different transgenic lines introduced with the recombinant interference vector PGWB2-R.

[0114] Figure 3 This shows the editing status of two pdeCAMBP genes in the knockout transgenic poplar. T1, T2, T3, and T4 represent the four target sites, Allele 1 and Allele 2 represent the two sets of alleles in the 'Nanlin 895' poplar, -- indicates a base deletion, blue indicates an inserted base, and NE indicates no editing.

[0115] Figure 4 Phenotypic and statistical diagrams of new organs (tap root and new leaves) of wild-type poplar and different transgenic lines. Figure 4 a represents the phenotype of different transgenic lines after 10 days of growth. Figure 4 b represents the statistical count of the number of taproots in different transgenic lines after ten days of growth. Figure 4 c represents the statistical analysis of the taproot length of different transgenic lines after ten days of growth. Figure 4 d shows the phenotypic diagram of the apical leaves of different transgenic lines that have not fully unfolded after one month of growth.

[0116] Figure 5 Statistical graphs showing the phenotypes of wild-type poplar trees that have grown for two months and the quantitative traits of different transgenic lines, including plant height, number of stem nodes, internode length, and biomass. Figure 5 a shows the phenotypic diagrams of different transgenic lines that have grown in the soil for two months. Figure 5 Figures b, 5c, 5d, and 5e show the plant height, number of stem nodes, internode length from the first to the fifth node, and dry weight of different transgenic lines after two months of growth, respectively. Each line system has 5 replicates. * indicates p < 0.05, *** indicates p < 0.001, and NS indicates no significant difference. Detailed Implementation

[0117] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0118] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0119] The pCABIA2300-3×Flag vector in the following examples was modified from the pCABIA2300 vector, as described in the literature "Deng, MS, Ji, C., Shen, Y., He, MZ, & Tian, ​​ML (2016). Cloning, subcellular lactalization and expression analysis of chloroplast-targeted obg gene in cyathula officinalis. Zhongguo Zhongyao za zhi=Zhongguo zhongyao zazhi=China journal of Chinese materia medica,41(14),2612-2618.".

[0120] The PGWB2 vector in the following embodiments is described in the literature "Figueiredo J,P". Lahaye T, etal. (2011) Agrobacterium-mediated transient expression in citrus leaves: a rapidtool for gene expression and functional gene assay. [J]. Plant Cell Reports, 30(7):1339-1345."

[0121] The pRS300 vector in the following examples is described in the literature “Yun-Xiang W, Jin-Hua Z, Zheng JU, et al. A MicroRNA-Based Gene Silencing Vector Construction Method in Tomato[J]. Northern Horticulture, 2012.”.

[0122] In the following embodiments The vector is described in the literature “Razzaque S, Chakraborty D, Tammi RS, et al. Cloning of Three Antiporter Genes from Arabidopsis and Rice for Over-Expressing Them in Farmer Popular Tomato Varieties of Bangladesh[J]. American Journal of Botany (English), 2014, 5(26):3957-3963.”

[0123] The pYLCRISPR / Cas9 vector in the following examples is described in the literature “Ma,X.and Liu,Y.-G.2016.CRISPR / Cas9-based multiplex genome editing in monocot and dicotplants.Curr.Protoc.Mol.Biol.115:31.6.1-31.6.21.doi:10.1002 / cpmb.10”.

[0124] The Agrobacterium tumefaciens GV3101 in the following examples is described in the literature “Zheng, S., et al. (2020). Two MADS-box genes regulate vascular cambium activity and secondary growth via modulating auxin homeostasis in Populus. Plant Communications.”

[0125] The wild-type poplar 'Nanlin 895' in the following examples is described in the literature "Zhu, Y., et al. (2018). AHD-ZIP III gene, PtrHB4, is required for interfascicular cambium development in Populus." Plant Biotechnol J 16(3):808-817."

[0126] Example 1: Obtaining the protein pdeCAMBP-1 and its encoding gene

[0127] 1. Take the whole "nanlin 895" poplar plant that has been growing in a tissue culture bottle for one month, freeze it in liquid nitrogen, grind it and extract total RNA, and reverse transcribe the total RNA to obtain poplar cDNA.

