Application of nasp and anxa2 as a radiotherapy sensitivity predictor for human glioblastoma

Abstract

The application relates to application of NASP and ANXA2 as human glioblastoma radiotherapy sensitivity prediction markers, belongs to the technical field of biological medicine, and discloses application of NASP and ANXA2 as human glioblastoma radiotherapy sensitivity prediction markers, a DNA nucleotide sequence of the NASP and ANXA2 is shown as SEQ ID NO. 1; the application identifies that NASP and ANXA2 genes can accurately predict the radiotherapy sensitivity of GBM patients based on WES sequencing results and immunohistochemical results of fresh tissue samples of GBM patients, and the application has important clinical application value.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically involving the application of NSP and ANXA2 as predictive biomarkers for radiosensitivity in human glioblastoma. Background Technology

[0002] Glioblastoma (GBM) is a highly aggressive primary brain tumor, classified as a grade 4 high-grade glioma. It is the most malignant glioma among astrocytic tumors and the most common malignant primary intracranial tumor, accounting for 50.1% of primary malignant tumors of the central nervous system (CNS). Currently, the preferred treatment for GBM is surgical intervention followed by multimodal therapy with radiotherapy and / or temozolomide chemotherapy. However, despite most patients receiving standard treatment, the recurrence rate remains high, and the prognosis is extremely poor. Recent data show that the median survival for GBM patients is 8 months, with a 5-year relative survival rate of only 6.9%. Even with standard concurrent chemoradiotherapy after surgery, the median survival is only 15-17 months. Therefore, to improve the prognosis and quality of life for GBM patients, there is an urgent need to find more effective treatment methods and novel therapeutic targets that can reduce drug and radiotherapy tolerance.

[0003] Radiation therapy is one of the most widely used and effective treatments for cancer. It generates peroxide ions and free radicals through physical ionization and water ionization, causing direct and indirect damage to DNA, thereby killing tumor cells. A phase III clinical trial conducted by the European Organisation for Research and Treatment of Cancer (EORTC) and the National Cancer Institute of Canada (NCIC) on GBM showed that radiation therapy combined with temozolomide adjuvant chemotherapy can improve overall survival and progression-free survival. Based on this, the current standard treatment regimen for GBM is 2 Gy of radiation therapy daily from Monday to Friday, with a total dose of 60 Gy, followed by temozolomide maintenance therapy every 28 days for 5 days, for a total of 6 cycles.

[0004] Despite significant advancements in radiation oncology in recent years, radioresistance remains a major challenge in treating GBM patients. Therefore, understanding the molecular mechanisms of radioresistance and developing molecularly based radiosensitization strategies could help improve treatment outcomes for GBM patients. While radiation-induced DNA damage leads to tumor cell death, DNA damage and repair are subject to complex intracellular and extracellular regulation. In certain situations, tumor cells may exhibit radioresistance due to intrinsic cellular mechanisms and the microenvironment, leading to treatment failure and tumor recurrence. Therefore, identifying genes that can predict GBM radiosensitivity and targeting them to promote GBM treatment is of great significance. Summary of the Invention

[0005] The purpose of this invention is to overcome the shortcomings of the prior art and provide an application of NSP and ANXA2, which can predict the radiosensitivity of GBM, as predictive biomarkers for radiosensitivity in human glioblastoma.

[0006] The technical solution of the present invention is as follows:

[0007] Application of NASP and ANXA2 as predictive biomarkers for radiosensitivity in human glioblastoma.

[0008] Furthermore, the DNA nucleotide sequences of NASP and ANXA2 are shown in SEQ ID NO.1.

[0009] This invention also discloses the application of NASP and ANXA2 in the preparation of a radiosensitivity kit for human glioblastoma patients.

[0010] Furthermore, the kit contains primers and probes specifically targeting NASP and ANXA2, as well as standards.

