A tRNA-based chlorella crisper / cas system and application thereof

Abstract

The application discloses a tRNA-based Nannochloropsis CRISPR / Cas system and application thereof. The Nannochloropsis CRISPR / Cas system is any one of the following: (1) comprising specific RNA and a Cas nuclease, the specific RNA comprising tRNA and a guide RNA, the tRNA being obtained by transcription of DNA shown in SEQ ID No. 2; (2) comprising specific DNA and a Cas nuclease gene, the specific DNA comprising a tRNA gene and a guide RNA skeleton fragment gene, the nucleotide sequence of the tRNA gene being shown in SEQ ID No. 2; (3) comprising specific DNA and a Cas nuclease, the specific DNA comprising a tRNA gene and a guide RNA skeleton fragment gene; and (4) comprising specific RNA and a Cas nuclease gene, the specific RNA comprising tRNA and a guide RNA. The system can realize accurate expression of a guide RNA of Nannochloropsis.

Description

Technical Field

[0001] This invention belongs to the field of bioengineering technology, specifically relating to a tRNA-based CRISPR / Cas system for *Microcystis aeruginosa* and its applications. Background Technology

[0002] *Microcystis aeruginosa* is considered a potential bioenergy crop due to its high oil yield, ease of cultivation, and ability to synthesize high-value byproducts. Modifying the *Microcystis aeruginosa* genome is beneficial for genome research and is significant for improving its oil production, biomass, and pest resistance. The CRISPR / Cas9 system is an RNA-mediated adaptive immune system found in bacteria and archaea that controls viral invasion and eliminates plasmids. Cas9 can form a complex with a synthetically produced guide RNA (cRNA), which is generated by the fusion of crRNA (CIRSPR RNA) and tracrRNA (trans-activating crRNA). The guide RNA guides the Cas9 endonuclease to recognize and cleave target DNA. Cas9 has two key domains: HNH and RuvC, which cleave one single strand of the DNA double helix, respectively, resulting in a DNA double-strand break (DSB). The cell initiates repair mechanisms. Inaccurate repair methods, such as non-homologous end joining (NHEJ), can produce site-directed mutations, while homologous recombination (HR) can achieve precise site-directed insertion or replacement of genes. Although CRISPR / Cas9 has been applied to the modification of *Microcystis globulus*, further research is needed on how to accurately and conveniently express guide RNA in *Microcystis globulus*.

[0003] The commonly used CRISPR / Cas system based on episomes, specifically *Microcystis globulus*, utilizes the Hammerhead structure to achieve accurate expression of guide RNA in *Microcystis globulus*. However, the design and application of the Hammerhead structure in guide RNA expression is relatively complex. Summary of the Invention

[0004] One of the objectives of this invention is to provide a tRNA-based CRISPR / Cas system for *Microcystis aeruginosa*.

[0005] This invention provides a tRNA-based CRISPR / Cas system for *Microcystis aeruginosa*, which is any one of the following:

[0006] (1) Includes specific RNA and Cas nuclease, wherein the specific RNA includes tRNA and guide RNA, and the tRNA is obtained by transcription of the DNA shown in SEQ ID No. 2;

[0007] (2) Includes specific DNA and Cas nuclease gene, wherein the specific DNA includes tRNA gene and guide RNA backbone fragment gene, and the nucleotide sequence of the tRNA gene is shown in SEQ ID No. 2;

[0008] (3) Includes specific DNA and Cas nuclease, wherein the specific DNA includes tRNA gene and guide RNA backbone fragment gene, and the nucleotide sequence of the tRNA gene is shown in SEQ ID No. 2;

[0009] (4) Includes specific RNA and Cas nuclease gene, wherein the specific RNA includes tRNA and guide RNA, and the tRNA is obtained by transcription of the DNA shown in SEQ ID No.2.

[0010] Optionally, according to the Micrococcus microcarpa CRISPR / Cas system described above, the specific DNA described in (2) or (3) further includes a promoter that drives the expression of the tRNA gene and the guide RNA gene.

[0011] Optionally, according to the above-described Microcystis CRISPR / Cas system, the promoter is the Ribi promoter. The Ribi promoter sequence may be as shown in positions 9389-10572 of SEQ ID No. 1.

[0012] Optionally, according to the Micrococcus microcarpa CRISPR / Cas system described above, the specific DNA described in (2) or (3) further includes an RNA fragment gene that binds complementary to the target fragment. Alternatively, the specific DNA may not include an RNA fragment gene that binds complementary to the target fragment; in this case, before use, depending on the specific target fragment, an RNA fragment gene that binds complementary to the target fragment needs to be inserted into the specific DNA.

[0013] Optionally, according to the above-described Micrococcus microcarpa CRISPR / Cas system, the guide RNA described in (1) or (4) comprises an RNA fragment that binds complementaryly to the target fragment and a backbone RNA fragment. For example, the guide RNA is formed by sequentially linking an RNA fragment that binds complementaryly to the target fragment and a backbone RNA fragment. The backbone RNA fragment may be an RNA with a hairpin-like structure formed by sequentially chimerating tracrRNA and crRNA, and the backbone RNA fragment may bind to the Cas9 nuclease.