[0128] 2. Using the obtained cDNA as a template, PCR amplification was performed with 5'-ATGATGCCTGCGAAGCTTGG-3' as the forward primer and 5'-TGTATCTGACCACTCTCCAC-3' as the reverse primer to obtain the amplification product.

[0129] 3. After the amplification product was detected by agarose gel electrophoresis, a DNA fragment of about 4kb was separated and purified. Then, this PCR product was ligated into the cloning vector peasy-Blunt simple, and the ligated vector was sequenced.

[0130] Sequencing results show that the coding region sequence of the pdeCAMBP-1 gene in poplar nanlin 895 is shown in sequence 3 of the sequence listing, the genome sequence is shown in sequence 2 of the sequence listing, and the amino acid sequence of the encoded pdeCAMBP-1 protein is shown in sequence 1 of the sequence listing.

[0131] Example 2: Obtaining the protein pdeCAMBP-2 and its encoding gene

[0132] 1. Take the whole "nanlin 895" poplar plant that has been growing in a tissue culture bottle for one month, freeze it in liquid nitrogen, grind it and extract total RNA, and reverse transcribe the total RNA to obtain poplar cDNA.

[0133] 2. Using the obtained cDNA as a template, PCR amplification was performed with 5'-ATGATGCCTACCAAGCTTGG-3' as the forward primer and 5'-ACTTCCAATAGGGGTGACTGCC-3' as the reverse primer to obtain the amplification product.

[0134] 3. After the amplification product was detected by agarose gel electrophoresis, a DNA fragment of about 4kb was separated and purified. Then, this PCR product was ligated into the cloning vector peasy-Blunt simple, and the ligated vector was sequenced.

[0135] Sequencing results showed that the coding region sequence of the pdeCAMBP-2 gene in poplar nanlin 895 is shown in sequence 6 of the sequence listing, the genome sequence is shown in sequence 5 of the sequence listing, and the amino acid sequence of the encoded pdeCAMBP-1 protein is shown in sequence 4 of the sequence listing.

[0136] Example 3: Construction of recombinant vector and recombinant bacteria

[0137] I. Construction of recombinant overexpression vector and recombinant overexpressing Agrobacterium

[0138] 1. Construction of the recombinant overexpression vector p35S::pdeCAMBP-1-3×Flag

[0139] The DNA fragment between the SacI and SaII restriction sites of the pCABIA2300-3×Flag vector was replaced with the DNA fragment shown in positions 1-3933 of sequence 3 in the sequence listing, while keeping the other sequences of the pCABIA2300-3×Flag vector unchanged, to obtain the recombinant overexpression vector p35S::pdeCAMBP-1-3×Flag.

[0140] 2. Construction of recombinant Agrobacterium p35S::pdeCAMBP-1-3×Flag / GV3101 overexpression

[0141] The recombinant overexpression vector p35S::pdeCAMBP-1-3×Flag was transformed into Agrobacterium tumefaciens strain GV3101 using the Agrobacterium transformation method. After PCR detection, recombinant overexpressing Agrobacterium p35S::pdeCAMBP-1-3×Flag / GV3103 containing the recombinant overexpression vector p35S::pdeCAMBP-1-3×Flag was obtained.

[0142] 3. Construction of the recombinant overexpression vector p35S::pdeCAMBP-2-3×Flag

[0143] The DNA fragment between the BglII and SaII restriction sites of the pCABIA2300-3×Flag vector was replaced with the DNA fragment shown in positions 1-3987 of sequence 6 in the sequence listing, while keeping the other sequences of the pCABIA2300-3×Flag vector unchanged, to obtain the recombinant overexpression vector p35S::pdeCAMBP-2-3×Flag.

