Method for preparing circular single-stranded DNA using dynamic nick and application thereof

Abstract

The application belongs to the technical field of molecular biology, and relates to a method for preparing circular single-stranded DNA by using dynamic nick and application, comprising the following steps: through designing linear precursor single-stranded DNA, the linear single-stranded DNA is formed into a dynamic nick structure, the distance between the 3' end and the 5' end is instantaneously shortened, the 3' end and the 5' end are connected under the action of a ligase, and circular single-stranded DNA is obtained. The dynamic nick does not need to be very stable, can instantaneously shorten the distance between the 3' end and the 5' end, and under the action of the ligase, the 3' end and the 5' end are connected, and circular single-stranded DNA is obtained. The method significantly reduces the generation of by-products, and does not need to additionally add an auxiliary chain or an additional sequence, and solves the technical problems of low connection efficiency of short-length circular single-stranded DNA, the need for a ring auxiliary chain, more by-products or complicated operation in the prior art.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, specifically relating to a method and application for preparing circular single-stranded DNA using dynamic nicks. Background Technology

[0002] Nucleic acids are not only carriers of genetic information and essential nutrients for the human body, but also crucial application materials. Circular single-stranded DNA (RSDNA) is a circular structure formed by connecting single-stranded DNA or other modified DNA end-to-end. RSDNA has a wide range of applications in terms of kinetics and topological constraints. Due to the absence of exposed 5′ phosphate and 3′ hydroxyl ends, it exhibits high resistance to nucleases and has been widely used in gene diagnostics and therapy, including circular aptamers, drug delivery, and oligonucleotide drug development. Furthermore, due to the unique morphology and kinetic properties of RSDNA, it is widely used in the construction of nanostructures such as molecular motors, DNA origami, and DNA nanoflowers. In addition, RSDNA can serve as a template for rolling circle amplification (RCA), further expanding its application in detection. Therefore, developing efficient strategies for circularizing RSDNA has broad application prospects, and a method for efficiently preparing RSDNA is urgently needed.

[0003] Currently, the enzymatic preparation of circular single-stranded DNA involves cyclization by using ligases to catalyze the formation of phosphodiester bonds between the 5′ phosphate terminus and the 3′ hydroxyl terminus. This can be divided into two categories: one uses cyclases for direct cyclization, but cyclases are relatively expensive and require Mn. 2+ One approach is the use of a cyclization aid; another is the traditional cyclization method, which uses a cyclization helper strand. However, during enzymatic preparation, the cyclization yield decreases significantly and is accompanied by a large number of cyclization byproducts when the substrate length is less than 40 nt or the substrate concentration exceeds 5 μM. To address this issue, researchers have conducted a series of studies, but these studies are still based on cyclization methods using helper strands. In view of this, this invention studies and develops a single-stranded DNA cyclization strategy that does not require a cyclization helper strand. Summary of the Invention

[0004] The purpose of this invention is to address the technical problems in existing technologies, such as low ligation efficiency of short-length circular single-stranded DNA, the need for circular auxiliary strands, numerous byproducts, or cumbersome operations. This invention proposes a method and application for preparing circular single-stranded DNA using dynamic nicks. This method simulates the secondary structure of the target circular single-stranded DNA, designs nick positions to obtain linear precursor single-stranded DNA, utilizes the linear single-stranded DNA itself to form dynamic nicks, and then ligates them using T4 DNA ligase to obtain circular single-stranded DNA. The dynamic nicks do not need to be highly stable; they only need to be able to instantly pull the 3′ and 5′ ends together. This method significantly reduces the generation of byproducts and eliminates the need for additional auxiliary strands or extra sequences.

[0005] The technical solution of this invention is:

[0006] This invention protects a method for preparing circular single-stranded DNA, comprising the following steps: designing linear precursor single-stranded DNA to form a dynamic Nick structure, thereby instantly bringing the 3′ end and 5′ end closer together; and then connecting the 3′ end and 5′ end under the action of a ligase to obtain circular single-stranded DNA.

[0007] In this process, linear single-stranded DNA can achieve circularization by forming nicks using its own secondary structure. The nicks can be formed instantaneously and dynamically. The nick structure does not need to be very stable. It is enough to instantly shorten the distance between the 3′ and 5′ ends of the linear single-stranded DNA. Then, under the action of ligase, the nicks can be joined to achieve the self-circularization of the linear single-stranded DNA.

[0008] In the preparation method of the present invention, the linear single-stranded DNA molecule itself forms a dynamic nick, which brings the 5′ end and 3′ end close to each other to achieve cyclization. This method itself is an intramolecular cyclization, which is not prone to producing byproducts and has high cyclization efficiency.

[0009] At the same time, this method does not require the addition of additional ring-forming auxiliary chains or extra sequences, and will not affect subsequent applications.

[0010] Furthermore, the desired circular single-stranded DNA is simulated for circular secondary structure. The nick is designed near the middle of a continuous complementary region, which is required to be 5-18 bp. The designed linear precursor single-stranded DNA forms a dynamic nick structure through intramolecular hybridization. Then, T4 DNA ligase is used to ligate the dynamic nick, thereby achieving circularization.

[0011] Preferably, a continuous complementary region of 5–18 bp is selected to design nick position-assisted looping; secondary structure simulation can be performed using computer software, such as, but not limited to, the application of software such as Mfold and IDT.

[0012] Furthermore, the secondary structure of circular single-stranded DNA contains a continuous complementary region of 5–18 bp, and the length of the single-stranded DNA sequence outside the complementary region is 6–890 nt; at the Nick structure, the continuous complementary base pairs are 3–9 bp starting from the 3′ end of the linear precursor single-stranded DNA, and 2–9 bp starting from the 5′ end of the linear precursor single-stranded DNA.