[0011] Furthermore, the specific sequences of the primers are as follows:

[0012] NASP upstream primer: CTGAAAACGAGGCAGGAAAG;

[0013] NASP downstream primer: CTGCACCATCCTTAGGGAGA;

[0014] ANXA2 upstream primer: ACACCTGCTCAGTATGACGC;

[0015] ANXA2 downstream primer: CAGGACCTTATCTCGCGTCC.

[0016] Furthermore, the detection methods for NASP and ANXA2 include the following steps:

[0017] 1) Extraction of total RNA from samples: Total RNA was extracted from glioblastoma tumor tissue according to the TRIzol reagent instructions. The concentration and purity of the extracted total RNA from glioblastoma tumor tissue were detected, and the integrity of the extracted total RNA from glioblastoma tumor tissue was determined by agarose gel electrophoresis.

[0018] 2) Preparation of cDNA from samples: Total RNA extracted from glioblastoma tumor tissue was reverse transcribed using the TIANScript II RT Kit and the corresponding steps to synthesize cDNA;

[0019] 3) DNA amplification: using TB Premix Ex Taq TM The real-time PCR kit uses reverse-transcribed cDNA as a template, and employs StepOnePlus... TM A real-time PCR system was used to amplify NASP and ANXA2 using PCR.

[0020] Furthermore, the PCR amplification system for NASP and ANXA2 is as follows: 0.8 μL of 10 μmol / L upstream primer, 0.8 μL of 10 μmol / L downstream primer, 2 μL of glioblastoma sample cDNA, 0.4 μL of 50× ROX Reference Dye, 10 μL of TBGreen Premix Ex Taq II (TliRNaseH Plus) (2×), and 6 μL of deionized water.

[0021] Furthermore, the PCR amplification program is as follows: 95℃ for 30s, pre-denaturation; followed by 40 cycles: 95℃ for 5s, 60℃ for 30s. The PCR melting curve generation program is as follows: 95℃ for 15s, 60℃ for 60s, 95℃ for 15s.

[0022] Compared with the prior art, the beneficial effects of the present invention are:

[0023] 1. Based on WES sequencing and immunohistochemical results of fresh tissue samples from GBM patients, this invention identifies NASP and ANXA2 genes as being able to accurately predict the radiosensitivity of GBM patients, which has important clinical application value.

[0024] 2. This invention confirms that NASP and ANXA2 are highly expressed in GBM, and that the NASP and ANXA2 genes can predict the radiosensitivity of GBM patients.

[0025] 3. This invention confirms that the NASP gene can promote the proliferation, migration and invasion of GBM cell lines. This marker indicates that NASP can serve as a new target for future GBM treatment. The NASP gene can serve as a reference indicator for predicting the prognostic survival time of GBM patients and a reference for predicting prognostic survival risk.

[0026] 4. This invention demonstrates that NSP and ANXA2 genes are closely related to radiotherapy resistance in GBM cells. By studying the relationship between NSP and ANXA2 genes and radiotherapy sensitivity in GBM, this invention provides new biomarkers for predicting radiotherapy sensitivity in GBM patients, enabling timely intervention and treatment of GBM patients and improving clinical prognosis.

[0027] In summary, the present invention has the advantage of being able to predict the radiosensitivity of GBM. Attached Figure Description

[0028] Figure 1 : Expression characteristics of NASP in glioblastoma patients;

[0029] Figure 2 The role of NASP in promoting radiotherapy resistance in glioblastoma cell lines;

[0030] Figure 3 : The mechanism by which NASP mediates radiotherapy resistance in glioblastoma via ANXA2;

[0031] Figure 4 NASP and ANXA2 genes predict radiosensitivity in glioblastoma patients. Detailed Implementation

[0032] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0033] Example 1

[0034] like Figure 1 As shown, NSP and ANXA2 are used as predictive biomarkers for radiosensitivity in human glioblastoma. The DNA nucleotide sequences of NSP and ANXA2 are shown in SEQ ID NO.1.

[0035] 1. Expression characteristics of NASP in patients with glioblastoma.

[0036] 1.1 Expression of NASP mRNA in GBM;

[0037] Analysis from the GEPIA website shows that NASP mRNA levels are highly expressed in various tumors, including LGG and GBM, and are significantly higher than in their control normal tissues (e.g., Figure 1 (As shown in A).