[0014] The guide RNA backbone fragment gene encodes a guide RNA backbone fragment, the sequence of which is shown in positions 10686-10761 of SEQ ID No. 1.

[0015] The specific DNA may consist of a promoter (e.g., the Ribi promoter), a tRNA gene, and a guide RNA gene (encoding guide RNA). The promoter can be any transcribed RNA promoter. The transcripts generated after transcription of the tRNA and guide RNA genes are tRNA-guide RNA structures. The tRNA in the transcripts is then processed and cleaved to form mature guide RNA. The guide RNA gene consists of an RNA fragment gene that binds complementary to the target sequence and a backbone RNA fragment gene. The specific DNA sequence may be shown as positions 9389-10761 of SEQ ID No. 1.

[0016] Optionally, the target fragment is located on the target gene; one strand of the target fragment has the following structure: 5'-NX-NGG-3', where N represents any one of A, G, C, and T, and 14≤X≤30, then NX represents the presence of 14 or more and 30 or less A, G, C, or T; the RNA fragment in the guide RNA that binds complementary to the target fragment is the RNA fragment that binds complementary to the NX fragment in the 5'-NX-NGG-3'.

[0017] Optionally, according to the above-described Micrococcus microcarpa CRISPR / Cas system, the Cas nuclease gene described in (2) or (3) further includes a nuclear localization signal peptide gene. The nuclear localization signal peptide gene sequence may be the reverse complementary sequence of positions 4642-4662 of SEQ ID No. 1.

[0018] The Cas nuclease gene encodes the Cas nuclease, and the Cas nuclease gene sequence may be the reverse complementary sequence of positions 5257-9381 or positions 4642-9381 of SEQ ID No. 1 (the reverse complementary sequence of positions 4642-9381 can translate Cas9 protein-luciferase-SV40). The Cas nuclease (e.g., Cas9 nuclease) may have a nuclear localization signal peptide at the N-terminus and / or C-terminus of the Cas nuclease.

[0019] Optionally, according to the above-described Micrococcus microcarpa CRISPR / Cas system, the Micrococcus microcarpa CRISPR / Cas system is a vector with a nucleotide sequence as shown in SEQ ID No. 1.

[0020] The present invention also provides a gene editing method for *Microcystis globulus*, which enables *Microcystis globulus* to contain the aforementioned CRISPR / Cas system.

[0021] This editing method utilizes the CRISPR / Cas system to modify target genes in *Microcystis globulus*, achieving random insertion and / or deletion of target fragments within the target gene. The main working principle involves incorporating specific DNA and the encoding gene for Cas nuclease / Cas nuclease into *Microcystis globulus*. The specific DNA first expresses a tRNA-guide RNA fusion sequence via a promoter. After removing the tRNA, precisely expressed guide RNA is obtained. Under the combined action of the guide RNA and Cas nuclease, the double-stranded target fragment on the target gene is cleaved. Finally, through the *Microcystis globulus*'s own DNA repair function, random insertion and / or deletion of the target fragment in the target gene are achieved.

[0022] Optionally, the above-described CRISPR / Cas system for *Microcystis globulus* is introduced into *Microcystis globulus* according to the gene editing method described above. For example, specific DNA and a Cas nuclease gene are introduced into *Microcystis globulus*. The specific DNA expresses guide RNA in *Microcystis globulus*, and the Cas nuclease gene expresses Cas nuclease in *Microcystis globulus*.

[0023] The aforementioned Micrococcus microcarpa CRISPR / Cas system, the aforementioned tRNA, or the aforementioned tRNA gene in gene editing or in the preparation of gene editing products are also within the scope of protection of this invention.

[0024] The aforementioned tRNA or tRNA gene also falls within the scope of protection of this invention.

[0025] tRNA can achieve precise cleavage of co-expressed guide RNA by utilizing RNase P and RNase Z. Using tRNA, the precise expression of guide RNA can be easily achieved, simplifying the design of guide RNA.

[0026] The aforementioned CRISPR / Cas system for *Microcystis globulus* can be a recombinant expression vector. This recombinant expression vector can be any expression vector or DNA sequence capable of expressing exogenous genes in *Microcystis globulus*.

[0027] The CRISPR / Cas system of *Microcystis globulus* of this invention enables precise expression of *Microcystis globulus* guide RNA, ultimately realizing a method for gene editing of *Microcystis globulus* based on the CRISPR / Cas system. Detailed Implementation

[0028] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0029] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available. All quantitative experiments in the following examples were performed in triplicate, and the results were averaged.