[0013] Furthermore, the connection of the dynamic nick includes the following steps:

[0014] Linear single-stranded DNA, ligase, and ligase buffer were mixed into a single ligation system, and the ligation reaction was carried out at 16℃ to 37℃ for 0.5 to 72 h.

[0015] The linear single-stranded DNA has a length of 16–900 nt and a concentration of ≤100 μM, specifically 0.01–100 μM; the ligase is T4 DNA ligase, and the buffer for the ligase reaction is 0.02–2 times that of the standard ligase buffer, i.e., 0.02–2.0 × T4 DNA ligase buffer.

[0016] The length of the linear single-stranded DNA is 16–900 nt, for example, it can be 16 nt, 30 nt, 40 nt, 50 nt, 60 nt, 80 nt, 200 nt, 300 nt, 500 nt, or 899 nt, but is not limited to the listed values; other unlisted values ​​within this range are also applicable. Preferably, the length of the linear single-stranded DNA is 16–300 nt; more preferably, the length of the linear single-stranded DNA is 30–100 nt.

[0017] The temperature for the above-mentioned connection reaction is 16℃ to 37℃, for example, it can be 16℃, 20℃, 25℃, 28℃, 30℃, 32℃, 33℃, 35℃ or 37℃, etc., but is not limited to the listed values. Other unlisted values ​​within this range are also applicable.

[0018] The reaction time is 0.5 to 72 hours, depending on the substrate concentration and the required reaction yield. For example, it can be 0.5 hours, 2 hours, 4 hours, 6 hours, 8 hours, 10 hours, 12 hours, 16 hours, 18 hours, 24 hours, 36 hours, 48 ​​hours, or 72 hours, but is not limited to the listed values. Other unlisted values ​​within this range are also applicable.

[0019] The buffer for the ligase reaction is 0.02 to 2 times the volume of the standard ligase buffer, for example, 0.02, 0.04, 0.06, 0.1, 0.5, 1, 1.4, 1.6, 1.8, or 2 times, but is not limited to the listed values; other unlisted values ​​within this range are also applicable. More preferably, it is 0.05 to 0.2 × T4 DNA ligase buffer (0.05 to 0.2 times).

[0020] The concentration of the linear single-stranded DNA is ≤100 μM, for example, it can be 0.01 μM, 0.05 μM, 0.1 μM, 0.5 μM, 0.8 μM, 1 μM, 10 μM, 20 μM, 30 μM, 40 μM, 60 μM, 80 μM, 90 μM or 100 μM, but is not limited to the listed values. Other unlisted values ​​within this range are also applicable. The preferred concentration is 0.01 to 10 μM, and the more preferred concentration is 0.1 to 1.0 μM.

[0021] Furthermore, the system includes: linear single-stranded DNA at a concentration of 0.01–10 μM, and T4 DNA ligase at a concentration of 0.10 U / μL–2.0 U / μL (one unit of enzyme is defined as: catalyzing 1 nmol of […] within 20 minutes at 37°C). 32 The amount of enzyme required to convert PPi to the adsorbable Norit form, 0.05–0.2 × T4 DNA ligase buffer.

[0022] Further, linear single-stranded DNA at a concentration of 0.1–1.0 μM, T4 DNA ligase at a concentration of 0.25 U / μL–0.50 U / μL, and 0.1 × T4 DNA ligase buffer.

[0023] This invention also protects circular single-stranded DNA molecules prepared according to the above preparation method, wherein the circular DNA molecules are obtained by connecting the first and last ends of the linear single-stranded DNA molecules through phosphodiester bonds.

[0024] This invention further protects the use of circular single-stranded DNA prepared according to the above preparation method in the construction of DNA nanomaterials, preparation of DNA rolling circle amplification templates, food traceability, or nucleic acid topology research.

[0025] The beneficial effects of this invention are:

[0026] (1) The method for preparing circular single-stranded DNA provided by the present invention includes ligation with a ligase to close both ends of linear single-stranded DNA with dynamic nicks, thereby obtaining circular single-stranded DNA. The method utilizes the self-forming dynamic nicks of the linear single-stranded DNA to achieve self-circularization of the linear single-stranded DNA molecule, minimizing the generation of intermolecular byproducts and avoiding any impact on subsequent applications. Using this self-forming dynamic nick ligation method, the single-strand circularization rate of linear single-stranded DNA in a conventional system can reach 100% under ligase ligation. Furthermore, this method does not require the addition of additional nucleic acid sequences or circularization auxiliary strands, thus not affecting the application of circular single-stranded DNA and expanding its application range.

[0027] (2) This invention uses this design of the precursor sequence to achieve splint-free ligation of linear single-stranded DNA under the action of ligase. The single-stranded circularization rate in the conventional system can reach nearly 100%. Furthermore, this circularization method is applicable to single-stranded circularization of various lengths, with high ligation efficiency and strong versatility.

[0028] In addition, this method is simple to operate, takes little time, and can be performed without specialized experimental personnel. It not only saves manpower and time costs, but also has the advantage of wide applicability. Attached Figure Description

[0029] Figure 1 This is a schematic diagram of the use of dynamic nick self-circularization of linear single-stranded DNA provided by the present invention.