[0038] 1.2 Relationship between NASP mRNA expression level and WHO grade in gliomas;

[0039] Analysis was conducted on glioma samples of different grades from the TCGA and CGGA databases. The results showed that in the TCGA, CGGA325, CGGA693, and CGGA301 datasets, NASP mRNA levels increased with increasing WHO grade, indicating a positive correlation with WHO grade (e.g., ...). Figure 1 (as shown in B);

[0040] Western blot and immunohistochemical experiments were performed on glioma tissues. Western blot analysis showed that NASP protein expression was lowest in WHO grade 2 glioma tissues, and increased with increasing WHO grade. Figure 1 C) Immunohistochemical results of glioma tissue showed that the percentage of NASP-positive cells was lowest in WHO grade 2 and highest in WHO grade 4 (e.g., Figure 1 (as shown in D);

[0041] Based on the above results, NASP is highly expressed in GBM at both the mRNA and protein levels.

[0042] 2. The effect of NASP on promoting radiotherapy resistance in glioblastoma cell lines

[0043] 2.1 Compared with the control group Vector, NASP upregulation induced radioresistance in U87 and U251 glioma cells, while NASP downregulation promoted their radiosensitivity (e.g., Figure 2 (As shown in AB);

[0044] 2.2 The role of NASP in radiotherapy-induced DNA repair.

[0045] Immunofluorescence analysis of γ-H2AX levels showed that, compared with the control Vector cells, NASP overexpression significantly reduced DNA damage levels in U87 cells, and the rate of decrease in γ-H2AX levels was significantly faster (e.g., Figure 2 (As shown in C), this indicates that NASP-overexpressing cells have a higher DNA repair capacity than the control group Vector. Similar experiments were performed in the U251 cell line, and the same results were shown (as shown in C). Figure 2 (as shown in D);

[0046] For NASP-knockdown U87 and U251 cells, the applicant conducted a comet assay and found that, compared with the control group Vector, NASP downregulation increased DNA damage (e.g., ...) in GBM cells. Figure 2 (as shown in EF);

[0047] Based on the above results, NASP plays an important role in DNA repair in GBM cells and mediates radiotherapy resistance in GBM cells.

[0048] 3. Mechanism of NASP-mediated radiotherapy resistance in glioblastoma via ANXA2

[0049] 3.1 Identification of potential interacting proteins using mass spectrometry analysis;

[0050] The results showed that at least 44 proteins could interact with NASP, and protein scoring based on protein abundance indicated that ANXA2 had the same effect (e.g., Figure 3 As shown in A), the mass spectrum confirmed the presence of ANXA2 protein (as shown in Figure A) in the immunoprecipitate. Figure 3 (as shown in B);

[0051] 3.2. Confirmed that NASP can promote ANXA2-mediated DNA repair after radiotherapy;

[0052] Co-IP assays were performed using protein lysates from U87 and U251 cells, confirming the presence of ANXA2 protein (e.g., ) in the lysates treated with anti-NASP antibody. Figure 3 (as shown in C), and NASP protein (as shown in C) in the lysate treated with anti-ANXA2 antibody. Figure 3 (as shown in D);

[0053] This finding further confirms the interaction between NASP and ANXA2 in GBM cells;

[0054] 3.3 Determine whether DNA repair is mediated by the interaction between NASP and ANXA2;

[0055] Knockdown of ANXA2 expression in NASP-overexpressing cells showed that downregulation of ANXA2 reversed the reduction in γ-H2AX focal points induced by NASP overexpression (e.g., Figure 3 As shown in E), in addition, the reduction in DNA comet tail moment caused by NASP overexpression was also reversed (e.g., Figure 3 (as shown in F);

[0056] These results indicate that NASP participates in ANXA2-mediated DNA repair by increasing ANXA2 nuclear localization, and its upregulation enhances DNA repair capacity after radiotherapy.