[0144] 4. Construction of recombinant Agrobacterium p35S::pdeCAMBP-2-3×Flag / GV3101 overexpression

[0145] The recombinant overexpression vector p35S::pdeCAMBP-2-3×Flag was transformed into Agrobacterium tumefaciens strain GV3101 using the Agrobacterium transformation method. After PCR detection, recombinant overexpressing Agrobacterium tumefaciens p35S::pdeCAMBP-2-3×Flag / GV3101 containing the recombinant overexpression vector p35S::pdeCAMBP-2-3×Flag was obtained.

[0146] II. Construction of Recombinant Interference Vector and Recombinant Interference Agrobacterium

[0147] 1. Construction of the recombinant interference vector PGWB2-R

[0148] (1) Primers were designed using the common coding sequence 5'-TTGAGGCAGTCACCCCTATTG-3' of pdeCAMBP-1 and pdeCAMBP-2 as the target sequence on the primer design website http: / / wmd3.weigelworld.org / cgi-bin / webapp.cgi?page=Home;project=stdwmd. The primer sequences are as follows:

[0149] CA-allI miR-s: gaTAATAGGGGTGACTGTCTCGAtctctcttttgtattcc;

[0150] CA-allII miR-a: gaTCGAGACAGTCACCCCTATTAtcaaagagaatcaatga;

[0151] CA-allIII miR*s: gaTCAAGACAGTCACGCCTATTTtcacaggtcgtgatatg;

[0152] CA-allIV miR*a:gaAAATAGGCGTGACTGTCTTGAtctacatatatattcct.

[0153] (2) Using the pRS300 vector as a template, two rounds of nested PCR were performed using the four primer sequences in step (1) (for specific methods, refer to Rebecca Schwab, MPI for Developmental Biology, Tuebingen, 2005) to obtain artificial microRNA: TAATAGGGGTGACTGTCTCGA.

[0154] (3) Connect artificial microRNA to After vectorization, artificial microRNA is ligated to vector PGWB2 using LR homologous recombination reaction, finally obtaining the recombinant interference vector PGWB2-R.

[0155] 2. Construction of recombinant Agrobacterium interfering PGWB2-R / GV3101

[0156] The recombinant interference vector PGWB2-R was transformed into Agrobacterium tumefaciens GV3101 using the Agrobacterium-mediated transformation method. After PCR detection, the recombinant interfering Agrobacterium PGWB2-R / GV3101 was obtained.

[0157] III. Construction of Recombinant Knockout Vectors and Recombinant Knockout Agrobacterium

[0158] 1. Construction of the recombinant knockout vector pYLCRISPR / Cas9-R2

[0159] (1) Select the following two target points on the coding region sequence of pdeCAMBP-1: target point T1 (AATCAGCAAGAACTTTGGCG) and target point T2 (TGGGAGAAACGTTCAGCTTC), and select the following two target points on the coding region sequence of pdeCAMBP-2: target point T3 (GAAGATAATAGCTACGAGGC) and target point T4 (GCAGCAAGCTCACAACATTC).

[0160] (2) The four target sites T1-T4 were combined with the promoters AtU3b, AtU3d, AtU6-1 and AtU6-29 to form sgRNA expression cassettes AtU3b+T1 (sequence 7), AtU3d+T2 (sequence 8), AtU6-1+T3 (sequence 9) and AtU6-29+T4 (sequence 10).

[0161] (3) First, the sgRNA expression cassettes AtU3b+T1, AtU3d+T2, AtU6-1+T3 and AtU6-29+T4 were assembled sequentially using two rounds of nested PCR and enzyme digestion. Then, the assembled fragments were ligated to the BsaI multiple cloning site near the RB position of the binary vector pYLCRISPR / Cas9 using the GoldenGate cloning method. After PCR detection and sequencing, the recombinant knockout vector pYLCRISPR / Cas9-R2, which can work together to act on the pdeCAMBP-1 and pdeCAMBP-2 genes, was obtained.

[0162] 2. Construction of recombinant knockout Agrobacterium pYLCRISPR / Cas9-R2 / GV3101

[0163] The recombinant knockout vector pYLCRISPR / Cas9-R2 was transformed into Agrobacterium GV3101 using the Agrobacterium-mediated transformation method. After PCR detection, the recombinant knockout Agrobacterium pYLCRISPR / Cas9-R2 / GV3101 was obtained.