[0030] Figure 2 A schematic diagram and results of the preparation of a 16nt circular single-stranded DNA provided by this invention;

[0031] Figure 3 A schematic diagram and results of the preparation of 18nt circular single-stranded DNA provided by the present invention;

[0032] Figure 4 A schematic diagram and results of the preparation of a 22nt circular single-stranded DNA provided by this invention;

[0033] Figure 5 A schematic diagram and results of the preparation of a 23nt circular single-stranded DNA provided by this invention;

[0034] Figure 6 A schematic diagram and results of the preparation of a 30nt circular single-stranded DNA provided by this invention;

[0035] Figure 7 A schematic diagram and results of the preparation of a 44nt circular single-stranded DNA provided by this invention;

[0036] Figure 8A schematic diagram and results of the preparation of a 50nt circular single-stranded DNA provided by this invention;

[0037] Figure 9 A schematic diagram and results of the preparation of a 62nt circular single-stranded DNA provided by this invention;

[0038] Figure 10 A schematic diagram and results of the preparation of 81nt circular single-stranded DNA provided by the present invention;

[0039] Figure 11 A schematic diagram and results of the preparation of a 210 nt circular single-stranded DNA provided by this invention;

[0040] Figure 12 A schematic diagram and results of the preparation of 899nt circular single-stranded DNA provided by this invention. Detailed Implementation

[0041] To further understand the present invention, the technical solution of the present invention will be clearly and completely described below with reference to the accompanying drawings and embodiments. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of them. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0042] Unless otherwise specified, the experimental methods in the following embodiments are conventional methods.

[0043] Unless otherwise specified, the medicines and reagents used in the embodiments of this invention are all purchased from legitimate channels.

[0044] Linear single-stranded DNA was purchased from Sangon Biotech (Shanghai) Co., Ltd., and was artificially synthesized; T4 DNA ligase was purchased from Thermo Scientific, USA; one unit of T4 DNA ligase is defined as: catalyzing 1 nmol of […] within 20 minutes at 37°C. 32 The amount of enzyme required to convert PPi to the adsorbable Norit form. Ultra GelRed nucleic acid dye was purchased from Qingdao Sangon Biotech Co., Ltd.; other reagents, such as acrylamide, N,N-methylenebisacrylamide, ammonium persulfate (APS), and tetramethylethylenediamine (TEMED), were all domestically produced analytical grade reagents.

[0045] like Figure 1 The diagram shown is a schematic of dynamic Nick self-circularization of linear single-stranded DNA. First, the desired circular single-stranded DNA was simulated using Mfold simulation software under the following conditions: 25℃, [Mg...] 2+] = 10mM, simulation results are as follows Figure 1 As shown, the secondary structure of circular single-stranded DNA contains a continuous complementary region of 5–18 bp, and the single-stranded DNA sequence outside the complementary region is 6–890 nt in length and may contain secondary structures.

[0046] Then, the nick position was designed based on the simulation results. The nick was designed in the middle region of the continuous complementary region; at the nick structure, the continuous complementary base pairs starting from the 3′ end of the linear precursor single-stranded DNA are 3 to 9 bp, that is, part a is 3 to 9 bp, and the continuous complementary base pairs starting from the 5′ end of the linear precursor single-stranded DNA are 2 to 9 bp, that is, part b is 2 to 9 bp.

[0047] Finally, T4 DNA ligase was used to ligate the dynamic nick, achieving self-circularization and obtaining circular single-stranded DNA.

[0048] Example 1

[0049] (1) A linear precursor single-stranded DNA 1 was designed and obtained.

[0050] First, the secondary structure of the target circular single-stranded DNA was simulated using Mfold, such as... Figure 2 A, Simulation conditions: 25℃, 10mM Mg 2+ Design the nick position at Figure 2 At position B, linear precursor single-stranded DNA 1 was obtained.

[0051] Linear precursor single-stranded DNA 1 (5′→3′, L 16 ):

[0052] CGTTTCGATCGAAGAT (5′-phosphorylated, 16nt in length, SEQ ID NO: 1); Source: Artificially synthesized (Sangon Biotech (Shanghai) Co., Ltd.).

[0053] (2) Linear precursor single-stranded DNA 1 utilizes its own secondary structure to form a dynamic nick, which is then circularized under the action of ligase.

[0054] (2.1) Connect into a ring

[0055] Linear precursor single-stranded DNA 1, ligase, and ligase buffer were mixed in a system with a concentration of 1 μM linear single-stranded DNA 1, 0.25 U / μL T4 DNA ligase, and a total volume of 10 μL 0.1×T4 DNA ligase buffer; ligation was carried out at 25°C for 12 hours.

[0056] (2.2) Enzyme digestion confirmation

[0057] Take a portion of the ligated system and add exonuclease I and exonuclease III to remove single strands. Enzyme digestion system: 5 μL ligation system, 0.5×Exonuclease I exonuclease buffer, 0.5×Exonuclease III exonuclease buffer, 1 U / μL Exonuclease I, 1.5 U / μL Exonuclease III. Digest at 37℃ for 2 hours, total volume 10 μL.

[0058] (2.3) Electrophoresis detection

[0059] cyclization results as follows Figure 2 As shown in C, Figure 2 The reaction system and conditions for circularization in C were as follows: [linear single-stranded DNA 1] = 1 μM, 0.25 U / μL T4 DNA ligase, 0.1×T4 DNA ligase buffer, 25℃, incubation for 12 hours. The electrophoresis conditions were: 12% polyacrylamide gel, 300V, electrophoresis for 2-3 hours.

[0060] Lane 1 is a linear L 16 Substrate chain; Lane 2 is the band after ligation with 0.1×T4 DNA ligase buffer and T4 DNA ligase; Lane 3 is the band of the product from Lane 2 after digestion with Exo I and Exo III exonucleases.

[0061] The results showed that 16nt linear single-stranded DNA circularization could be achieved using dynamic nick, with a yield of 12.82% for circular single-stranded DNA.