[0057] 4. Determining the predictive ability of NSP and ANXA2 genes to assess radiosensitivity in glioblastoma patients.

[0058] 4.1 Determine the ability of NSP and ANXA2 genes to predict radiosensitivity in glioblastoma patients;

[0059] Comparing overall survival rates in LGG and GBM patients in the CGGA database who received radiotherapy but not temozolomide chemotherapy, high NASP expression after radiotherapy was also associated with poorer overall survival in different datasets (e.g., Figure 4 As shown in Figure A), furthermore, in different datasets of the CGGA database, patients with high expression of NASP and ANXA2 had significantly lower survival rates than patients with low expression of both (e.g., ...). Figure 4 (as shown in B);

[0060] The above results indicate that NSP and ANXA2 genes have the ability to predict the radiosensitivity of glioblastoma patients.

[0061] Example 2

[0062] Application of NASP and ANXA2 in the preparation of radiosensitivity kits for human glioblastoma patients;

[0063] 1. Components of the reagent kit:

[0064] 1.1 RNA extraction kit: The TRIzol kit from Ambion was used;

[0065] 1.2 Reverse transcription kit: The TIANScriptⅡRTKit kit from Tiangen Biotech (Beijing) Co., Ltd. was used;

[0066] 1.3. Real-time PCR kit: TaKaRa TB kit was used. Premix Ex Taq TM Real-time PCR kit.

[0067] The kit contains primers and probes specifically targeting NSP and ANXA2, as well as standards.

[0068] 2. The detection methods for NASP and ANXA2 include the following steps:

[0069] 2.1 Extraction of total RNA from samples: Refer to the Ambion TRIzol kit instructions; the specific steps are as follows:

[0070] ① Tumor samples from glioblastoma patients were rapidly cooled with liquid nitrogen and stored for later use after being removed from the body;

[0071] ②The mortar is cooled with liquid nitrogen, and the tissue sample (weighing about 20 mg) is ground with liquid nitrogen while the mortar is being ground.

[0072] ③ Add about 1 ml of TRIzol reagent to the powdered tissue sample, continue grinding, and transfer the powder to a 1.5 ml centrifuge tube;

[0073] ④ After the contents of the centrifuge tube are in a liquid state, use a 1ml pipette to blow up and down 20-30 times, add 0.2ml of chloroform to each tube, cover the centrifuge tube, shake the tube up and down by hand 15-20 times, incubate at room temperature for 5 minutes, and centrifuge at 4℃ for 10 minutes (12000g).

[0074] ⑤ After centrifugation, aspirate the supernatant aqueous phase and transfer it to a new centrifuge tube. Pre-cool the RNA with 0.5 ml of isopropanol and centrifuge at 4°C for 10 minutes (12000 g).

[0075] ⑥ Discard the supernatant, wash the RNA with 1 ml of 75% ethanol, and centrifuge at 4°C for 5 minutes (12000g);

[0076] ⑦ Discard the supernatant, dry in a vacuum dryer for 5 minutes, dissolve the RNA in 50 μL of DEPC water, and after the RNA is completely dissolved, use NanoDrop One to detect the concentration and purity of the RNA. Then, use agarose gel electrophoresis to check the integrity of the extracted RNA.

[0077] 2.2 Preparation of cDNA from samples: The preparation was carried out according to the instructions of the TIANScript II RT Kit from Tiangen Biotech (Beijing) Co., Ltd., and the specific steps are as follows:

[0078] cDNA was prepared using the TIANScript 11 cDNA first-strand synthesis kit. The system was as follows: 1 ng - 2 μg Total RNA, 2 μL Random Primer (10 μM), 1 μL Super Pure dNTPs (10 mM), and RNase-free H2O was added to a final volume of 14.5 μL. The mixture was incubated at 65 °C for 5 min, and then placed on ice for 2 min to obtain the reaction solution.

