A pichia guilliermondii and application thereof in tomato acid soup reinforcing fermentation
Patent Information
- Application Number
- CN202311839396.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-12-27
- Publication Date
- 2026-08-18
- Estimated Expiration
- 2043-12-27
AI Technical Summary
[0004]但是,现有的番茄酸汤大都是自然发酵,主要是乳酸菌发酵,其酸汤在涩味、苦味以及涩味回味和苦味回味这类不愉快味觉指标方面较高,导致番茄酸汤的味道不是很理想
[0020] The present invention uses Pichia pastoris to ferment tomato sour soup, which significantly reduces unpleasant taste indicators such as astringency, bitterness, and astringent and bitter aftertastes in the sour soup.
Smart Images

Figure CN117778213B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a type of Pichia pastoris and its application in the enhanced fermentation of tomato sour soup, belonging to the field of yeast technology. Background Technology
[0002] Guizhou Miao Sour Soup, also known as Tomato Sour Soup, is a dish characterized by its sour, spicy, and bitter flavors. It is made primarily from tomatoes and chili peppers through fermentation. Miao Sour Soup is characterized by its sour, spicy, and savory aroma and unique flavor. It is widely praised for its pure sourness, fragrant aroma, refreshing taste, and high nutritional value, and it also has a cooling and heat-relieving effect. The finished red sour soup is primarily bright red in color, with a flavor that is not only fresh, fragrant, and sour, but also has a mellow and sweet-sour aftertaste. Red sour soup contains a large amount of organic acids, such as tartaric acid, malic acid, lactic acid, acetic acid, citric acid, and a small amount of succinic acid. It also contains lycopene, capsaicin, and other functional substances, which not only have antioxidant and immune-boosting effects, but may even have cancer-preventive properties. Compared to other vegetables, sour soup is higher in vitamin C and vitamin E, and also contains a large amount of natural antioxidants, giving it strong antioxidant and anti-aging properties. Therefore, sour soup is also known as the "longevity vegetable." It provides abundant vitamins and minerals, including rich amounts of vitamin C and vitamin E, which are powerful antioxidants that can eliminate free radicals, resist aging, and enhance the body's immune function. Sour soup also has the effect of invigorating the spleen and stomach, and increasing appetite. The abundant organic acids and citric acid in sour soup can stimulate the secretion of digestive juices from the salivary and gastric glands, thus increasing appetite. When the body's digestive juice secretion is insufficient, consuming sour soup can stimulate the secretion of digestive juices to increase appetite. Sour soup also has the effects of replenishing qi and blood, and eliminating fatigue. The abundant organic acids in sour soup have an acidity three times that of apples and twice that of oranges and bananas. These organic acids can promote gastric juice secretion, stimulate appetite, and eliminate fatigue. The rich organic acids and vitamin C not only invigorate the stomach and aid digestion, astringe and stop diarrhea, and relieve cough and phlegm, but also quench thirst, clear heat and reduce inflammation, and have a good effect on relieving pharyngitis.
[0003] Currently, there are many studies on the microbial fermentation of tomato sauerkraut. Using liquid culture medium, various lactic acid bacteria strains can be isolated from natural fermentation, including Streptococcus thermophilus, Lactobacillus casei, Bacillus subtilis, and Bacillus licheniformis.
[0004] However, most existing tomato sour soups are naturally fermented, mainly by lactic acid bacteria. Their sour soups have a higher level of unpleasant taste indicators such as astringency, bitterness, and unpleasant aftertaste, resulting in a less than ideal taste. Summary of the Invention
[0005] This invention provides a type of Pichia pastoris and its application in the enhanced fermentation of tomato sour soup, which can effectively solve the above problems.
[0006] This invention is implemented as follows:
[0007] A type of Pichia fermentan 4-1, with the accession number CDMCC NO.63699.
[0008] In some embodiments, the ITS sequence of the *Pichia pastoris* is shown in SEQ ID NO:1.