[0164] Example 4: Obtaining and Identifying Transgenic Poplar Trees

[0165] I. Obtaining Genetically Modified Poplar Trees

[0166] All the recombinant Agrobacterium bacteria constructed in Example 3 were used to infect the tender leaves of tissue-cultured poplar seedlings 'Nanlin 895' using the leaf disc method. After a series of callus induction, bud induction, and rooting induction processes, transgenic poplar seedlings were obtained. The specific steps are as follows:

[0167] 1. The Agrobacterium monoclonal strain obtained in Example 3 was cultured in 100 ml of YEB liquid medium at 28°C until OD was reached. 600nm =0.8, then add 100μm acetylsuccinone.

[0168] 2. Take a tender leaf from a poplar seedling that has been growing for one month in a tissue culture bottle. Use a scalpel to cut off the edges of the leaf, leaving about 1 cm near the midrib. 2 Take a leaf, make 3-4 small cuts on the main vein, place it in a shaker of Agrobacterium, and gently shake it to infect for 30 minutes.

[0169] 3. Remove the leaves and place them face down on a co-culture medium (containing 0.5 mg / L kinetin, 0.75 mg / L 2-4-D, 100 μm acetylsuccinone, and no antibiotics) and co-culture at 28°C for two days.

[0170] 4. Transfer the leaves into the callus induction medium (containing 0.5 mg / L kinetin, 0.75 mg / L 2-4-D, 50 mg / L kan, 250 mg / L carb, and 300 mg / L Timentin) and culture in the dark. Subculture every 12 days until spherical callus tissue grows.

[0171] 5. Cut off the callus and place it in differentiation medium (containing 0.2 mg / L thidiazuron, 50 mg / L kan, 250 mg / L carb, 300 mg / L Timentin) for light culture. Subculture every 15 days until buds emerge.

[0172] 6. Cut off the small buds and culture them independently on rooting medium (containing 50 mg / L kan, 250 mg / L carb, and 300 mg / L Timentin) until they root. The transgenic poplar seedlings can be continuously propagated after rooting.

[0173] II. Identification of Genetically Modified Poplar

[0174] 1. PCR identification

[0175] DNA was extracted from transgenic poplar seedlings for PCR identification, which included the following steps: DNA was extracted from all transgenic poplar seedlings using the CTAB method, and primers were designed at both ends of the above recombinant vector to amplify the DNA of each plant by PCR, while wild-type poplar DNA was used as a control.

[0176] The primer sequences designed for the pCABIA2300-3×Flag vector are as follows:

[0177] 5'-CGTCTTCAAAGCAAGTGGATTGATG-3';

[0178] 5'-TTGCGGGACTCTAATCATAAAAACC-3'.

[0179] The primer sequences designed for the PGWB2-R vector are as follows:

[0180] 5'-GGGGACTCTAGAGTTATCAAC-3';

[0181] 5'-GCATGTCTTGCGTTGATGAAGC-3'.

[0182] The primer sequences designed for the pYLCRISPR / Cas9-R2 vector are as follows:

[0183] 5'-GTCGTGTCCACATGTTGACCG-3';

[0184] 5'-CGACATAGATGCAATAACTTCG-3'.

[0185] The PCR products can be preliminarily identified as positive transgenic plants by electrophoresis.

[0186] 2. Obtaining transgenic poplar trees with overexpression and those with interference

[0187] For positive transgenic plants incorporating p35S::pdeCAMBP-1-3×Flag, p35S::pdeCAMBP-2-3×Flag, and PGWB2-R, expression levels were detected as follows: Leaves from one-month-old positive transgenic plants and wild-type poplar 'Nanlin 895' under the same growth conditions were collected. Total RNA was extracted from the leaves using Megan's Plant RNA Mini-Extraction Kit. cDNA was then synthesized using Invitrogen's Reverse Transcription Kit with Oligo d(T) primers. Real-time quantitative PCR was performed using two pdeCAMBP gene-specific primers, with Actin as an internal control gene. Primers are as follows:

[0188] Q pdeCAMBP-1 F:AGGAGCTTGCAGTGAAGGAT;

[0189] Q pdeCAMBP-1 R:TCCACCCTTGATTGTGTGCTCT;

[0190] Q pdeCAMBP-2 F:GCAAGTCCCCATCGTGAATC;

[0191] Q pdeCAMBP-2 R:CTGAAGCTCGCCACTTTTGT;

[0192] Q pdeActin F:AAACTGTAATGGTCCTCCCTCCG;

[0193] Q pdeActin R:GCATCATCACAATCACTCTCCGA.

[0194] The expression levels of the pdeCAMBP-1 gene in different transgenic poplar trees are as follows: Figure 1 As shown in the figure. The pdeCAMBP-1 overexpressing transgenic poplar line OE-L89, which showed the most significant upregulation of pdeCAMBP-1 gene expression compared to wild-type poplar, was selected for subsequent research experiments.

[0195] The expression levels of the pdeCAMBP-2 gene in different transgenic poplar trees are as follows: Figure 2 As shown in the figure. The OE-L150 transgenic poplar line that showed the most significant upregulation of the pdeCAMBP-2 gene expression level compared to wild-type poplar was selected for subsequent research experiments.

[0196] The pdeCAMBP-interference transgenic poplar line mi-L41, whose expression levels of both pdeCAMBP-1 and pdeCAMBP-2 genes were most significantly downregulated, was selected for subsequent research experiments.

[0197] 3. Obtaining the knockout of genetically modified poplar trees

[0198] For positive transgenic plants introduced with pYLCRISPR / Cas9-R2, the pdeCaMBP-1 and pdeCaMBP-2 genes were detected according to the following steps: Using DNA from the positive transgenic plants as templates, PCR amplification was performed using 5'-CTCGCATCATTCACGCATG-3' as the forward primer and 5'-CATAGAATTGTTACCAGGAGAAG-3' as the reverse primer to detect the editing status of the pdeCaMBP-1 gene. PCR amplification was performed using 5'-TGAAAGTTCATGTATGAGCAGC-3' as the forward primer and 5'-CCTATCCTCATTGTTGCTAATC-3' as the reverse primer to detect the editing status of the pdeCaMBP-2 gene. The PCR products from each independent line were ligated into a cloning vector for single-clone sequencing, with at least 20 single clones from each line being analyzed.

[0199] Sequencing analysis revealed the editing status of the pdeCaMBP-1 and pdeCaMBP-2 genes in the obtained pdeCaMBP knockout transgenic poplar as follows: Figure 3 As shown in the figure. The pdeCaMBP knockout transgenic poplar line Cas9-L59, in which both pdeCaMBP-1 and pdeCaMBP-2 genes were knocked out, was selected for subsequent research experiments.

[0200] The pdeCaMBP knockout transgenic poplar line Cas9-L59 is a poplar mutant with a homozygous mutation in the pdeCaMBP-1 gene (the same mutation occurred on both chromosomes) and a heterozygous mutation in the pdeCaMBP-2 gene (the mutation occurred on one homologous chromosome, while the other chromosome did not). The only difference between the pdeCaMBP-1 gene and the wild-type poplar 'Nanlin 895' is that on the homologous chromosomes encoding the pdeCaMBP-1 protein, one chromosome has a 2bp deletion located at positions 714-715 of sequence 2, and the other chromosome has a 2bp insertion of the GA base located between positions 715 and 716 of sequence 2. On the homologous chromosomes encoding the pdeCaMBP-2 protein, one chromosome has a 4bp deletion located at positions 597-600 of sequence 5, and the other chromosome does not have the mutation (no difference from the wild-type DNA sequence).

[0201] Example 5: The pdeCAMBP gene significantly affects the formation and biomass of poplar organs.

