Library preparation methods for identifying base-specific regulatory elements based on high-throughput sequencing

Abstract

The application discloses a library construction method for identifying base-specific regulatory elements based on high-throughput sequencing, comprising the following steps: constructing a candidate susceptible SNP plasmid library; constructing an input type DNA sequencing library after PCR amplification and purification of the candidate susceptible SNP plasmid library; transfecting the plasmid library into target cells to obtain an RNA expression library; constructing an output type DNA sequencing library through reverse transcription, purification and PCR amplification; adding a one-step PCR amplification to the input type DNA sequencing library and the output type DNA sequencing library respectively to introduce different Barcode label sequences of different repeat groups, and respectively performing end A tailing and sequencing adapter connection to construct a mixed sample sequencing library. The method is a high-efficiency and low-cost library construction method based on high-throughput sequencing, and is used for identifying functional elements with base-specific regulatory activity on a genome.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and more specifically to a library construction method for identifying base-specific regulatory elements based on high-throughput sequencing. Background Technology

[0002] Currently, genome-wide association studies (GWASs) have identified tens of thousands of complex disease-related pathogenic / susceptibility loci, typically single nucleotide polymorphisms (SNPs), most of which are located in non-coding regions of the genome. Therefore, in-depth analysis of the molecular genetic regulatory mechanisms of these non-coding disease susceptibility SNPs is a key focus and challenge in the post-GWAS era. In recent years, with the development of next-generation sequencing (NGS) technology, researchers have successively developed various high-throughput regulatory element detection technologies based on NGS to identify the regulatory activity of non-coding functional elements and susceptibility SNPs. Typical examples include massively parallel reporter assays (MPRA) and self-transcribing active regulatory region sequencing (STARR-seq). Thanks to these new technologies, researchers can systematically detect the allele-specific expression regulatory activity of tens of thousands of functional elements and disease susceptibility SNPs.

[0003] High-throughput reporter analysis systems (MPRA and STARR-seq) mainly consist of three steps: 1) candidate fragment plasmid library construction; 2) plasmid library transfection into target cells for expression; and 3) high-throughput sequencing library construction (plasmid sequencing library and RNA expression sequencing library). For step 1, current methods primarily employ whole-genome fragment sonication or microarray capture to obtain candidate fragments. However, neither of these methods can detect different allelic genotypes of SNPs, only obtaining one genotype from the genome. Furthermore, subsequent fragment end repair, A-tail addition, and adapter ligation are required before ligation with the reporter gene vector to obtain the plasmid library. Additionally, the microarray capture method is more complex, influenced by more factors, and more expensive. Moreover, MPRA experiments often use microarrays to synthesize candidate SNP sequences and corresponding barcode tag sequences to detect the base-specific regulatory activity of different SNP genotypes. However, this method requires simultaneous synthesis of candidate SNP fragments and barcode tag sequences, increasing costs, and the two fragments must be ligated separately into the reporter gene vector, making the operation more complex. For step 3, the current standard procedure involves reverse transcription using reporter-RNA specific primers to enrich the expressed polyA+ RNA, obtaining cDNA. This is followed by a first round of PCR using reporter-RNA specific primers, purification, and a second round of PCR using sequencing adapter primers to obtain the final product. This method requires multiple PCR operations, which easily introduces PCR amplification bias, leading to inaccurate quantification of candidate fragments and thus reducing the accuracy of high-throughput detection systems. Summary of the Invention

[0004] The purpose of this invention is to overcome the shortcomings of existing technologies and provide a library construction method for identifying base-specific regulatory elements based on high-throughput sequencing. This method is an efficient and inexpensive library construction method based on high-throughput sequencing, used to identify functional elements with base-specific regulatory activities on the genome.

[0005] To achieve the above objectives, the present invention employs the following technical solution:

[0006] This invention provides a library construction method for identifying base-specific regulatory elements based on high-throughput sequencing, comprising:

[0007] Construct a library of candidate susceptible SNP plasmids;

[0008] The candidate susceptible SNP plasmid library was amplified by PCR, purified, and then used to construct an input DNA sequencing library.

[0009] The plasmid library was transfected into target cells to obtain an RNA expression library; reverse transcription, purification, and PCR amplification were performed to construct an output DNA sequencing library;

[0010] One-step PCR amplification was added to the input DNA sequencing library and the output DNA sequencing library to introduce different barcode tag sequences for different repeat groups. A-tailing and sequencing adapter ligation were then performed on the input and output DNA sequencing libraries to construct a mixed sample sequencing library.

