Molecular markers closely linked to a qtl for resistance to wheat foot rot and uses thereof

Abstract

The present application relates to the field of agricultural molecular detection, and particularly relates to a molecular marker closely linked to a wheat stem base rot resistance QTL and application thereof. The present application uses two specific SNP sites (AX-110429468, AX-110521277) first discovered for identification, can quickly screen wheat stem base rot resistance seedling and adult plant resistance lines, helps to improve the selection efficiency and save the experimental cost. The two specific SNP sites have a strong linkage relationship, can be independently used for wheat stem base rot resistance identification, have high specificity and accuracy, and the identification result is stable and reliable. Population verification experiments show that different genotyping of AX-110429468 and AX-110521277 two specific SNP sites has significant difference in the resistance performance of seedling and adult plant of stem base rot.

Description

Technical Field

[0001] This invention relates to the field of agricultural molecular detection, and in particular to a molecular marker closely linked to a QTL for resistance to wheat stem base rot and its application. Background Technology

[0002] Wheat stem rot is a soil-borne disease caused by Fusarium spp. Due to its characteristics such as strong saprophytic properties of the pathogen, wide range of hosts, main disease site at the stem base, and the ability to cause disease throughout the entire growth period, it has seriously threatened the safe production of wheat in my country in recent years.

[0003] Planting disease-resistant varieties is one of the most effective measures to control the occurrence and damage of stem base rot. However, to date, no varieties with complete resistance or immunity to Fusarium have been found, nor have any breeding materials showing high resistance to the disease been discovered. Only a small number of QTLs showing moderate resistance are available for use, and reports on resistance loci at the adult stage and KASP markers are extremely rare.

[0004] In view of this, the present invention is hereby proposed. Summary of the Invention

[0005] The purpose of this invention is to provide a molecular marker closely linked to QTLs for resistance to wheat stem base rot and its application, and to identify wheat stem base rot resistance at the seedling and adult stages based on SNP molecular marker detection.

[0006] Specifically, the technical solution of the present invention is as follows:

[0007] In a first aspect, the present invention provides a method for identifying resistance to wheat stem base rot, using specific SNP sites for identification, including AX-110429468 and / or AX-110521277;

[0008] The AX-110429468 is located at position 815380919 on chromosome 3BL;

[0009] The AX-110521277 is located at position 815473690 on chromosome 3BL.

[0010] In this invention, the aforementioned specific SNP sites are determined based on the wheat Chinese spring reference genome sequence information, the version number of which is IWGSC RefSeq v1.0.

[0011] The two specific SNP loci (AX-110429468 and AX-110521277) provided by this invention have a strong linkage relationship and can be used independently for the identification of wheat stem rot resistance. Identification of wheat stem rot resistance based on either AX-110429468 or AX-110521277, or based on a combination of both SNP loci, has high specificity and accuracy, and the identification results are stable and reliable. Population validation experiments show that different genotypes of the two specific SNP loci, AX-110429468 and AX-110521277, exhibit significant differences in stem rot resistance.

[0012] The two specific SNP loci provided by this invention exhibit homozygous genotypes in wheat stem rot resistant plants. Specifically,

[0013] The resistant individuals have the genotype AA in AX-110429468;

[0014] The susceptible individuals have the genotype GG in AX-110429468;

[0015] The resistant individuals have the TT genotype in AX-110521277;

[0016] The genotype of susceptible individuals in AX-110521277 is CC.

[0017] When identifying resistant plants, this invention preferably uses the specific genotypes mentioned above to identify resistance to wheat stem rot, which can omit basic sequencing of the corresponding region on chromosome 3BL and polymorphism analysis of SNP sites, thus simplifying the identification process.

[0018] The two specific SNP loci provided in this invention are essentially fixed in wheat stem rot-resistant plants, both being homozygous genotypes, and are reported for the first time. Identifying wheat stem rot-resistant plants using these two specific SNP loci is beneficial for screening resistant materials against wheat stem rot (especially against the most widely distributed and pathogenic 'WZ2-8A' Fusarium pseudobulb). This provides an important theoretical basis and technical support for the discovery of wheat stem rot resistance genes and the breeding of new varieties.

[0019] In addition, the detection method provided by this invention is simple to operate, highly efficient, and produces accurate and reliable detection results, making it suitable for widespread application.

[0020] Secondly, the present invention provides a specific SNP molecular marker combination for identifying resistance to wheat stem base rot at the seedling and adult stages, including AX-110429468 and AX-110521277.

[0021] The two SNP loci mentioned above can not only be used to identify resistance to wheat stem rot at the seedling and adult stages, but also to quickly screen for disease resistance-related genes near the marker. This can eliminate the need to obtain populations in the process of wheat disease resistance breeding, thus saving experimental costs, shortening the practical process, and accelerating the process of wheat disease resistance breeding.