[0062] Example 2

[0063] (1) Design and obtain linear precursor single-stranded DNA2

[0064] First, the secondary structure of the target circular single-stranded DNA was simulated using Mfold, such as... Figure 3 A, Simulation conditions: 25℃, 10mM Mg 2+ Design the nick position at Figure 3 At position B, linear precursor single-stranded DNA2 was obtained.

[0065] Linear precursor single-stranded DNA2 (5′→3′, L) 18 ):

[0066] CGTTCATCGATCGAAGAT (5′-phosphorylated, 18nt in length, SEQ ID NO: 2); Source: Artificially synthesized (Sangon Biotech (Shanghai) Co., Ltd.).

[0067] (2) Linear single-stranded DNA2 can form dynamic nicks using its stem-loop structure, and achieve circularization under the action of ligase.

[0068] (2.1) Connect into a ring

[0069] Linear single-stranded DNA2, ligase, and ligation buffer were mixed in a system with a concentration of 1 μM linear single-stranded DNA2, 0.25 U / μL T4 DNA ligase, and a total volume of 10 μL 0.1×T4 DNA ligase buffer; the mixture was incubated at 25°C for 12 hours.

[0070] (2.2) Enzyme digestion confirmation

[0071] Take a portion of the ligated system and add exonuclease I and exonuclease III to remove single strands. Enzyme digestion system: 5 μL ligation system, 0.5×Exonuclease I exonuclease buffer, 0.5×Exonuclease III exonuclease buffer, 1 U / μL Exonuclease I, 1.5 U / μL Exonuclease III. Digest at 37℃ for 2 hours, total volume 10 μL.

[0072] (2.3) Electrophoresis detection

[0073] cyclization results as follows Figure 3 As shown in C, Figure 3 The reaction system and conditions for circularization in C were as follows: [linear single-stranded DNA2] = 1 μM, 0.25 U / μL T4 DNA ligase, 0.1×T4 DNA ligase buffer, 25℃, 12 hours. The electrophoresis conditions were: 12% polyacrylamide gel, 300V, electrophoresis for 2-3 hours.

[0074] Lane 1 is a linear L 18 Substrate chain; Lane 2 is the band after reaction with 0.1×T4 DNA ligase buffer and T4 DNA ligase; Lane 3 is the band of the product after digestion with Exo I and Exo III exonucleases of the circularized product in Lane 2.

[0075] The results showed that dynamic nick can be used to achieve circularization of 18nt linear single-stranded DNA, with a yield of 60.98% for circular single-stranded DNA.

[0076] Example 3

[0077] (1) Design and obtain linear precursor single-stranded DNA 3

[0078] First, the secondary structure of the target circular single-stranded DNA was simulated using Mfold, such as... Figure 4A, Simulation conditions: 25℃, 10mM Mg 2+ Design the nick position at Figure 4 At position B, linear precursor single-stranded DNA 3 was obtained.

[0079] Linear precursor single-stranded DNA 3 (5′→3′, L 22 ):

[0080] GAGCTTCAGATCAGAGCCCTCT (5′-phosphorylated, 22nt in length, SEQ ID NO: 3);

[0081] Source: Artificial synthesis (Sangon Biotech (Shanghai) Co., Ltd.).

[0082] (2) Linear precursor single-stranded DNA 3 utilizes its own secondary structure to form a dynamic nick, which is then circularized under the action of ligase.

[0083] (2.1) Connect into a ring

[0084] Linear single-stranded DNA 3, ligase, and ligation buffer were mixed in a system with a concentration of 1 μM linear single-stranded DNA 3, 0.25 U / μL T4 DNA ligase, and a total volume of 10 μL 0.1×T4 DNA ligase buffer; the mixture was incubated at 25°C for 12 hours.

[0085] (2.2) Enzyme digestion confirmation

[0086] Take a portion of the ligated system and add exonuclease I and exonuclease III to remove single strands. Enzyme digestion system: 5 μL ligation system, 0.5×Exonuclease I exonuclease buffer, 0.5×Exonuclease III exonuclease buffer, 1 U / μL Exonuclease I, 1.5 U / μL Exonuclease III. Digest at 37℃ for 2 hours, total volume 10 μL.

[0087] (2.3) Electrophoresis detection

[0088] cyclization results as follows Figure 4 As shown in C, Figure 4 The reaction system and conditions for circularization in C were as follows: [linear single-stranded DNA 3] = 1 μM, 0.25 U / μL T4 DNA ligase, 0.1×T4 DNA ligase buffer, 25℃, 12 hours. The electrophoresis conditions were: 12% polyacrylamide gel, 300V, electrophoresis for 2-3 hours.

[0089] Lane 1 is a linear L 22Substrate chain; Lane 2 is the band after reaction with 0.1×T4 DNA ligase buffer and T4 DNA ligase; Lane 3 is the band of the product after digestion with Exo I and Exo III exonucleases of the circularized product in Lane 2.

[0090] The results showed that dynamic nick can be used to achieve circularization of 22nt linear single-stranded DNA with a 100% yield of circular single-stranded DNA.

[0091] Example 4

[0092] (1) Design to obtain linear precursor single-stranded DNA4

[0093] First, the secondary structure of the target circular single-stranded DNA was simulated using Mfold, such as... Figure 5 A, Simulation conditions: 25℃, 10mM Mg 2+ Design the nick position at Figure 5 At position B, linear precursor single-stranded DNA4 was obtained.

[0094] Linear precursor single-stranded DNA 4 (5′→3′, L 23 ):

[0095] CAGTCAACAGTCTGATAAGCTAT (5′-phosphorylated, 23nt in length, SEQ ID NO: 4);

[0096] Source: Artificial synthesis (Sangon Biotech (Shanghai) Co., Ltd.).