[0011] As a further improvement of the present invention, the construction of the candidate susceptible SNP plasmid library includes:

[0012] Double-stranded DNA libraries were obtained from single-stranded DNA libraries containing different allelic genotypes of all candidate SNPs. The double-stranded DNA libraries were then assembled with enzyme-digested reporter vectors to construct candidate susceptible SNP plasmid libraries.

[0013] As a further improvement of the present invention, the step of obtaining a double-stranded DNA library from a single-stranded DNA library containing different allelic genotypes of all candidate SNPs, assembling the double-stranded DNA library with an enzyme-digested reporter vector, and constructing a candidate susceptible SNP plasmid library specifically includes:

[0014] a. Using a precise primer pool synthesis method, a single-stranded DNA library containing different alleles of all candidate SNPs was obtained;

[0015] b. Amplify the single-stranded DNA library by PCR using the first and second primers and purify it to obtain a double-stranded DNA library;

[0016] c. Using Age I and Sal I to double-digest the high-throughput reporter vector, assemble the double-stranded DNA library and the digested reporter vector to construct a candidate susceptible SNP plasmid library containing different genotypes of all candidate SNPs.

[0017] The first and second primers contain complementary base regions of the PCR adapter sequence -F and R.

[0018] As a further improvement to the present invention, the method of synthesizing using a precise primer pool also includes:

[0019] Using the candidate SNP as the center, obtain the sequence information upstream and downstream of the SNP, and add PCR adapter sequences F and R to both ends of the sequence to obtain the complete set of sequences for library construction.

[0020] As a further improvement of the present invention, the step of constructing an input DNA sequencing library after PCR amplification and purification of the candidate susceptible SNP plasmid library includes:

[0021] a. The candidate susceptible SNP plasmid library was amplified by one-step PCR using the third primer, and the purified DNA library with specific molecular tags was obtained.

[0022] b. The DNA library with a specific molecular tag was amplified by PCR using the fourth and fifth primers, and the purified DNA was used to obtain the input DNA sequencing library.

[0023] As a further improvement of the present invention, the third primer is a specific molecular tag primer, which consists of the following three parts:

[0024] Random sequences are composed of multiple bases and serve as specific molecular tag regions, providing specific molecular tags for each RNA / plasmid during reverse transcription and one-step PCR.

[0025] The 3' end of the random sequence serves as the second primer, which specifically recognizes the RNA expressed in the candidate susceptible SNP plasmid library;

[0026] The 5' end of the random sequence is the fifth primer, which provides the binding region for the next step of PCR amplification.

[0027] As a further improvement of the present invention, the step of using a third primer to perform one-step PCR amplification of the candidate susceptible SNP plasmid library, and obtaining a DNA library with a specific molecular tag after purification, specifically includes:

[0028] Candidate susceptible SNP plasmid libraries were transiently transfected into target cells. After full expression, total RNA was extracted from the cells, DNase I was added to remove DNA contamination from the RNA, the total RNA was processed using a Poly(A) mRNA magnetic bead separation module, and further concentrated and purified to obtain an RNA expression library.

[0029] The RNA expression library was reverse transcribed using a third primer, and the purified DNA library with a specific molecular tag was obtained.

[0030] As a further improvement of the present invention, the transfection of the plasmid library into target cells to obtain an RNA expression library; reverse transcription, purification, and PCR amplification are performed to construct an output DNA sequencing library; including:

[0031] a. Transfect the plasmid library into target cells, extract total RNA from the cells, remove DNA contamination from the RNA, isolate and purify it to obtain Poly(A) mRNA, and obtain an RNA expression library;

[0032] b. The RNA expression library was reverse transcribed using a third primer, and the purified DNA library with specific molecular tags was obtained.

[0033] c. A DNA library with a specific molecular tag is amplified by PCR using the sixth and fifth primers to obtain an output DNA sequencing library;

[0034] The sixth primer has a thiophosphate bond, which enables it to specifically bind only to reporter gene transcripts after intron cleavage, and not to recognize and bind to candidate library plasmids.

[0035] As a further improvement of the present invention, the addition of one-step PCR amplification to the input DNA sequencing library and the output DNA sequencing library to introduce different barcode tag sequences for different repeat groups includes:

[0036] The seventh primer and the fifth primer, the eighth primer and the fifth primer, and the ninth primer and the fifth primer were used to PCR amplify the three biological repeats of the input DNA sequencing library, and the mixed input DNA sequencing library was obtained after purification.