[0022] Thirdly, the present invention provides a specific detection primer composition for identifying resistance to wheat basal rot, the specific detection primer composition being used to detect AX-110429468 and / or AX-110521277.

[0023] Preferably, the specific detection primer composition for AX-110429468 includes 1F, 1H, and 1R; the specific detection primer composition for AX-110521277 includes 2F, 2H, and 2R; the nucleotide sequences of 1F, 1H, 1R, 2F, 1H, and 2R are as shown in SEQ ID NO: 1-6, respectively. See Table 1 for details.

[0024] Table 1 Sequences of primers for specific detection

[0025] 1 1F gtggttaatggcgtgaaatctagtt(SEQ ID NO: 1) 2 1H gtggttaatggcgtgaaatctagtc(SEQ ID NO: 2) 3 1R ccgctccaaaagtttcaatggt(SEQ ID NO: 3) 4 2F atctGgttttgcatccgaca(SEQ ID NO: 4) 5 2H atctGgttttgcatccgacg(SEQ ID NO: 5) 6 2R tgacGgtgatgccacataaa(SEQ ID NO: 6)

[0026] Fourthly, the present invention provides detection reagents, kits, or chips containing the specific detection primer composition described above.

[0027] Preferably, the detection reagent, kit, or chip further includes genomic DNA extraction reagent, PCR reaction mix, and double-distilled water.

[0028] Fifthly, the present invention provides the application of the specific SNP molecular marker combination, the specific detection primer composition, the detection reagent, the kit, or the chip in the identification and screening of wheat stem rot resistant planting resources.

[0029] Preferably, the application includes the following steps:

[0030] S1. Extract genomic DNA from wheat to be tested;

[0031] S2. Add the specific detection primer composition to the DNA template extracted in step S1 for PCR amplification;

[0032] S3. Detect PCR amplification products.

[0033] Further preferred embodiments are shown in Tables 2, 3, and 4, regarding the primer configuration, reaction system, and procedure for PCR amplification in step S2:

[0034] Table 2 Primer preparation methods for the genotyping system

[0035] FAM 12 12 HEX 12 12 COMMON 30 30 PCR grade water - 46 Total - 100

[0036] Table 3. Reaction system used for PCR amplification

[0037] HiGeno 2x Probe Mix 2.5 SNP-Specific Primers 0.07 DNA sample X* concentration = 4-50ng Sterile water 2.5-x Total 5

[0038] Note: SNP-Specific Primers are not included in the reaction volume.

[0039] Table 4 PCR reaction procedures

[0040]

[0041]

[0042] Further preferably, step S3 includes: detecting the SNP molecular markers AX-110429468 and AX-110521277 in the PCR amplification product; when the genotypes corresponding to AX-110429468 and AX-110521277 are AA and TT respectively, the wheat to be tested is determined to be a stem rot resistant material.

[0043] In this invention, the wheat stem rot is caused by Fusarium, with the dominant species being *Fusarium graminearum*. The resistance described in this invention is primarily targeted at the most widely distributed and most pathogenic species, 'WZ2-8A' (*Fusarium graminearum*).

[0044] Beneficial effects:

[0045] This invention provides a molecular marker tightly linked to QTLs for wheat stem rot resistance and its application. This invention utilizes two newly discovered specific SNP loci (AX-110429468 and AX-110521277) for identification, enabling rapid screening of resistant wheat stem rot lines at both the seedling and mature stages, thus improving selection efficiency and saving experimental costs. The two specific SNP loci have a strong linkage relationship and can be used independently for wheat stem rot resistance identification. Identification of wheat stem rot resistance based on either AX-110429468 or AX-110521277, or based on a combination of both SNP loci, exhibits high specificity and accuracy, and the identification results are stable and reliable. Population validation experiments showed that different genotypes of the two specific SNP loci, AX-110429468 and AX-110521277, exhibited significant differences in resistance to stem rot. Detailed Implementation

[0046] This invention provides a molecular marker tightly linked to QTLs for wheat stem rot resistance and its application. It describes a method for identifying wheat stem rot resistance based on SNP molecular marker detection, using specific SNP sites for identification, which can effectively screen for resistant materials at both the seedling and adult stages of wheat stem rot. This invention utilizes a 660k SNP chip developed by the Wheat Genetic Resources Team of the Institute of Crop Science, Chinese Academy of Agricultural Sciences, to conduct a genome-wide association study on stem rot resistance at the seedling and adult stages of 303 Chinese wheat varieties.

[0047] Seedling resistance was assessed using a spore concentration of 1×10⁻⁶. 6 Soak germinating seeds (0.5-1 cm in diameter) in a spore suspension of 'WZ2-8A' (spores / mL) for 1 minute, then transplant them into seedling trays overnight. When the infected control 'Shaanxi 253' was almost dead (about 42 days after transplanting), the disease severity of the wheat stem base was assessed according to Table 5.