[0009] In some embodiments, the nitrate reduction test and urea hydrolysis test of the *Pichia pastoris* were both negative.
[0010] Application of the above-mentioned Pichia pastoris in reducing unpleasant taste indicators of tomato sour soup.
[0011] In some embodiments, the application of Pichia pastoris in reducing unpleasant taste indicators in tomato soup includes the following steps:
[0012] S1. Wash the tomatoes and peppers, dry them, crush them, add salt, glutinous rice flour, ginger, garlic, and white wine, mix well, and then bottle them.
[0013] S2, inoculate with the described Pichia pastoris and ferment at 28-32℃.
[0014] In some embodiments, the mass ratio of the tomato, chili pepper, salt, glutinous rice flour, ginger, garlic, and liquor is 45-55:5-10:1-3:0.20-0.50:1-5:1.
[0015] In some embodiments, the mass ratio of the tomato, chili pepper, salt, glutinous rice flour, ginger, garlic, and liquor is 48:8:2:0.40:3:1.
[0016] In some embodiments, the inoculation amount of Pichia pastoris is 1.5-2.5 wt%.
[0017] In some embodiments, the fermentation period is 4-6 days.
[0018] In some embodiments, the unpleasant taste index is one or more of astringency, bitterness, and astringent aftertaste and bitter aftertaste.
[0019] The beneficial effects of this invention are:
[0020] The present invention uses Pichia pastoris to ferment tomato sour soup, which significantly reduces unpleasant taste indicators such as astringency, bitterness, and astringent and bitter aftertastes in the sour soup. Attached Figure Description
[0021] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation of the scope. For those skilled in the art, other related drawings can be obtained from these drawings without creative effort.
[0022] Figure 1 This is a biological microscope image of the yeast isolated in Example 1. Wherein, Figure 1 A is strain Z1. Figure 1 B is strain Z4.
[0023] Figure 2 This is a phylogenetic tree of the strain isolated in Example 1.
[0024] Figure 3 This is a graph showing the pH changes during the fermentation process of the strain isolated in Example 2.
[0025] Figure 4 This is a graph showing the change in soluble solids content during the fermentation process of the strain isolated in Example 2.
[0026] Figure 5 This is a graph showing the changes in reducing sugars during the fermentation process of the strain isolated in Example 2.
[0027] Figure 6 Radar graph showing the difference in taste on the electronic tongue before and after fermentation for the strain isolated in Example 2.
[0028] Figure 7 The image shows the GC-IMS determination of flavor compounds in sour soup provided in Example 2.
[0029] Figure 8 The software provided in Example 2 automatically generates a three-dimensional spectrum (retention time, migration time, and peak intensity) and a two-dimensional top view (retention time and migration time) of the flavor substances in sour soup.
[0030] Figure 9 The software provided in Example 2 automatically generates a two-dimensional top view (retention time and migration time) of the sour soup flavor substances.
[0031] Figure 10 The flowchart for preparing yeast-fermented tomato sour soup is provided for the example. Detailed Implementation
[0032] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only a part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Therefore, the following detailed description of the embodiments of the present invention provided in the accompanying drawings is not intended to limit the scope of the claimed invention, but merely to represent selected embodiments of the invention. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0033] Example 1: Isolation, purification and identification of Pichia pastoris
[0034] Specific bacterial screening process:
[0035] 1. Isolation and Purification: Take 25 mL from each of the three sour soup samples (purchased from Guizhou Qianli Miaojiang Agricultural Development Co., Ltd.), place them in beakers containing physiological saline that have been autoclaved at 121℃ for 20 min, mix thoroughly to prepare a mixed solution, and dilute to different gradients. Take 200 μL of each dilution and spread it on Bengal red agar. Incubate at 30℃ for 48 h. Use an inoculation loop to pick single colonies of different morphologies and streak them on PDA solid agar until no contaminants are found in the isolated colonies. Isolate and select single colonies, perform streak purification four times on plates, number them, and store them on PDA solid agar (slant) in a -20℃ refrigerator with 30% glycerol.