[0037] The tenth primer and the fifth primer, the eleventh primer and the fifth primer, and the twelfth primer and the fifth primer were used to extract three biological repeats from the output DNA sequencing library, and the mixed output DNA sequencing library was obtained after purification.

[0038] As a further improvement of the present invention, the step of separately adding A-tails to the ends and ligating sequencing adapters to construct a mixed sample sequencing library includes:

[0039] After multiple replicates of mixed input DNA sequencing libraries or mixed output DNA sequencing libraries, A-tailing and sequencing adapter ligation were performed on each library to construct a mixed sample sequencing library.

[0040] Primers 7 through 9 are barcode tag primers for mixed-input DNA sequencing libraries, and have barcode tags composed of bases;

[0041] Primers 10-12 are barcode tag primers for mixed output DNA sequencing libraries, and have barcode tags composed of bases.

[0042] Compared with the prior art, the present invention has the following beneficial effects:

[0043] This invention combines a precise primer pool synthesis method to synthesize fragments (single-stranded DNA libraries) of different alleles for all candidate SNPs, thereby enabling the systematic detection of functional elements with base-specific regulatory activity on the genome. By combining a precise primer pool synthesis method with unique molecular tags (UMIs), this invention simplifies library preparation, improves experimental accuracy, and reduces costs, providing a high-throughput sequencing-based method for identifying base-specific regulatory elements. Attached Figure Description

[0044] To more clearly illustrate the technical solutions in the specific embodiments of this application or the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this application. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0045] The accompanying drawings are used to specifically illustrate the vector diagram, the working principle diagram of the special primers, and the construction process of each library of the present invention, and constitute a part of the specification. They are used together with the examples of the present invention to explain the present invention, but do not constitute a limitation of the present invention.

[0046] Figure 1 This is a schematic diagram of a high-throughput reporting carrier.

[0047] Figure 2 This is a schematic diagram illustrating the working principle of UMI.

[0048] Figure 3 A schematic diagram illustrating the process of constructing a plasmid library for candidate susceptible SNPs.

[0049] Figure 4 A schematic diagram of the process for constructing an input DNA sequencing library;

[0050] Figure 5 A schematic diagram of the process for constructing an output DNA sequencing library. Detailed Implementation

[0051] To make the technical problems, technical solutions, and beneficial effects of this application clearer, the following detailed description is provided in conjunction with embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the scope of this application.

[0052] In this application, the term "and / or" describes the relationship between related objects, indicating that three relationships can exist. For example, A and / or B can represent: A existing alone, A and B existing simultaneously, or B existing alone. A and B can be singular or plural. The character " / " generally indicates that the preceding and following related objects have an "or" relationship.

[0053] In this application, "at least one" means one or more, and "more than one" means two or more. "At least one of the following" or similar expressions refer to any combination of these items, including any combination of single or multiple items. For example, "at least one of a, b, or c", or "at least one of a, b, and c" can both mean: a, b, c, a~b (i.e., a and b), a~c, b~c, or a~b~c, where a, b, and c can be single or multiple.

[0054] It should be understood that in the various embodiments of this application, the order of the above processes does not imply the order of execution. Some or all steps may be executed in parallel or sequentially. The execution order of each process should be determined by its function and internal logic, and should not constitute any limitation on the implementation process of the embodiments of this application.

[0055] The terminology used in the embodiments of this application is for the purpose of describing particular embodiments only and is not intended to be limiting of this application. The singular forms “a,” “the,” and “the” used in the embodiments of this application and the appended claims are also intended to include the plural forms unless the context clearly indicates otherwise.

[0056] The weight of the relevant components mentioned in the embodiments of this application can refer not only to the specific content of each component, but also to the proportional relationship between the weights of each component. Therefore, as long as the content of the relevant components is scaled up or down proportionally according to the embodiments of this application, it is within the scope disclosed in the embodiments of this application.

[0057] This invention relates to a library construction method for identifying base-specific regulatory elements based on high-throughput sequencing, and particularly to the construction of plasmid libraries of base-specific SNP regulatory fragments and the construction of sequencing libraries of specific molecular tags.