[0048] Table 5 Grading and Evaluation Standards for Wheat Stem Base Rot Resistance

[0049]

[0050] Field resistance identification was conducted as follows: 303 samples were planted in October 2021 and October 2022 at the Dishan Experimental Station of the Grain and Oil Crops Research Institute, Hebei Academy of Agricultural and Forestry Sciences. 100 g / m² of inoculum of the pathogen 'WZ2-8A', propagated on wheat grain medium, was evenly spread on the soil surface and mixed thoroughly. Different wheat varieties were then planted in furrows using a furrow opener. Two rows were planted per treatment, with 100 grains per row at 1.5 m spacing and a row spacing of 20 cm. Standard field management was implemented. According to Table 1, five single stems from each treatment were collected at the wheat waxy maturity stage for investigation. The survey dates were marked as 21R (2021) and 22R (2022).

[0051] Association analysis of wheat stem base rot resistance: Phenotypic data and 660k SNP filtered data were analyzed together using the GAPIT language package in R program. It was found that two SNPs (AX-110429468 and AX-110521277) located in the 0.9mb region of chromosome 3BL were significantly associated with wheat stem base rot resistance at both the seedling and mature stages (P<0.001), with an effect value of 8%. They can be divided into two types: susceptible haplotype HAP1: G&C; and resistant haplotype HAP2: A&T.

[0052] KASP markers were designed for SNPs (AX-110429468 and AX-110521277) for genotyping of the test materials. When the genotypes corresponding to AX-110429468 and AX-110521277 are AA and TT respectively, the test wheat is determined to be a stem rot resistant material.

[0053] The following examples are provided to illustrate the present invention, but not to limit the scope thereof. Any modifications or substitutions made to the methods, steps or conditions of the present invention without departing from the spirit and essence of the present invention shall fall within the protection scope of the present invention. Unless otherwise specified, the experimental materials, reagents, instruments and the like used in the examples of the present invention are all commercially available; unless otherwise specified, all technical means in the examples of the present invention are conventional means well known to those skilled in the art.

[0054] Example 1 Significant resistance performance of resistant wheat genotype materials in the original population

[0055] The original 303 population was used to verify AX-110429468 and AX-110521277. Haplotype analysis was performed based on the 2 SNPs. Except for 2 materials with uncertain allele types at one or more of the 2 SNPs during genotyping, the remaining 301 materials were divided into 2 haplotypes according to their genotypes at the 2 SNPs. Among them, Hap1 (G&C) showed high average disease indices of 44.3 and 49.2 at the seedling stage and adult plant stage respectively, indicating susceptible reactions, and there were a total of 213 materials; Hap2 (A&T) contained 88 materials, with low average disease indices of 39.6 and 35.6 at the seedling stage and adult plant stage respectively, which was more resistant than Hap1, as shown in Table 6.

[0056] Table 6 Observed haplotypes and resistance performance of the 2 SNPs in the population

[0057] HAP1 G:G C:C 213 44.3a* 49.2a* HAP 2 A:A T:T 88 39.6b 35.6b

[0058] Note: * Lowercase letters a and b indicate significant difference at the 0.05 level.

[0059] Example 2 The test sample with the detected genotype of A&T shows significant resistance.

[0060] Specifically, in this experimental example, AX-110429468 and AX-110521277 are used to identify the wheat varieties to be tested. The steps are as follows:

[0061] Three test samples were taken, including '04 Zhong 36', 'Liangxing 518' and 'Jinxiu 21'.

[0062] SNP genotyping was performed using the primers involved in the present invention, and the results showed that 'Liangxing 518' and 'Jinxiu 21' were of Hap1 type (G&C), and '04 Zhong 36' was of Hap2 type (A&T).

[0063] Phenotypic detection and verification indeed found that: '04 Zhong 36' showed moderate resistance; 'Liangxing 518' and 'Jinxiu 21' showed high susceptibility.

[0064] Example 3 The F2 progeny of '04 Zhong 36' and 'Liangxing 518' were tested, and it was found that individuals with the A&T genotype exhibited overall disease resistance.

[0065] Specifically, in this experimental example, AX-110429468 and AX-110521277 were used to identify the wheat varieties to be tested. The steps are as follows:

[0066] 147 test samples were taken, including the F2 progeny of '04 Zhong 36' and 'Liangxing 518'.