[0202] The following experiments were conducted using the pdeCAMBP-1 overexpressing transgenic poplar OE-L89 (abbreviated as OE-L89), pdeCAMBP-2 overexpressing transgenic poplar OE-L150 (abbreviated as OE-L150), pdeCAMBP interference transgenic poplar mi-L41 (abbreviated as mi-L41), and pdeCaMBP knockout transgenic poplar Cas9-L59 (abbreviated as Cas9-L59) obtained in Example 4 as experimental materials:

[0203] I. The pdeCAMBP gene significantly affects the formation of poplar organs.

[0204] 1. The pdeCAMBP gene significantly affects poplar root formation.

[0205] After culturing transgenic seedlings in rooting medium for 15 days, the number and length of taproots of different transgenic plants (30 plants of each type were measured) were counted. Wild-type poplar 'Nanlin 895' (WT) was used as a control.

[0206] The results are as follows Figure 4 As shown in ac. The results showed that the number of taproots of WT, OE-L89, OE-L150, mi-L41, and Cas9-L59 were 3.03±1.39, 5±2.12, 4.23±1.67, 2.23±1.09, and 1.73±0.71, respectively, and the taproot lengths of WT, OE-L89, OE-L150, mi-L41, and Cas9-L59 were 4.92±1.04, 4.68±1.08, 4.82±1.04, 2.71±1.25, and 3.2±1.19, respectively. Compared with WT, mi-L41 and Cas9-L59 had 26.4% and 42.9% fewer taproots, respectively, and taproot lengths decreased by 44.9% and 34.96%, respectively. OE-L89 and OE-L150 had 65% and 39.6% more taproots, respectively.

[0207] 2. The pdeCAMBP gene significantly affects poplar leaf formation.

[0208] Transgenic seedlings grown in rooting medium for 15 days were transferred to soil culture pots. After one month of cultivation in a culture room, the number and phenotype of new leaves at the top of the poplar seedlings were observed under a smart 3D digital microscope.

[0209] The results are as follows Figure 4As shown in d. The results showed that the number of newly generated leaves in WT, OE-L89, OE-L150, mi-L41, and Cas9-L59 were 6, 8, 8, 4, and 3, respectively. Compared with WT, mi-L41 and Cas9-L59 had significantly fewer newly generated young leaves, while OE-L89 and OE-L150 had significantly more.

[0210] The results above indicate that the pdeCAMBP-1 and / or pdeCAMBP-2 genes play a crucial role in the production of new organs (young roots and young leaves) in poplar trees.

[0211] II. The pdeCAMBP gene significantly affects poplar biomass.

[0212] Transgenic seedlings grown in rooting medium for 15 days were transferred to soil culture pots. The characteristics of representative biomass, such as plant height, number of internodes, internode length (length from the first to the fifth node from top to bottom), and dry weight, of the transgenic poplar seedlings grown in soil for two months were statistically analyzed.

[0213] The results are as follows Figure 5As shown. The results showed that the plant heights of WT, OE-L89, OE-L150, mi-L41, and Cas9-L59 were 60±4.08cm, 63.3±1.34cm, 66.2±1.34cm, 52.38±4.63cm, and 44.8±3.80cm, respectively. The internode numbers of WT, OE-L89, OE-L150, mi-L41, and Cas9-L59 were 40±1.87, 40.8±1.72, 41±1.85, 31.25±3.56, and 19.2±2.13, respectively. Taking the representative third internode as... For example, the internode lengths of WT, OE-L89, OE-L150, mi-L41, and Cas9-L59 are 7.63±1.26mm, 9.17±1.97mm, 8.04±1.27mm, 13.91±4.98mm, and 35.38±7.95mm, respectively, and the dry weights of WT, OE-L89, OE-L150, mi-L41, and Cas9-L59 are 19.50±2.81g, 17.63±1.58g, 18.97±2.25g, 12.4±0.95g, and 11.45±1.03g, respectively. Compared to WT, the plant height of mi-L41 and Cas9-L59 decreased by 12.7% and 25.3%, respectively; the number of internodes decreased by 21.5% and 52%, respectively; and the dry weight decreased by 36.4% and 41.3%, respectively. In contrast, the plant height of OE-L89 and OE-L150 increased by 5.5% and 10.33%, respectively. Notably, compared to WT, the internode length of mi-L41 and Cas9-L59 plants also changed significantly, increasing by 82.31% and 363.7%, respectively.