[0058] The purpose of this invention is to provide a library construction method for identifying base-specific regulatory elements based on high-throughput sequencing, comprising:

[0059] Construct a library of candidate susceptible SNP plasmids;

[0060] The candidate susceptible SNP plasmid library was amplified by PCR, purified, and then used to construct an input DNA sequencing library.

[0061] The plasmid library was transfected into target cells to obtain an RNA expression library; reverse transcription, purification, and PCR amplification were performed to construct an output DNA sequencing library;

[0062] One-step PCR amplification was added to the input DNA sequencing library and the output DNA sequencing library to introduce different barcode tag sequences for different repeat groups. A-tailing and sequencing adapter ligation were then performed on the input and output DNA sequencing libraries to construct a mixed sample sequencing library.

[0063] This invention introduces a barcode tag sequence via PCR amplification before library construction, enabling mixed sequencing of multiple biological repeats, which greatly reduces sequencing costs.

[0064] The complete technical solution adopted in this invention is as follows:

[0065] S1, Construction of candidate susceptible SNP plasmid library

[0066] a. Using a precise primer pool synthesis method, a single-stranded DNA library containing different alleles of all candidate SNPs was obtained 1;

[0067] b. The single-stranded DNA library 1 was amplified by PCR using primer 1 and primer 2 and then purified to obtain the double-stranded DNA library 2;

[0068] c. High-throughput reporter vector 1 was digested with Age I and Sal I. Figure 1 The double-stranded DNA library 2 and the enzyme-digested reporter vector 1 were assembled to construct a candidate susceptible SNP plasmid library 1 containing different genotypes of all candidate SNPs.

[0069] S2, Construction of input DNA sequencing library

[0070] a. Use third primer 3 (UMI, Figure 2 The candidate susceptible SNP plasmid library 1 was amplified by one-step PCR and purified to obtain DNA library 3 with specific molecular tags.

[0071] b. DNA library 3 was amplified by PCR using primer 4 and primer 5, and purified to obtain DNA library 4, which is the input DNA sequencing library.

[0072] S3, Construction of output DNA sequencing libraries

[0073] a. Transfect candidate susceptible SNP plasmid library 1 into target cells, extract total RNA from cells, remove DNA contamination from RNA, isolate and purify to obtain Poly(A) mRNA, and obtain RNA expression library;

[0074] b. The RNA expression library was reverse transcribed using the third primer 3 (UMI), and purified to obtain the DNA library 5 with a specific molecular tag, i.e., the cDNA library;

[0075] c. The cDNA library was amplified by PCR using primer 6 and primer 5 to obtain DNA library 6, which is the output DNA sequencing library.

[0076] The input and output DNA sequencing libraries obtained above were directly ligated with A-tails and sequencing adapters, purified, and then directly used for next-generation sequencing on the Illumina platform.

[0077] S4, Construction of mixed-sample sequencing library

[0078] For libraries with multiple biological repeats, a PCR step can be added to introduce different barcode tag sequences for different repeats. Here, we take 3 biological repeats as an example.

[0079] a. The 7th primer 7 and the 5th primer 5, the 8th primer 8 and the 5th primer 5, and the 9th primer 9 and the 5th primer 5 were used to PCR amplify the three biological repeats of DNA library 4, and the purified mixed-input type DNA sequencing library, namely DNA library 7.

[0080] b. Primer 10 and primer 5, primer 11 and primer 5, primer 12 and primer 5 were used to amplify the three biological repeats of DNA library 6 by PCR, and the mixed output DNA sequencing library, namely DNA library 8, was obtained by purification.

[0081] c. After mixing the three replicates of DNA library 7 or DNA library 8, A-tails are added to the ends and sequencing adapters are ligated, followed by next-generation sequencing.

[0082] This invention combines a precise primer pool synthesis method to synthesize fragments of different alleles of all candidate SNPs (single-stranded DNA library 1), thereby enabling the systematic detection of functional elements with base-specific regulatory activity on the genome.

[0083] This invention requires only one pair of fixed primers (primer 1 and primer 2) to bind to the PCR adapter sequence in single-stranded DNA library 1, perform PCR, and enrich DNA fragments (double-stranded DNA library 2). This method has the advantages of high efficiency and simplicity, simple reaction conditions, and low cost.

[0084] In the DNA sequencing library construction process, this invention adds a specific molecular tag (UMI) to each plasmid and each expressed RNA sequence using a one-step PCR and reverse transcription method. The introduction of UMIs not only enables precise quantification of the number of starting molecules, but also reduces errors generated during sequencing and library preparation, as well as the heterogeneity caused by PCR amplification, thereby achieving absolute quantification of each sequence and increasing the accuracy of this high-throughput identification system.