[0067] SNP genotyping was performed using the primers and kit involved in the present invention. The results showed that the two SNPs co-segregated in the F2 population with a segregation ratio of 1:2:1, indicating a strong linkage relationship between the two SNPs. Among the 147 F2 individuals, 38 plants in the first group were homozygous for the 'Liangxing 518' allele (Hap1 type G&C), 38 plants in the second group were homozygous for the '04 Zhong 36' allele (Hap2 type A&T); the remaining 71 plants carried alleles from both parents and were classified into the third group.

[0068] Phenotypic detection and verification indeed confirmed that the average disease indices of the first group of materials (G&C) at the seedling stage and adult plant stage were 49.35 and 45.86 respectively, which were significantly higher than 36.08 and 37.12 of the second group (A&T), and the second group showed better resistance than the first group. The details are shown in Table 7.

[0069] Table 7 Genotyping and resistance performance of the 3BL disease resistance locus in the F2 population of '04 Zhong 36' and 'Liangxing 518'

[0070] Group 1 G:G C:C 38 49.35a 45.86a Group 2 A:A T:T 38 36.08b 37.12b Group 3 G:A C:T 71 -

[0071] Example 4 The F2 progeny of '04 Zhong 36' and 'Jinxiu 21' were tested, and it was found that individuals with the A&T genotype exhibited overall disease resistance.

[0072] Specifically, in this experimental example, AX-110429468 and AX-110521277 were used to identify the wheat varieties to be tested. The steps are as follows:

[0073] 128 test samples were taken, including the F2 progeny of '04 Zhong 36' and 'Jinxiu 21'.

[0074] SNP genotyping was performed using the primers involved in the present invention. The results showed that the two SNPs co-segregated in the F2 population with a segregation ratio of 1:2:1, indicating a strong linkage relationship between the two SNPs. Among the 128 F2 individuals, 32 plants in the first group were homozygous for the 'Jinxiu 21' allele (Hap1 type), 32 plants in the second group were homozygous for the '04 Zhong 36' allele (Hap2 type A&T); the remaining 64 plants carried alleles from both parents and were classified into the third group.

[0075] Phenotypic testing confirmed that the average disease index of Group 1 (G&C) at the seedling and adult stages was 49.35 and 45.86, respectively, significantly higher than that of Group 2 (36.08 and 37.12). Group 2 exhibited better resistance than Group 1. See Table 8 for details.

[0076] Table 8. 3BL disease resistance locus genotyping and resistance expression in the '04' 36' and 'Jinxiu 21' F2 populations.

[0077] Group 1 G:G C:C 32 50.35a 51.25a Group 2 A:A T:T 32 35.08b 39.68b Group 3 G:A C:T 64 - -

[0078] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention are within the scope of protection claimed by the present invention.

Claims

1. A method for identifying resistance to wheat stem base rot, characterized in that, The SNP sites were identified using a specific detection primer composition, and the specific sites were AX-110429468 and AX-110521277. The specific detection primer composition for AX-110429468 includes 1F, 1H, and 1R; The specific detection primer composition for AX-110521277 includes 2F, 2H, and 2R; The nucleotide sequences of 1F, 1H, 1R, 2F, 2H, and 2R are shown in SEQ ID NO: 1-6, respectively. The resistant individuals have the genotype AA in AX-110429468 and the genotype TT in AX-110521277; The susceptible individuals have the genotype GG in AX-110429468 and the genotype CC in AX-110521277. The AX-110429468 is located at position 815380919 on chromosome 3BL; The AX-110521277 is located at position 815473690 on chromosome 3BL; The version number of the reference genome sequence information is IWGSC RefSeq v1.

0.

2. A specific primer composition for identifying resistance to wheat stem base rot, characterized in that, The specific detection primer composition is used to detect AX-110429468 and AX-110521277; The specific detection primer composition for AX-110429468 includes 1F, 1H, and 1R; The specific detection primer composition for AX-110521277 includes 2F, 2H, and 2R; The nucleotide sequences of 1F, 1H, 1R, 2F, 2H, and 2R are shown in SEQ ID NO: 1-6.

3. A detection reagent, kit, or chip, characterized in that, The detection reagent, kit, or chip includes the specific detection primer composition of claim 2.

4. The application of the specific detection primer composition of claim 2, the detection reagent, kit, or chip of claim 3 in the identification and screening of wheat stem base rot resistant germplasm resources, characterized in that, When the genotypes corresponding to AX-110429468 and AX-110521277 are AA and TT respectively, the wheat to be tested is determined to be a stem rot resistant material.

5. The application according to claim 4, characterized in that, Includes the following steps: S1. Extract the genomic DNA of the wheat to be tested; S2. Add the specific detection primer composition to the DNA template extracted in step S1 for PCR amplification; S3. Detect PCR amplification products.

6. The application according to claim 4 or 5, characterized in that, The wheat stem rot is caused by Fusarium, with the dominant species being Fusarium pseudograecum (…). Fusarium pseudograminearum ).

Images