[0030] The microalgae used in the following examples were obtained from the Single Cell Center of Qingdao Institute of Bioenergy and Bioprocess Technology, Chinese Academy of Sciences (described in Wang, QT, Lu, YD, Xin, Y., Wei, L., Huang, S. and Xu, J. (2016) Genomeediting of model oleaginous microalgae Nannochloropsis spp. by CRISPR / Cas9. Plant J 88, 1071-1081.).

[0031] The CRISPR / Cas system plasmid used in the following examples is named 160tRNA plasmid, and its nucleotide sequence is shown in SEQ ID No. 1. The reverse complementary sequence of nucleotides 5257-9381 is the Cas9 coding sequence, nucleotides 9389-10572 are the Ribi promoter, nucleotides 10579-10660 are the tRNA coding sequence, and nucleotides 10686-10761 are the guide RNA backbone coding sequence. There are two BspQI restriction sites between the tRNA coding sequence and the guide RNA backbone coding sequence.

[0032] Example 1: Knockout of the Lightharvesting Complex Protein (LHC) gene in *Microcystis microphylla* using the CRISPR / Cas system.

[0033] (I) Design of target fragment target-LHC, guide RNA-LHC: GAACTCAGGGATCTCAACAT (LHC gene is numbered NO13G02860 in NanDeSyn).

[0034] (II) Preparation of CRISPR / Cas plasmids containing guide RNA-LHC nucleotide fragments

[0035] Synthesize the following single-stranded primers with sticky ends (underlined parts):

[0036] Guide RNA-LHC-F: TGCAGAACTCAGGGATCTCAACATG;

[0037] Guide RNA-LHC-R: AAACATGTTGAGATCCCTGAGTTCT.

[0038] Double-stranded DNA with sticky ends was formed by primer annealing and ligated into a 160tRNA plasmid digested with BspQI, resulting in a plasmid containing guide RNA-LHC. The plasmid was confirmed positive by sequencing. The nucleotide sequence of the plasmid containing guide RNA-LHC is obtained by replacing sequences 10661-10685 shown in SEQ ID No. 1 with GAACTCAGGGATCTCAACAT.

[0039] (III) Electroporation method to convert CRISPR / Cas system into Microcystis globulus.

[0040] Plasmids containing guide RNA-LHC were precipitated with 75% ethanol and concentrated to 300 ng / μl for transformation experiments.

[0041] Take a concentration of approximately 1-3 × 10 7 Micrococcus pluvialis algal culture in logarithmic growth phase was centrifuged at 6000g for 5 min, the supernatant was discarded, and the cells were washed twice with 375mM sorbitol. The cell concentration was then adjusted to approximately 1×10⁻⁶ cells / mL. 9 Cells were concentrated to obtain thalli. The concentrated thalli were aliquoted into 200 μl portions. Each portion was added with 3 μg of purified vector and 1 μl of denatured salmon sperm DNA (15 μg / mL). The mixture was incubated on ice for 10 min to obtain a final mixture. The mixture was transferred to a 2 mm electroporation cuvette and electroporated at 2200 V, 50 μF. Immediately after electroporation, the mixture was transferred to 5 mL of fresh f / 2 medium. Cells were incubated at 25 °C for 48 h under weak light with a shaker at 100 rpm. Cells were plated onto f / 2 plates containing bleomycin (5 μg / mL) and cultured for 25 days. Twelve single clones were picked and cultured in 24-well plates for 14 days. DNA was extracted from each clone using a plant tissue extraction kit (OMEGA).

[0042] (iv) Sequencing detection of mutation sites

[0043] Primers F: 5'-CATATCCTCATCTCATCCGTCTT-3' and R: 5'-AAGGTCTCGTCATCCTTACCCT-3' were designed near the target site. Using extracted cloned DNA as a template, the target site was amplified by PCR, and the amplified products were sequenced. The sequencing results are shown in Table 1, where WT represents the wild-type gene sequence. Three mutations were found in the 12 mutant strains: mutation 1 in 10 strains, mutation 2 in 1 strain, and mutation 3 in 1 strain. Mutation 1 involves the insertion of an A after position 15 of the target site sequence; mutation 2 involves the deletion of a C at position 18 of the target site sequence; and mutation 3 involves the deletion of AAC at positions 16-18 of the target site sequence. The results indicate that all 12 transformants produced mutations at the target site, proving that the CRISPR / Cas system in this example successfully achieved mutations at the target site.

[0044] Table 1. Sequencing results of photocomplex protein genes.

[0045]

[0046] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. A tRNA-based Nannochloropsis CRISPR / Cas system, characterized in that: The vector is a nucleotide sequence as shown in SEQ ID No.

1.

2. A gene editing method for *Microcystis aeruginosa*, characterized in that: The microalgae contains the CRISPR / Cas system as described in claim 1.

3. The gene editing method according to claim 2, characterized in that: The Microsporum spp. CRISPR / Cas system of claim 1 is introduced into the Microsporum spp.

4. The application of the Micrococcus microcarpa CRISPR / Cas system according to claim 1 in Micrococcus microcarpa gene editing or in the preparation of Micrococcus microcarpa gene editing products.

Images