[0036] 2. Physiological and biochemical identification: Physiological and biochemical identification tests were performed on the isolated yeast, including hydrogen sulfide test, nitrate reduction test, indole test, and urea hydrolysis test.
[0037] Hydrogen sulfide test: Inoculate the test strain into the culture medium and incubate at 30±1℃ for 2 days. Dip a filter paper strip in 10% lead acetate solution and place it 1 cm above the surface of the culture medium. Continue incubation for 3 days. If the filter paper strip turns black, it is a positive reaction; otherwise, it is a negative reaction. Observe and record the experimental results.
[0038] Indole test: Inoculate the test bacteria into peptone water medium and incubate at 30±1℃ for 2 days. Add 0.5mL of ether, shake well and let stand for 30min. Then add 0.5mL of Euler reagent and observe whether there is a color change between the ether and the liquid surface of the medium. If a red ring appears, it is positive; if there is no change, it is negative.
[0039] Nitrate reduction test: Inoculate the test bacteria into liquid culture medium containing nitrate and incubate at 30±1℃ for 3 days. Add one drop each of nitrate reduction reagent A and B. If the culture medium turns pink, it is nitrate positive. If it does not change, add 2 drops of diphenylamine reagent. If it turns blue, it is negative. Otherwise, it is positive.
[0040] Urea hydrolysis test: Inoculate the test bacteria into solid slant agar medium for decomposing urea and incubate at 28°C for 5-7 days. Use a blank control. If the agar medium turns red, the test is positive; otherwise, it is negative.
[0041] 3. Secondary screening:
[0042] Ester production test: Single colonies of the five selected strains were streaked onto the ester production medium and incubated at 28°C for 1–3 days. The more yellow the colonies, the stronger the ester production capacity of the corresponding strain. The formulation of the ester production medium was: 0.04 g / L bromocresol purple, 15 mL / L glyceryl tartrate, 10 g / L yeast extract, 20 g / L peptone, 20 g / L glucose, and 20 g / L agar.
[0043] Alcohol production test: The strains obtained through the initial screening were streaked onto the lower layer of PDA medium and incubated at 30°C for 48 hours. After a large number of single colonies of each strain had grown, the upper layer of medium was slowly poured into the petri dish to completely cover the lower layer of medium. The dish was then placed in the dark for 2-3 hours. The redder the colonies, the stronger the ester production capacity.
[0044] Membrane formation test: The strains were inoculated into PDB broth medium and cultured at 30°C for 48 hours to observe the membrane formation.
[0045] Two yeast strains, Z1 and Z4, with significantly different indices were identified through secondary screening. They were stained with 1% methylene blue and observed under a biological microscope. Strain Z1... Figure 1 As shown in A, strain Z4 is as follows Figure 1 As shown in B.
[0046] Strain Z1 was activated at 30℃ and pH 7 on PDA medium and cultured for 24–48 h. Its colonies were round, with a rough, dry, opaque, and yellowish-brown surface. This strain produced more alcohols and esters than other strains. It was negative in nitrate reduction and urea hydrolysis tests, and did not produce indole or hydrogen sulfide, exhibiting good safety.
[0047] Strain Z4 was activated on nutrient agar medium at 30℃ and pH=7, and the seed culture was cultured at 37℃. Morphological observation and physiological and biochemical identification showed that the strain was round, irregular, dull, with glossy edges, a raised central hilum, a rough surface, and was dry, opaque, and yellowish-brown in color. The screened strain did not produce indole or hydrogen sulfide, and both the nitrate reduction test and urea hydrolysis test were negative, indicating good safety performance.
[0048] 4. Molecular biological identification of the strain: The activated strain was inoculated into PDA medium and cultured at 30℃ for 24–48 h. DNA was extracted using a fungal genome extraction kit (Guiyang Jingong Technology Co., Ltd.) and subjected to ITS sequencing.