[0079] Add the following reverse transcription components to the above reaction solution: 14.5 μL of the above reaction solution; 4 μL of 5×TIANScript II RTase Buffer, 0.5 μL of RNasin (40 U / μL), and 1 μL of TIANScript II RTase (200 U / μL); incubate at 25 °C for 10 min, incubate at 42 °C for 60 min, and terminate the reaction by heating at 85 °C for 5 min. Place the product on ice for subsequent experiments or freeze for storage.

[0080] 2.3 Amplification of NASP and ANXA2 gene markers: The amplification was performed using TaKaRa TB markers. Premix Ex Taq TM The real-time PCR kit uses reverse-transcribed cDNA as a template, via StepOnePlus... TM The NASP and ANXA2 genes were amplified separately using the tepOnePlusx E system.

[0081] The quantitative real-time PCR system consists of: 0.8 μL of upstream primer (10 μmol / L) and 0.8 μL of downstream primer (10 μmol / L) for a single gene; 2 μL of cDNA from the GBM sample; 0.4 μL of 50× ROX Reference Dye; 10 μL of TB Green Premix Ex TaqII (Tli RNaseH Plus) (2×); and 6 μL of deionized water.

[0082] PCR amplification program: 95℃ for 30s pre-denaturation; 40 cycles: 95℃ for 5s, 60℃ for 30s;

[0083] The reaction procedure for generating the PCR dissociation curve is: 95℃ for 15s, 60℃ for 60s, and 95℃ for 15s.

[0084] Primer sequence information for NASP and ANXA2 is shown in Table 1;

[0085]

[0086]

[0087] Table 1: Primer sequence information for NSP and ANXA2 gene sequences and the internal reference gene GAPDH

[0088] Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. Application of reagents for detecting NSP mRNA expression levels in the preparation of radiosensitivity prediction products for human glioblastoma.

2. The application according to claim 1, characterized in that: The DNA nucleotide sequence of the NASP is shown in SEQ ID NO.

1.

3. Application of reagents for detecting NASP expression levels in the preparation of a radiosensitivity prediction kit for human glioblastoma patients.

4. The application according to claim 3, characterized in that: The kit contains primers and probes specifically targeting NSP and ANXA2, as well as standards.

5. The application according to claim 4, characterized in that: The specific sequences of the primers are as follows: NASP upstream primer: CTGAAAACGAGGCAGGAAAG; NASP downstream primer: CTGCACCATCCTTAGGGAGA; ANXA2 upstream primer: ACACCTGCTCAGTATGACGC; ANXA2 downstream primer: CAGGACCTTATCTCGCGTCC.

6. The application according to claim 5, characterized in that: The detection methods for NASP and ANXA2 include the following steps: 1) Extraction of total RNA from samples: Total RNA was extracted from glioblastoma tumor tissue according to the TRIzol reagent instructions. The concentration and purity of the extracted total RNA from glioblastoma tumor tissue were detected, and the integrity of the extracted total RNA from glioblastoma tumor tissue was determined by agarose gel electrophoresis. 2) Preparation of cDNA from samples: Total RNA extracted from glioblastoma tumor tissue was reverse transcribed using the TIANScript II RT Kit reagents and corresponding steps to synthesize cDNA; 3) DNA amplification: Using the TB Green® Premix Ex Taq™ Real-Time PCR Kit as a template, reverse-transcribed cDNA was used to amplify NASP and ANXA2 via the StepOnePlus™ Real-Time PCR system.

7. The application according to claim 6, characterized in that: The PCR amplification system for NASP and ANXA2 was as follows: 0.8 μL of 10 μmol / L upstream primer, 0.8 μL of 10 μmol / L downstream primer, 2 μL of glioblastoma sample cDNA, 0.4 μL of 50×ROXReference Dye, 10 μL of TB Green Premix Ex Taq II 2× premix containing TliRNaseH Plus, and 6 μL of deionized water.

8. The application according to claim 7, characterized in that: The PCR amplification program is as follows: 95℃ for 30s, pre-denaturation; followed by 40 cycles: 95℃ for 5s, 60℃ for 30s. The PCR melting curve generation program is as follows: 95℃ for 15s, 60℃ for 60s, 95℃ for 15s.

Images