[0214] The results above indicate that the pdeCAMBP-1 and / or pdeCAMBP-2 genes play an important regulatory role in internode development and biomass accumulation in poplar.

[0215] In conclusion, the pdeCAMBP-1 and / or pdeCAMBP-2 genes significantly affect the formation and biomass of new poplar organs. This discovery can provide new ideas for breeding new poplar varieties with high quality, fast growth, and good tree shape.

[0216] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. A protein or biological material associated with said protein, said protein being a protein as shown in a) or b) below: a) The amino acid sequence is that of the protein shown in sequence 4; b) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein shown in Sequence 4; The biomaterial is any one of the following A1) to A8): A1) The nucleic acid molecule that encodes the protein; A2) An expression cassette containing the nucleic acid molecules described in A1); A3) A recombinant vector containing the nucleic acid molecules described in A1); A4) A recombinant vector containing the expression cassette described in A2); A5) Recombinant microorganisms containing the nucleic acid molecules described in A1); A6) Recombinant microorganisms containing the expression cassette described in A2); A7) Recombinant microorganisms containing the recombinant vector described in A3); A8) Recombinant microorganisms containing the recombinant vector described in A4).

2. The biomaterial according to claim 1, characterized in that: A1) The nucleic acid molecule is the DNA molecule shown in sequence 5 or sequence 6.

3. The use of the protein or biological material according to claim 1 or 2 in any of the following: B1) Increase the number of plant organs; B2) Increase plant height; B3) Increase the number of taproots in plants; B4) Increase the number of plant leaves; B5) Transgenic plants with increased number of organs and / or plant height; The organ is a root and / or leaf; The plant in question is a poplar.

4. The use of a substance that reduces the content of PdeCAMBP-1 protein and the protein of claim 1 in plants in any of the following: D1) Reduce the number of plant organs; D2) Reduce plant biomass; D3) Reduce the number of taproots in plants; D4) Reduce the length of the plant's taproot; D5) Reduce the number of plant leaves; D6) Reduce plant height; D7) Reduce the number of internodes in plants; D8) Increase the length of plant internodes; D9) Reduce plant dry weight; D10) Transgenic plants with reduced organ number and / or reduced biomass and / or increased internode length; D11) Cultivating transgenic plants with altered tree shapes; The amino acid sequence of the PdeCAMBP-1 protein is shown in Sequence 1. The organ is a root and / or leaf; The plant in question is a poplar.

5. A method for cultivating transgenic plants with increased organ number and / or plant height, comprising the step of increasing the expression level and / or activity of the protein of claim 1 in a recipient plant to obtain a transgenic plant; wherein the transgenic plant has a higher organ number and / or plant height than the recipient plant; The organ is a root and / or leaf; The plant in question is a poplar.

6. A method for cultivating transgenic plants with reduced organ number and / or reduced biomass and / or reduced taproot length and / or reduced plant height and / or reduced internode number and / or increased internode length, comprising the step of reducing the expression level and / or activity of the protein of claim 1 and the PdeCAMBP-1 protein in a recipient plant to obtain the transgenic plant; wherein the number of organs and / or biomass and / or taproot length and / or plant height and / or number of internodes of the transgenic plant are lower than those of the recipient plant, and the internode length of the transgenic plant is higher than that of the recipient plant; The amino acid sequence of the PdeCAMBP-1 protein is shown in Sequence 1. The organ is a root and / or leaf; The plant in question is a poplar.

7. The method according to claim 6, characterized in that: The method for reducing the expression level and / or activity of the protein of claim 1 and the PdeCAMBP-1 protein in the recipient plant is to introduce a substance that interferes with the expression of the protein-coding gene of claim 1 and the PdeCAMBP-1 protein-coding gene in the recipient plant or a substance that knocks out the protein-coding gene of claim 1 and the PdeCAMBP-1 protein-coding gene in the recipient plant into the recipient plant.

Images