[0085] The present invention will now be described in detail with reference to the embodiments and accompanying drawings. The following embodiments are only used to further explain the present invention and do not constitute any limitation on the scope of the present invention. Those skilled in the art can modify and adjust the technical details based on these embodiments.

[0086] Please refer to the attached figures. This invention provides a library construction method for identifying base-specific regulatory elements based on high-throughput sequencing.

[0087] S1, Construction of candidate susceptible SNP plasmid library

[0088] The construction process in this section is as follows: Figure 3 .

[0089] a. Using the candidate SNP as the center, obtain 120bp of sequence information upstream and downstream of the SNP. Add PCR adapter sequences F and R to both ends of the sequence, and the total length of the sequence is 150bp.

[0090] b. Using a precise primer pool synthesis method, a single-stranded DNA library containing different allelic genotypes of all candidate SNPs was obtained.

[0091] c. The single-stranded DNA library 1 was amplified by PCR using primer 1 and primer 2 and then purified to obtain the double-stranded DNA library 2;

[0092] d. High-throughput reporter vector 1 was digested with Age I and Sal I. Figure 1 After recovery and purification, double-stranded DNA library 2 and enzyme-digested reporter vector 1 were assembled using the NEBuilder reaction. After transformation with E. coli, endotoxin-free plasmids were extracted to obtain candidate susceptible SNP plasmid library 1 containing different genotypes of all candidate SNPs.

[0093] Note: The candidate SNP sequence length is only an example and can be increased or decreased as needed.

[0094] S2, Construction of input DNA sequencing library

[0095] The construction process in this section is as follows: Figure 4 .

[0096] a. The candidate susceptible SNP plasmid library 1 was amplified by one-step PCR using the third primer 3 (program: 98℃, 30s; 63℃, 30s; 72℃, 2min; 1 cycle). After purification, the DNA library 3 with specific molecular tags was obtained.

[0097] b. DNA library 3 was amplified by PCR using primer 4 and primer 5. After purification, DNA library 4 was obtained, which is the input DNA sequencing library and meets the sample loading requirements of the Illumina platform sequencer.

[0098] S3, Construction of output DNA sequencing libraries

[0099] The construction process in this section is as follows: Figure 5 .

[0100] a. Transiently transfect candidate susceptible SNP plasmid library 1 into target cells. After expression for 24 hours, total RNA was extracted from the cells, DNase I was added to remove DNA contamination from the RNA, the total RNA was processed using a Poly(A) mRNA magnetic bead separation module, and further concentrated and purified to obtain the RNA expression library.

[0101] b. The RNA expression library was reverse transcribed using the third primer 3 (program: 42℃, 1h; 80℃, 5min), and after purification, a DNA library 5 with a specific molecular tag was obtained, namely the cDNA library;

[0102] c. The cDNA library was amplified by PCR using primer 6 and primer 5 to obtain DNA library 6, which is the output DNA sequencing library.

[0103] Note: The reverse transcription procedure is for reference only. The reverse transcription conditions should be set according to the reagents and primers used.

[0104] The input and output DNA sequencing libraries obtained above were directly ligated with A-tails and sequencing adapters, purified, and then directly used for next-generation sequencing on the Illumina platform.

[0105] S4, Construction of mixed-sample sequencing library

[0106] For libraries with multiple biological repeats, one-step PCR amplification can be used to introduce different barcode tag sequences for each repeat. Here, we take three biological repeats as an example. The input DNA sequencing library tags are primer 7, primer 8, and primer 9, and the output DNA sequencing library tags are primer 10, primer 11, and primer 12.

[0107] a. Mixed-input DNA sequencing library: The 7th primer 7 and the 5th primer 5, the 8th primer 8 and the 5th primer 5, and the 9th primer 9 and the 5th primer 5 were used to PCR amplify the three biological repeats of DNA library 4, and the DNA library 7 was obtained after purification.

[0108] b. Mixed output DNA sequencing library: The 10th primer 10 and the 5th primer 5, the 11th primer 11 and the 5th primer 5, and the 12th primer 12 and the 5th primer 5 were used to PCR amplify the three biological repeats of DNA library 6, and the DNA library 8 was purified.