[0049] The ITS sequence of strain Z1 is as follows:
[0050] TGGAGTATACACACGTCAACAAAAGATCTAAAAGAATAAAACTTTCAACA
[0051] ACGGATCTCTTGGTTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATAC
[0052] CTAGTGTGAATTGCAGCCATCGTGAATCATCGAGTTCTTGAACGCACATTG
[0053] CGCCCGTCGGTATTCCGGCGGGCATGCCTGTCTGAGCGTCGTTTCCTTCTT
[0054] GTGCACCGGGGTCTTTGCAGATCCTCTCTGCGCAGAGCTGGCCGTGCCAC
[0055] TGGCCCGGCCGAAAAGAAACGTTGCGGACGAAGCGAACTACATCGGGAC
[0056] GCTTTGGCCGCCGAGCGAAAAAAAAACACCATTGAGCTCGACCTCAGATCAGGTAGGAGTACCCGCTGAA (SEQ ID NO: 1).
[0057] The ITS sequence of strain Z4 is as follows:
[0058] CCGAACGCACGCCGTCAAGCAAGAAATCCACAAAACTTTCAACAACGGA
[0059] TCTCTTGGTTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACCTAGT
[0060] GTGAATTGCAGCCATCGTGAATCATCGAGTTCTTGAACGCACATTGCGCCC
[0061] GCTGGTATTCCGGCGGGCATGCCTGTCTGAGCGTCGTTTCCTTCTTGGAGC
[0062] GGAGCTTCAGACCTGGCGGGCTGTCCCTGTGGACGGCCGCCCAAAGCG
[0063] AGGGCCTTCTGCGCGAACTAGACTGTGCGCGCGGGGCGGCCGGCGAACTTATACCAAGCTCGACCTCAGATCAGGCAGGAG (SEQ ID NO: 2).
[0064] The obtained yeast sequencing sequences were input into the NCBI database and compared with similar existing strains using BLASTn. ITS sequences with high similarity were obtained. A phylogenetic tree was constructed using the adjacent-joining method on MEGA 5.0 software, as shown below. Figure 2 As shown.
[0065] Figure 2 The data shows the evolutionary distance between strains. Among them, Z1 is most closely related to Pichia fermentan isolate JGF9. Based on the morphological and physiological and biochemical characteristics of the strains, Z1 can be identified as Pichia helmetii. Z4 is most closely related to Pichia membranifaciens strain GMUSM131 and is identified as Pichia membranifaciens.
[0066] The strain Z1 was deposited at the Guangdong Provincial Center for Microbial Culture Collection, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou. The deposit name is Pichia fermentan 4-1, the accession number is GDMCC No. 63699, and the deposit date is July 31, 2023.
[0067] The strain Z4 was deposited at the Guangdong Provincial Center for Microbial Culture Collection, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou. The deposit name is Pichia membranifaciens 2-2, the accession number is GDMCCNo.63700, and the deposit date is July 31, 2023.
[0068] Example 2
[0069] Preparation steps for tomato sour soup: Take 4800g of high-quality tomatoes and 800g of fresh red peppers, wash and dry them, then crush them. Add 200g of salt, 40g of glutinous rice flour, 300g of ginger and garlic, and 100g of white wine. Mix well and bottle the mixture. Place it at 30℃ for fermentation, while simultaneously inoculating it with yeast. Before bottling, add 2wt% yeast as an inoculum. Mix well and ferment for 5 days to obtain tomato sour soup.
[0070] Samples are taken at regular intervals every day and frozen at -20℃.
[0071] The samples were subjected to pH testing, soluble solids content determination, reducing sugar determination, electronic tongue analysis, and sour soup flavor substance determination.
[0072] The pH test results are as follows: Figure 3 As shown in the figure. The results showed that inoculation with strains Z1 and Z4 had no significant effect on the pH value of the sour soup. During fermentation, the pH value continuously decreased with the extension of fermentation time. In the first 1-3 days of fermentation, the pH value dropped rapidly as fermentation progressed, and then the pH value gradually stabilized.