[0097] (2) Linear precursor single-stranded DNA4 can form dynamic nicks using its own secondary structure, and achieve circularization under the action of ligase.

[0098] (2.1) Connect into a ring

[0099] Linear single-stranded DNA4, ligase, and ligation buffer were mixed in a system with a concentration of 1 μM linear single-stranded DNA4, 0.25 U / μL T4 DNA ligase, and a total volume of 10 μL 0.1×T4 DNA ligase buffer; the mixture was incubated at 25°C for 12 hours.

[0100] (2.2) Enzyme digestion confirmation

[0101] Take a portion of the ligated system and add exonuclease I and exonuclease III to remove single strands. Enzyme digestion system: 5 μL ligation system, 0.5×Exonuclease I exonuclease buffer, 0.5×Exonuclease III exonuclease buffer, 1 U / μL Exonuclease I, 1.5 U / μL Exonuclease III. Digest at 37℃ for 2 hours, total volume 10 μL.

[0102] (2.3) Electrophoresis detection

[0103] cyclization results as follows Figure 5 As shown in C, Figure 5 The reaction system and conditions for circularization in C: [linear single-stranded DNA 4] = 1 μM, 0.25 U / μL T4 DNA ligase, 0.1×T4 DNA ligase buffer, 25℃, 12 hours. The electrophoresis conditions were: 12% polyacrylamide gel, 300V, electrophoresis for 2-3 hours.

[0104] Lane 1 is a linear L 23 Substrate chain; Lane 2 is the band after reaction with 0.1×T4 DNA ligase buffer and T4 DNA ligase; Lane 3 is the band of the product after digestion with Exo I and Exo III exonucleases of the circularized product in Lane 2.

[0105] The results showed that dynamic nick could be used to achieve circularization of 23nt linear single-stranded DNA, and the yield of circular single-stranded DNA was 100%.

[0106] Example 5

[0107] (1) A linear precursor single-stranded DNA 5 was designed and obtained.

[0108] First, the secondary structure of the target circular single-stranded DNA was simulated using Mfold, such as... Figure 6 A, Simulation conditions: 25℃, 10mM Mg 2+ Design the nick position at Figure 6 At position B, 5 linear precursor single-stranded DNA molecules were obtained.

[0109] Linear single-stranded DNA 5 (5′→3′, L 30 ):

[0110] CACGTTCTTTAATAGTGGACCGTTGGAGTC (5′-phosphorylated, 30nt in length, SEQ ID NO: 5);

[0111] Source: Artificial synthesis (Sangon Biotech (Shanghai) Co., Ltd.).

[0112] (2) Linear precursor single-stranded DNA 5 utilizes its own secondary structure to form a dynamic nick, which is then circularized by ligase.

[0113] (2.1) Connect into a ring

[0114] Linear single-stranded DNA 5, ligase, and ligation buffer were mixed in a system with a concentration of 10 μM linear single-stranded DNA 5, 0.5 U / μL T4 DNA ligase (purchased from Thermo Scientific), and a total volume of 10 μL 0.1×T4 DNA ligase buffer; ligation was carried out at 25°C for 12 hours.

[0115] (2.2) Enzyme digestion confirmation

[0116] Take a portion of the ligated system and add exonuclease I and exonuclease III to remove single strands. Enzyme digestion system: 5 μL ligation system, 0.5×Exonuclease I exonuclease buffer, 0.5×Exonuclease III exonuclease buffer, 1 U / μL Exonuclease I, 1.5 U / μL Exonuclease III. Digest at 37℃ for 2 hours, total volume 10 μL.

[0117] (2.3) Electrophoresis detection

[0118] cyclization results as follows Figure 6 As shown in C, Figure 6 The reaction system and conditions for circularization in C [linear single-stranded DNA 5] were 10 μM, 0.5 U / μL T4 DNA ligase, 0.1 × T4 DNA ligase buffer, 25℃, 12 hours. The electrophoresis conditions were: 12% polyacrylamide gel, 300V, electrophoresis for 2-3 hours.

[0119] Lane 1 is a linear L 30 Substrate chain; Lane 2 is the band after reaction with 0.1×T4 DNA ligase buffer and T4 DNA ligase; Lane 3 is the band of the product after digestion with Exo I and Exo III exonucleases of the circularized product in Lane 2.

[0120] The results showed that dynamic nick could be used to achieve circularization of 30nt linear single-stranded DNA, and the yield of circular single-stranded DNA was 100%.

[0121] Example 6

[0122] (1) A linear precursor single-stranded DNA 6 was designed and obtained.

[0123] First, the secondary structure of the target circular single-stranded DNA was simulated using Mfold, such as... Figure 7 A, Simulation conditions: 25℃, 10mM Mg 2+ Design the nick position at Figure 7 At position B, 6 linear precursor single-stranded DNA molecules were obtained.

[0124] Linear single-stranded DNA 6 (5′→3′, L 44 ):

[0125] TCTGATAAGCTATCAACATCAGTCTGATAAGCTATCAACATCAG (5′-phosphorylated, 44nt in length, SEQ ID NO: 6);

[0126] Source: Artificial synthesis (Sangon Biotech (Shanghai) Co., Ltd.).

[0127] (2) Linear precursor single-stranded DNA 6 can form nick using its own secondary structure, and then achieve circularization under the action of ligase.

[0128] (2.1) Connect into a ring

[0129] Linear single-stranded DNA 6, ligase, and ligation buffer were mixed in a system with a concentration of 10 μM linear single-stranded DNA 6, 0.5 U / μL T4 DNA ligase, and a total volume of 10 μL 0.1×T4 DNA ligase buffer; the mixture was incubated at 25°C for 12 hours.