[0109] c. After mixing the three repeats of DNA library 7 (or DNA library 8), A-tails are added to the ends and sequencing adapters are ligated, followed by next-generation sequencing. Subsequently, different biological repeat libraries can be separated by extracting the barcode tag sequences.

[0110] As an optional embodiment, the primers in the embodiments of this application can be designed according to requirements. For example, the primer sequences used in this invention are as follows (5'-3'):

[0111] PCR adapter sequence-F: GATCTAGAGCATGCA

[0112] PCR adapter sequence-R: CGATTCGGCCGGCC

[0113] First primer 1: GAATTAGATT GATCTAGAGCATGCA

[0114] Second primer 2: TCGAGC GGCCGGCCGAATTCG

[0115] [Note] The "_" part of the first primer 1 and the second primer 2 is the complementary region of the PCR adapter sequence -F and R.

[0116] Third primer 3:

[0117] ACACGACGCTCTTCCGATCTNNNNNNNNNNNNNTCGAAGCGGCCGGCCGAATTCG

[0118] [Note] Primer 3 is a specific molecular tag primer, i.e., UMI. This primer consists of the following three parts: NNNNNNNNNNNNN is a random sequence of 13 bases, which is the specific molecular tag region. During reverse transcription and one-step PCR, it provides a specific molecular tag for each RNA / plasmid. It should be noted that the length of the random sequence can be appropriately reduced according to the library size; the 3' end of the random sequence is primer 2, which specifically recognizes the RNA expressed in candidate susceptible SNP plasmid library 1, avoiding the reverse transcription of a large amount of irrelevant mRNA by oligo dT, reducing the subsequent sequencing cost and data analysis difficulty; the 5' end is primer 5, which provides the binding region for the next step of PCR amplification.

[0119] Fourth primer 4: GCATGGCTAGCAAAGGAGAAGAAC

[0120] Fifth primer 5: ACACGACGCTCTTCCGATCT

[0121] Primer 6: TCGTGAGGCACTGGGCAG*G*T*G*T*C

[0122] [Note] The "*" at the 3' end of the sixth primer represents a phosphate thioester bond. This treatment ensures that the sixth primer can only specifically bind to the reporter gene transcript after the intron has been cleaved, and cannot recognize and bind to candidate library plasmids. Therefore, specific enrichment of cDNA is achieved, avoiding the introduction of plasmid contamination.

[0123] Seventh primer 7: CTGTACAT TGGAGTTGTCCCAATTCTTG

[0124] Primer 8: ACGTATGA TGGAGTTGTCCCAATTCTTG

[0125] Ninth primer 9: ATAAGGTC TGGAGTTGTCCCAATTCTTG

[0126] [Note] Primers 7 through 9 are three sets of barcode tag primers for mixed-input DNA sequencing libraries, where the “_” part is a barcode tag consisting of 8 bases.

[0127] Primer 10: CTGTACAT GGCTAGCAAAGGAGAAGAAC

[0128] Eleventh primer 11: ACGTATGA GGCTAGCAAAGGAGAAGAAC

[0129] Primer 12: ATAAGGTC GGCTAGCAAAGGAGAAGAAC

[0130] [Note] Primers 10 through 12 are three sets of barcode tag primers for the mixed output DNA sequencing library, where the “_” part is a barcode tag consisting of 8 bases.

[0131] All articles and references disclosed above, including patent applications and publications, are incorporated herein by reference for various purposes. The term “substantially constitutes…” used to describe a combination should include the identified elements, components, parts, or steps, as well as other elements, components, parts, or steps that do not substantially affect the essential novelty of the combination. The use of the terms “comprising” or “including” to describe combinations of elements, components, parts, or steps herein also contemplates embodiments substantially constituted by such elements, components, parts, or steps. The use of the term “may” herein is intended to indicate that any described attribute included by “may” is optional.

[0132] Multiple elements, components, parts, or steps can be provided by a single integrated element, component, part, or step. Alternatively, a single integrated element, component, part, or step can be divided into multiple separate elements, components, parts, or steps. The use of "a" or "an" to describe an element, component, part, or step does not imply the exclusion of other elements, components, parts, or steps.