[0073] In red sour soup made from vegetables, lactic acid bacteria are the dominant bacteria in the early stages of fermentation. As fermentation progresses, the abundance of nutrients in the early stages accelerates the growth, reproduction, and metabolism of microorganisms, allowing them to grow rapidly and utilize environmental carbohydrates for fermentation, producing large amounts of organic acids. The number and activity of lactic acid bacteria increase continuously, leading to their proliferation and making them the dominant bacteria. Subsequently, they accumulate metabolic products, causing the pH value to decrease. As lactic acid accumulates and nutrients are consumed during metabolism, the growth of lactic acid bacteria in the sour soup is inhibited, their metabolic rate slows down, and the bacteria begin to decline. The pH of the sour soup gradually stabilizes.
[0074] During natural fermentation, pH value change is a crucial fermentation indicator. It is a comprehensive index of the metabolic activity of various microorganisms and one of the most critical fermentation parameters. It has a significant impact on the types and quantities of microorganisms and the accumulation of their metabolites, making it an important factor affecting the quality of sour soup.
[0075] The method for determining the soluble solids content is as follows: Weigh 250g of sample and place it in a high-speed tissue homogenizer to homogenize. Squeeze out the homogenate using two layers of lens paper or four layers of gauze for measurement. Calibrate the refractometer with distilled water at 20℃, adjusting the soluble solids content reading to 0. Maintain a stable measurement temperature, with a fluctuation not exceeding ±0.5℃. Clean the prism surface with a soft cloth, add 2-3 drops of the sample solution to distribute it evenly across the entire prism surface, align it with the light source (for non-digital refractometers, rotate the achromatic adjustment knob to divide the field of view into bright and dark sections, then rotate the prism knob until the boundary between bright and dark sections is aligned with the crosshair of the objective lens), and record the refractometer reading. For refractometers without automatic temperature compensation, record the measurement temperature. Clean the prism surface with distilled water and a soft cloth. The test results are as follows: Figure 4 As shown.
[0076] Depend on Figure 4 It can be seen that the soluble solids content of naturally fermented sour soup initially increases and then decreases. The change in soluble solids content during fermentation with Z1 yeast is similar to that of natural fermentation, initially increasing and then decreasing. However, the sour soup fermented with Z4 strain experienced a brief increase followed by a decrease and then an increase again, after which it rapidly decreased and then leveled off. It is speculated that Z4 yeast had a higher utilization rate of soluble solids in the early stage. Subsequently, due to the effects of salt, liquor, etc., proteins and pectins in tomatoes and glutinous rice flour were precipitated, greatly increasing the soluble solids content in the sour soup. In the later stage of fermentation, soluble reducing sugars, free amino acids, and soluble proteins in the sour soup were utilized by microorganisms, thus causing the soluble solids content in the sour soup to decrease again.
[0077] The method for determining reducing sugars uses the 3,5-dinitrosalicylic acid (DNS) method, and the steps are as follows:
[0078] (1) Prepare DNS reagent: Measure 750mL of deionized water, heat it to a slight temperature, and then add 10.00g of 3,5-dinitrosalicylic acid, 16.00g of NaOH, 5.00g of phenol, 5.00g of sodium sulfite and 300.00g of potassium sodium tartrate in sequence. After dissolving, make up to 1000mL and let it stand at room temperature in a brown bottle for one week before use.
[0079] (2) Extraction of reducing sugars: Weigh 3g of the sour soup sample evenly, add approximately 15mL of distilled water, and mix thoroughly in a beaker. Place the sample in a water bath at 50℃ for 30 minutes, stirring occasionally to ensure complete extraction of reducing sugars. After the water bath, transfer the sample to a 50mL centrifuge tube, balance it, and centrifuge at 4000g for 5 minutes. Remove the centrifuged sample, collect the supernatant, add 20mL of distilled water to the precipitate, mix thoroughly, and centrifuge again at 4000g for 5 minutes. Remove the sample from the second centrifugation, collect the supernatant, mix it with the supernatant collected previously, transfer it to a 100mL volumetric flask, dilute to the mark with distilled water, mix thoroughly, and use this as the reducing sugar test solution.