[0130] (2.2) Enzyme digestion confirmation

[0131] Take a portion of the ligated system and add exonuclease I and exonuclease III to remove single strands. Enzyme digestion system: 5 μL ligation system, 0.5×Exonuclease I exonuclease buffer, 0.5×Exonuclease III exonuclease buffer, 1 U / μL Exonuclease I, 1.5 U / μL Exonuclease III. Digest at 37℃ for 2 hours, total volume 10 μL.

[0132] (2.3) Electrophoresis detection

[0133] cyclization results as follows Figure 7 As shown in C, Figure 7The reaction system and conditions for circularization in C: [linear single-stranded DNA 6] = 10 μM, 0.5 U / μL T4 DNA ligase, 0.1 × T4 DNA ligase buffer, 25℃, 12 hours. The electrophoresis conditions were: 12% polyacrylamide gel, 300V, electrophoresis for 2-3 hours.

[0134] Lane 1 is a linear L 44 Substrate chain; Lane 2 is the band after T4 DNA ligase buffer and T4 DNA ligase; Lane 3 is the band of the product after Exo I and Exo III exonuclease digestion of the circularized product in Lane 2.

[0135] The results showed that 44nt linear single-stranded DNA circularization could be achieved using dynamic nick, with 100% yield of circular single-stranded DNA.

[0136] Example 7

[0137] (1) Designed to obtain linear precursor single-stranded DNA 7

[0138] First, the secondary structure of the target circular single-stranded DNA was simulated using Mfold, such as... Figure 8 A, Simulation conditions: 25℃, 10mM Mg 2+ Design the nick position at Figure 8 At position B, linear precursor single-stranded DNA7 was obtained.

[0139] Linear single-stranded DNA 7(5′→3′, L) 50 ):

[0140] CCCACAGCAGATGTGACTGTGAATCGTGACTCCCAATTGGGTACGCAGTA(5'-phosphorylated, 50nt in length, SEQ ID NO: 7);

[0141] Source: Artificial synthesis (Sangon Biotech (Shanghai) Co., Ltd.).

[0142] (2) The linear precursor single-stranded DNA7 uses its own secondary structure to form nick, which is then circularized by ligase.

[0143] (2.1) Connect into a ring

[0144] Linear single-stranded DNA 7, ligase, and ligation buffer were mixed in a system with a concentration of 10 μM linear single-stranded DNA 7, 0.5 U / μL T4 DNA ligase, and a total volume of 10 μL 0.1×T4 DNA ligase buffer; the mixture was incubated at 25°C for 12 hours.

[0145] (2.2) Enzyme digestion confirmation

[0146] Take a portion of the ligated system and add exonuclease I and exonuclease III to remove single strands. Enzyme digestion system: 5 μL ligation system, 0.5×Exonuclease I exonuclease buffer, 0.5×Exonuclease III exonuclease buffer, 1 U / μL Exonuclease I, 1.5 U / μL Exonuclease III. Digest at 37℃ for 2 hours, total volume 10 μL.

[0147] (2.3) Electrophoresis detection

[0148] cyclization results as follows Figure 8 As shown in C, Figure 8 The reaction system and conditions for circularization in C [linear single-stranded DNA 7] were 10 μM, 0.5 U / μL T4 DNA ligase, 0.1 × T4 DNA ligase buffer, 25℃, 12 hours. The electrophoresis conditions were: 12% polyacrylamide gel, 300V, electrophoresis for 2-3 hours.

[0149] Lane 1 is a linear L 50 Substrate chain; Lane 2 is the band after T4 DNA ligase buffer and T4 DNA ligase; Lane 3 is the band of the product after Exo I and Exo III exonuclease digestion of the circularized product in Lane 2.

[0150] The results showed that dynamic nick could be used to achieve circularization of 50 nt linear single-stranded DNA, with a 100% yield of circular single-stranded DNA.

[0151] Example 8

[0152] (1) A linear precursor single-stranded DNA 8 was designed and obtained.

[0153] First, the secondary structure of the target circular single-stranded DNA was simulated using Mfold, such as... Figure 9 A, Simulation conditions: 25℃, 10mM Mg 2+ Design the nick position at Figure 9 At position B, 8 linear precursor single-stranded DNA molecules were obtained.

[0154] Linear precursor single-stranded DNA 8 (5′→3′, L 62 ):

[0155] CTTTCAAAAAAAATAGTCGTGTCGTGAGCAGTGAAAAAATTGAAAGCTAACGAAAACGTTAG (5′-phosphorylated, 62nt in length, SEQ ID NO: 8);

[0156] Source: Artificial synthesis (Sangon Biotech (Shanghai) Co., Ltd.).

[0157] (2) Linear single-stranded DNA 8 uses its own secondary structure to form nick, which is then circularized by ligase.

[0158] (2.1) Connect into a ring

[0159] Linear single-stranded DNA 8, ligase, and ligation buffer were mixed in a system with a concentration of 10 μM linear single-stranded DNA 8, 0.5 U / μL T4 DNA ligase, and a total volume of 10 μL 0.1×T4 DNA ligase buffer; the mixture was incubated at 25°C for 12 hours.

[0160] (2.2) Enzyme digestion confirmation

[0161] Take a portion of the ligated system and add exonuclease I and exonuclease III to remove single strands. Enzyme digestion system: 5 μL ligation system, 0.5×Exonuclease I exonuclease buffer, 0.5×Exonuclease III exonuclease buffer, 1 U / μL Exonuclease I, 1.5 U Exonuclease III. Digest at 37℃ for 2 hours, total volume 10 μL.