[0133] It should be understood that the above description is for illustrative purposes and not for limitation. Many embodiments and applications beyond the provided examples will be apparent to those skilled in the art upon reading the above description. Therefore, the scope of this teaching should not be determined by reference to the above description, but rather by reference to the foregoing claims and the full scope of their equivalents. For purposes of completeness, all articles and references, including patent applications and publications, are incorporated herein by reference. The omission of any aspect of the subject matter disclosed herein in the foregoing claims is not intended as a waiver of that subject matter, nor should it be construed as an indication that the applicant has not considered that subject matter as part of the disclosed inventive subject matter.

Claims

1. A library construction method for identifying base-specific SNP regulatory fragments based on high-throughput sequencing, characterized in that, include: Construct a library of candidate susceptible SNP plasmids; The candidate susceptible SNP plasmid library was amplified by one-step PCR using the third primer. After purification, a DNA library with a specific molecular tag was obtained. The DNA library with the specific molecular tag was amplified by PCR using the fourth and fifth primers. After purification, an input DNA sequencing library was obtained. Candidate susceptible SNP plasmid libraries were transiently transfected into target cells. After sufficient expression, total RNA was extracted from the cells, and DNase I was added to remove DNA contamination from the RNA. The total RNA was then processed using a Poly(A) mRNA magnetic bead separation module and further concentrated and purified to obtain an RNA expression library. The RNA expression library was reverse transcribed using a third primer, and after purification, a DNA library with specific molecular tags was obtained. DNA libraries with specific molecular tags were amplified by PCR using the sixth and fifth primers to obtain output DNA sequencing libraries. The seven primers were used in combination with the fifth primer, the eighth primer in combination with the fifth primer, and the ninth primer in combination with the fifth primer, respectively. The three biological repeats of the imported DNA sequencing library were amplified by PCR, and the mixed imported DNA sequencing library was purified. The three biological repeats of the output DNA sequencing library were amplified by PCR using primers 10 and 5, 11 and 5, and 12 and 5, respectively, and the mixed output DNA sequencing library was purified. After multiple replicates of mixed input DNA sequencing libraries or mixed output DNA sequencing libraries, A-tailing and sequencing adapter ligation were performed on each library to construct a mixed sample sequencing library. The third primer is a specific molecular tag primer, namely UMI, which consists of the following three parts: Random sequences are composed of multiple bases and serve as specific molecular tag regions, providing specific molecular tags for each RNA / plasmid during reverse transcription and one-step PCR. The 3' end of the random sequence serves as the second primer, which specifically recognizes the RNA expressed in the candidate susceptible SNP plasmid library; The 5' end of the random sequence is the fifth primer, which provides the binding region for the next step of PCR amplification; The seventh to ninth primers are barcode tag primers for mixed input DNA sequencing libraries, each having an 8-base barcode tag; the tenth to twelfth primers are barcode tag primers for mixed output DNA sequencing libraries, each having an 8-base barcode tag.

2. The database construction method according to claim 1, characterized in that, The construction of the candidate susceptible SNP plasmid library includes: Double-stranded DNA libraries were obtained from single-stranded DNA libraries containing different allelic genotypes of all candidate SNPs. The double-stranded DNA libraries were then assembled with enzyme-digested reporter vectors to construct candidate susceptible SNP plasmid libraries.

3. The database construction method according to claim 1, characterized in that, The sixth primer has a thiophosphate bond, which enables it to specifically bind only to reporter gene transcripts after intron cleavage, and not to recognize and bind to candidate library plasmids.

4. The database construction method according to claim 1, characterized in that, The random sequence of the third primer consists of 13 bases.

5. The database construction method according to claim 1, characterized in that, The procedure for one-step PCR amplification of the candidate susceptible SNP plasmid library using the third primer is as follows: 98℃, 30s; 63℃, 30s; 72℃, 2min; 1 cycle.

6. The database construction method according to claim 1, characterized in that: The seventh primer is: CTGTACATTGGAGTTGTCCCAATTCTTG; The eighth primer is: ACGTATGATGGAGTTGTCCCAATTCTTG; The ninth primer is: ATAAGGTCTGGAGTTGTCCCAATTCTTG; The tenth primer is: CTGTACATGGCTAGCAAAGGAGAAGAAC; The eleventh primer is: ACGTATGAGGCTAGCAAAGGAGAAGAAC; The twelfth primer is: ATAAGGTCGGCTAGCAAAGGAGAAGAAC.

7. The database construction method according to claim 1, characterized in that, After mixing the three biological repeats of the mixed input DNA sequencing library or the mixed output DNA sequencing library, A-tailing is added to the ends and sequencing adapters are ligated, followed by next-generation sequencing.

Images