[0080] (3) Preparation of glucose standard curve: Take 0, 0.2, 0.4, 0.6, 0.8 and 1.0 mL of glucose standard solution (mg / ml) respectively, and accurately add 2 mL of DNS reagent to each test tube. Heat in a boiling water bath for 2 min, cool under running water, and add water to the mark of 15 mL. Measure the absorbance at a wavelength of 540 nm.
[0081] (4) Sample determination: Take 1.0 ml of reducing sugar test solution, and follow the same steps as above. Measure the absorbance at a wavelength of 540 nm.
[0082] The measurement results are as follows Figure 5 As shown.
[0083] Raw sugars are sugars that possess reducing properties. Monosaccharides containing free ketone or aldehyde groups and disaccharides containing free potential aldehyde groups are reducing sugars. Fructose contains free ketone groups, lactose and maltose contain free potential aldehyde groups, and glucose contains free aldehyde groups. Other disaccharides, trisaccharides, and polysaccharides do not inherently possess reducing properties but can be hydrolyzed to produce their corresponding reducing sugars.
[0084] Depend on Figure 5 It can be seen that the reducing sugar content in both naturally fermented and inoculated fermented red sour soup showed an overall decreasing trend, but the content varied at different fermentation stages. In the early stage of fermentation (0-1 day), the reducing sugar content in naturally fermented sour soup showed an increasing trend. The trend of reducing sugar content in the Z1 group was similar to that of naturally fermented sour soup, except that the reducing sugar content was slightly higher than that of naturally fermented sour soup after the second day. In the early stage of fermentation, the reducing sugar content in the Z4 group decreased. This may be because the microorganisms in naturally fermented sour soup degraded polysaccharides into reducing sugars, and their utilization rate was slow, resulting in a higher reducing sugar content. In contrast, the Z4 strain grew rapidly in the early stage, so the rate at which polysaccharides were degraded into reducing sugars was less than the rate at which the microorganisms utilized them, thus reducing the reducing sugar content.
[0085] The method for electronic tongue analysis is as follows: ① Sample preparation: Weigh 50.00g of sour soup and dilute to 100mL. Filter and collect the clear liquid for later use. ② Electronic tongue detection activation and calibration: Place the electronic tongue-specific beaker containing distilled water into position 1 of the automatic sample tray. Manually control the sensor array to be immersed in distilled water for 30min for activation. Then, actively activate, calibrate, and diagnose using 0.01mol / L NaCl (sodium chloride), HCl (hydrochloric acid), and MSG (monosodium glutamate) solutions according to the set program. ③ Pour the sample to be tested into the electronic tongue-specific beaker and directly test the sample at room temperature. Each sample is measured in parallel 5 times. The measurement results are as follows: Figure 6 As shown.
[0086] Depend on Figure 6 It can be seen that the fermented sour soup produced by strains Z1 and Z4 showed advantages over naturally fermented sour soup in terms of sourness, saltiness, umami, and richness. They contributed significantly to umami and saltiness, and significantly reduced unpleasant taste indicators such as astringency, bitterness, and astringent and bitter aftertastes. In terms of the contribution of sourness, strain Z1 was superior to strain Z4; in terms of the contribution of saltiness, strain Z4 was superior to strain Z1; in terms of richness and umami, strains Z4 and Z1 were similar; however, in terms of astringency, bitterness, and unpleasant taste aftertastes, strain Z1 showed a significantly better reduction effect than strain Z4. Z1 refers to strain Z1 identified in Example 1, which is *Pichia pastoris*, and Z4 refers to strain Z4 identified in Example 1, which is *Pichia pastoris*. K represents naturally fermented sour soup. The experiment was divided into two groups: a control group and an experimental group. The control group was the naturally fermented group, and the experimental group was the group fermented with strain Z1.