[0162] (2.3) Electrophoresis detection

[0163] cyclization results as follows Figure 9 As shown in C, Figure 9 The reaction system and conditions for circularization in C [linear single-stranded DNA 8] were 10 μM, 0.5 U T4 DNA ligase, 0.1 × T4 DNA ligase buffer, 25 °C, 12 h. The electrophoresis conditions were: 12% polyacrylamide gel, 300 V, electrophoresis for 2-3 h.

[0164] Lane 1 is a linear L 62 Substrate chain; Lane 2 is the band after reaction with 0.1×T4 DNA ligase buffer and T4 DNA ligase; Lane 3 is the band of the product after digestion with Exo I and Exo III exonucleases of the circularized product in Lane 2.

[0165] The results showed that 62nt long linear single-stranded DNA could be circularized using dynamic nick, with a 100% yield of circular single-stranded DNA.

[0166] Example 9

[0167] (1) Designed to obtain linear precursor single-stranded DNA 9

[0168] First, the secondary structure of the target circular single-stranded DNA was simulated using Mfold, such as... Figure 10 A, Simulation conditions: 25℃, 10mM Mg 2+ Design the nick position at Figure 10 At position B, linear precursor single-stranded DNA9 was obtained.

[0169] Linear precursor single-stranded DNA 9 (5′→3′, L) 81 ):

[0170] GATGCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCACGTCTCACGAAGTGA (5′-phosphorylated, length 81nt, SEQ ID NO: 9);

[0171] Source: Artificial synthesis (Sangon Biotech (Shanghai) Co., Ltd.).

[0172] (2) Linear single-stranded DNA 8 uses its own secondary structure to form nick, which is then circularized by ligase.

[0173] (2.1) Connect into a ring

[0174] Linear single-stranded DNA9, ligase, and ligation buffer were mixed in a system with a concentration of 10 μM linear single-stranded DNA9, 0.5 U / μL T4 DNA ligase, and a total volume of 10 μL 0.1×T4 DNA ligase buffer; the mixture was incubated at 25°C for 12 hours.

[0175] (2.2) Enzyme digestion confirmation

[0176] Take a portion of the ligated system and add exonuclease I and exonuclease III to remove single strands. Enzyme digestion system: 5 μL ligation system, 0.5×Exonuclease I exonuclease buffer, 0.5×Exonuclease III exonuclease buffer, 1 U / μL Exonuclease I, 1.5 U Exonuclease III. Digest at 37℃ for 2 hours, total volume 10 μL.

[0177] (2.3) Electrophoresis detection

[0178] cyclization results as follows Figure 10 As shown in C, Figure 10The reaction system and conditions for circularization in C [linear single-stranded DNA9] were 10 μM, 0.5 U T4 DNA ligase, 0.1 × T4 DNA ligase buffer, 25℃, 12 hours. The electrophoresis conditions were: 12% polyacrylamide gel, 300 V, electrophoresis for 2-3 hours.

[0179] Lane 1 is a linear L 81 Substrate chain; Lane 2 is the band after reaction with 0.1×T4 DNA ligase buffer and T4 DNA ligase; Lane 3 is the band of the product after digestion with Exo I and Exo III exonucleases of the circularized product in Lane 2.

[0180] The results showed that dynamic nick can be used to circularize 81nt long linear single-stranded DNA, with a yield of 80.7% for circular single-stranded DNA.

[0181] Example 10

[0182] (1) A linear precursor single-stranded DNA 10 was designed and obtained.

[0183] First, the secondary structure of the target circular single-stranded DNA was simulated using Mfold, such as... Figure 11 A, Simulation conditions: 25℃, 10mM Mg 2+ Design the nick position at Figure 11 At position B, 10 linear precursor single-stranded DNA molecules were obtained.

[0184] Linear precursor single-stranded DNA 10 (5′→3′, L 210 ):

[0185] ACTCCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCCTGATGCGGTATTTTTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCA

[0186] (5′-phosphorylation, 210nt in length, SEQ ID NO: 10);

[0187] Source: Artificial synthesis (Sangon Biotech (Shanghai) Co., Ltd.).

[0188] (2) Linear single-stranded DNA 10 uses its own secondary structure to form nick, which is then circularized by ligase.

[0189] (2.1) Connect into a ring

[0190] Linear single-stranded DNA 10, ligase, and ligation buffer were mixed in a system containing 1 μM linear single-stranded DNA 9, 0.5 U / μL T4 DNA ligase, and 0.1×T4 DNA ligase buffer in a total volume of 10 μL; the mixture was incubated at 25°C for 12 hours.

[0191] (2.2) Enzyme digestion confirmation

[0192] Take a portion of the ligated system and add exonuclease I and exonuclease III to remove single strands. Enzyme digestion system: 5 μL ligation system, 0.5×Exonuclease I exonuclease buffer, 0.5×Exonuclease III exonuclease buffer, 1 U / μL Exonuclease I, 1.5 U Exonuclease III. Digest at 37℃ for 2 hours, total volume 10 μL.

[0193] (2.3) Electrophoresis detection

[0194] cyclization results as follows Figure 11 As shown in C, Figure 11 The reaction system and conditions for circularization in C [linear single-stranded DNA 10] were 1 μM, 0.5 U T4 DNA ligase, 0.1 × T4 DNA ligase buffer, 25℃, 12 hours. The electrophoresis conditions were: 12% polyacrylamide gel, 300V voltage, electrophoresis for 2-3 hours.