[0087] The method for determining the flavor compounds in sour soup was as follows: 2.0 g of the sample after 5 days of fermentation was weighed and placed in a 20 mL headspace vial. After incubation at 80℃ for 15 minutes, the sample was injected for flavor analysis. Gas chromatography-ion mobility spectrometry (GC-IMS) was used as the flavor analyzer. The analytical conditions of the flavor analyzer were set as follows: analysis time: 35 min; column type: SE-54, 15 meter, 0.53 mm ID, 1.0 μm df (RESTEK, USA); column temperature: 60℃; carrier gas / drift gas: N2IMS; temperature: 60℃; injection volume: 200 μL; incubation time: 15 min; incubation temperature: 80℃; injection needle temperature: 85℃; incubation speed: 500 rpm.
[0088] The experiment was divided into two groups: the control group was the natural fermentation group, and the experimental group was the Z1 group.
[0089] Experimental results are as follows Figure 7-9 As shown. Figure 7The image shows the flavor compounds of sour soup determined by GC-IMS. The components in the red box area have larger peak brightness in the Z1 sample group, indicating that these components have higher content in the Z1 sample group. They mainly include compounds such as β-Ocimene-M (monomer), Diisobutyl ketone-M (monomer), and the unidentified component ID-10. Figure 8 The software automatically generates three-dimensional spectra (retention time, migration time, and peak intensity) of volatile substances in the sample. Figure 9 The software automatically generates a two-dimensional top view of the volatile substances in a sample (retention time and migration time). The differences in volatile organic compounds in different samples can be intuitively seen from the three-dimensional image, and combined with the corresponding two-dimensional top view, the differences and changes in volatile substances can be more clearly demonstrated.
[0090] Depend on Figure 7-9 It was found that the volatile organic compounds in the samples mainly included aldehydes, esters, terpenes, ketones, and alcohols. Significant differences in volatile organic compounds were observed among different samples. In the control group (natural fermentation), the contents of diisobutyl ketone-D, 1-pentane-1, 3-octanol-1, β-ocimene-D, β-ocimene-M, 1-octene-3-D, 1-octene-3-M, and diisobutyl ketone-M were significantly reduced or even disappeared after fermentation with *Pichia pastoris*. In the experimental group (strain Z1), the contents of 1-octene, styrene-D, 2-methylpropionic acid, citral-D, and (E)-2-octenal-D were significantly increased after fermentation. The sourness, umami, saltiness, and richness of the sour soup were all improved to varying degrees in the fermentation group, while unpleasant taste indicators such as bitterness and astringency were reduced to varying degrees in the fermentation group.
[0091] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the invention by those skilled in the art. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the invention should be included within the scope of protection of the invention.
Claims
1. A Pichia fermentan 4-1 characterized in that, Its accession number is GDMCCNO.63699.
2. Use of the Pichia guilliermondii of claim 1 for reducing the unpleasant taste indicators of tomato juice, characterized by, The unpleasant taste indicators are one or more of astringency, bitterness, and astringent aftertaste and bitter aftertaste.
3. Use according to claim 2, characterized in that, Includes the following steps: S1. Wash the tomatoes and peppers, dry them, crush them, add salt, glutinous rice flour, ginger, garlic, and white wine, mix well, and then bottle them. S2, inoculate with the described Pichia pastoris and ferment at 28-32℃.
4. Use according to claim 3, characterized in that, The mass ratio of the tomatoes, peppers, salt, glutinous rice flour, ginger, garlic, and liquor is 45-55:5-10:1-3:0.20-0.50:1-5:
1.
5. Use according to claim 4, characterized in that, The mass ratio of the tomatoes, peppers, salt, glutinous rice flour, ginger, garlic, and liquor is 48:8:2:0.40:3:
1.
6. The application according to claim 3, characterized in that, The inoculation amount of the *Pichia pastoris* was 1.5-2.5 wt.
7. The application according to claim 3, characterized in that, The fermentation period is 4-6 days.
Citation Information
Patent Citations
Pichia pastoris and application thereof in enhanced fermentation of tomato sour soup
CN117778207A