[0195] Lane 1 is a linear L 210 Substrate chain; Lane 2 is the band after reaction with 0.1×T4 DNA ligase buffer and T4 DNA ligase; Lane 3 is the band of the product after digestion with Exo I and Exo III exonucleases of the circularized product in Lane 2.

[0196] The results showed that dynamic nicks could be used to circularize 210 nt long linear single-stranded DNA, with a yield of 14.1% for circular single-stranded DNA.

[0197] Example 11

[0198] (1) A linear precursor single-stranded DNA 11 was designed and obtained.

[0199] First, the secondary structure of the target circular single-stranded DNA was simulated using Mfold, such as... Figure 12 A, Simulation conditions: 37℃, 1.5mM Mg 2+ Design the nick position at Figure 12 At position B, linear precursor single-stranded DNA 11 was obtained.

[0200] Linear precursor single-stranded DNA 11 (5′→3′, L 899 ):

[0201] TGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTC ACACCGCATATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATT

[0202] (899 nt in length, SEQ ID NO: 11);

[0203] Source: Obtained by secondary amplification aPCR (asymmetric PCR) of the primary amplification product (899bp) in plasmid PUC18.

[0204] (2) aPCR process: 50 μL reaction system (899 bp): 1 μL of the first amplification product 899 bp, [Primer F] = 0.2 μM (TGTTTATTTTTCTAAATACATTCA), [Abclonal PCR Mix] = 1×. Pre-denaturation at 98℃ for 1 min; denaturation at 98℃ for 15 s, annealing at 50℃ for 30 s, extension at 72℃ for 30 s, repeating the denaturation, annealing, and extension cycles 30 times; final extension at 72℃ for 5 min.

[0205] (3) Linear precursor single-stranded DNA 11 uses its own secondary structure to form nick, which is then circularized by ligase.

[0206] (3.1) Connect into a ring

[0207] Linear single-stranded DNA 11, ligase, and ligation buffer were mixed in a system containing 25 nM (estimated concentration) of linear single-stranded DNA 11, 0.25 U / μL T4 DNA ligase, and 0.1×T4 DNA ligase buffer in a total volume of 10 μL; the mixture was incubated at 37°C for 12 hours.

[0208] (3.2) Enzyme digestion confirmation

[0209] Take a portion of the ligated system and add exonuclease I and exonuclease III to remove single strands. Enzyme digestion system: 7 μL ligation system, 0.5×Exonuclease I exonuclease buffer, 0.5×Exonuclease III exonuclease buffer, 1 U / μL Exonuclease I, 2.5 U Exonuclease III. Digest at 37℃ for 2 hours, total volume 10 μL.

[0210] (3.3) Electrophoresis detection

[0211] cyclization results as follows Figure 12 As shown in C, Figure 12 The reaction system and conditions for circularization in C [linear single-stranded DNA 11] were 25 nM, 0.25 U T4 DNA ligase, 0.1 × T4 DNA ligase buffer, 37℃, 12 hours. The electrophoresis conditions were: 6% denaturing polyacrylamide gel, 300 V, electrophoresis for 6-8 hours.

[0212] Lane 1 is a linear L 899Substrate chain; Lane 2 is the band after reaction with 0.1×T4 DNA ligase buffer and T4 DNA ligase; Lane 3 is the band of the product after digestion with Exo I and Exo III exonucleases of the circularized product in Lane 2.

[0213] The results showed that dynamic nicks could be used to circularize 899 nt long linear single-stranded DNA, with a yield of 46.3% for circular single-stranded DNA.

[0214] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, alterations, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A method for preparing a circular single-stranded DNA, characterized by, Includes the following steps: Secondary structure simulation was performed on the desired circular single-stranded DNA. The nick was designed near the middle of a continuous complementary region, with the continuous complementary region being 5-18 bp. The designed linear precursor single-stranded DNA formed a dynamic nick structure through intramolecular hybridization to instantly shorten the distance between the 3' and 5' ends. At the nick structure, the continuous complementary base pairs from the 3' end of the linear precursor single-stranded DNA were 3-9 bp, and the continuous complementary base pairs from the 5' end of the linear precursor single-stranded DNA were 2-9 bp. Then, T4 DNA ligase was used to ligate the dynamic nick, thereby achieving circularization and obtaining the circular single-stranded DNA.

2. The production method according to claim 1, characterized by, The secondary structure of circular single-stranded DNA contains a continuous complementary region of 5–18 bp, and the length of the single-stranded DNA sequence outside the complementary region is 6–890 nt.

3. The preparation method according to any one of claims 1 or 2, characterized in that, The connection of a dynamic nick includes the following steps: Linear single-stranded DNA, ligase, and ligase buffer were mixed into a single ligation system, and the ligation reaction was carried out at 16℃~37℃ for 0.5~72 h. The linear single-stranded DNA has a length of 16–900 nt and a concentration of ≤100 μM; the ligase is T4 DNA ligase, and the buffer for the ligase reaction is 0.02–2.0 × T4 DNA ligase buffer.

4. The preparation method according to claim 3, characterized in that, The linear single-stranded DNA has a length of 16~300 nt.

5. The preparation method according to claim 3, characterized in that, The linear single-stranded DNA has a length of 30~100 nt.

6. The preparation method according to claim 3, characterized in that, The system includes: linear single-stranded DNA at a concentration of 0.01–10 μM, T4 DNA ligase at a concentration of 0.10 U / μL–2.0 U / μL, and 0.05–0.2×T4 DNA ligase buffer.

7. The preparation method according to claim 6, characterized in that, The system includes: linear single-stranded DNA at a concentration of 0.1–1.0 μM, T4 DNA ligase at a concentration of 0.25 U / μL–0.50 U / μL, and 0.1×T4 DNA ligase buffer.

Images