A hydrogel flexible SERS sensing patch, its preparation and application

Abstract

This invention discloses a hydrogel flexible SERS sensing patch, its preparation, and its application, belonging to the fields of functional materials and biodetection technology. The sensing patch is prepared by using agarose as the gel monomer material and embedding Ag NPs to obtain an Ag-AG hydrogel patch, then modifying the Ag NPs with an Apt-P recognition probe and hairpin DNA H1, and further loading SERS probes onto the hydrogel patch. It can specifically recognize *S. aureus* through Apt and release the P chain, thereby triggering the H2 on the SERS probe to catalyze a hairpin self-assembly (CHA) signal amplification reaction, binding the SERS probe to the Ag NPs. Qualitative and quantitative detection of *S. aureus* is achieved by outputting a SERS signal. The patch exhibits high sensitivity and specificity, good uniformity, and reproducibility, and is expected to be used for reliable in-situ detection of trace amounts of *S. aureus* in skin wounds.

Description

Technical Field

[0001] This invention belongs to the field of functional materials and biosensing technology, specifically relating to a hydrogel flexible SERS sensing patch, its preparation method, and its application in the field of bacterial detection. Background Technology

[0002] Pathogenic bacteria such as Staphylococcus aureus and Escherichia coli are ubiquitous in the environment and can spread rapidly through various methods. Some symbiotic pathogens easily cause skin infections, and bacterial infections or contamination can lead to many serious and even fatal diseases. The earlier a bacterial infection is diagnosed, the higher the patient's recovery rate. Therefore, it is essential to develop a rapid, sensitive, low-cost, and accurate method for detecting trace amounts of Staphylococcus aureus in wounds. Traditional blood bacterial detection methods mainly include plate count, polymerase chain reaction (PCR), and enzyme-linked immunosorbent assay (ELISA). While these methods can theoretically solve the corresponding problems, they all have their own shortcomings. Plate count is a relatively mature and classic detection method, but it requires isolation, incubation, and counting processes, which are complex and time-consuming. PCR requires specialized equipment and complex processing procedures, making it technically demanding and costly. ELISA is even more problematic due to its cumbersome process, long processing time, and poor reproducibility.

[0003] Based on the aforementioned problems and the need for rapid sensing, surface-enhanced Raman scattering (SERS), which benefits from the local surface plasmon resonance (LSPR) of noble metals, has become a more promising method for bacterial detection. This technology can provide specific high-signal "fingerprint" spectra, has strong resistance to interference from external factors, can selectively detect pathogens in complex environments, and is simple to operate, requiring no staining or specific labeling and will not damage the sample itself.

[0004] Several SERS sensing devices have been disclosed in the prior art, successfully detecting a variety of pathogens. For example, Chinese patent CN 116148239 A discloses a nano-"sandwich" bacterial detection system with multiple SERS signal enhancement, including highly bacterially adhesive labeled nanoparticles D-Au@Ag-C, modified with concanavalin A and a SERS tag, and a capture substrate Fe3O4@Au-Ab. The system can highly identify Staphylococcus aureus in aqueous solution or blood, with a limit of detection (LOD) of 97 CFU. Although this system significantly improves the detection sensitivity compared to traditional technologies, the detection limit is still around 100 CFU / mL, and the sensitivity needs further improvement. Furthermore, conventional SERS substrates are unstable and have weak binding ability to bacteria, resulting in weak spectral signal intensity and poor reproducibility.

[0005] Plasmon metal surfaces are easily contaminated by the non-specific and irreversible adsorption of interfering substances, which is the main reason why target molecules are difficult to enter, thus affecting detection accuracy. Experiments have shown that embedding plasmon metals in hydrogels can protect them from contamination. There are no reports in the current technology on using hydrogel-based SERS patches to capture and detect *S. aureus* in actual systems. Hydrogel SERS substrates can directly detect target bacteria in situ using a simple "attach and peel" method. Furthermore, hydrogels are three-dimensional (3D) cross-linked molecular networks that can hold large amounts of water, making them highly biocompatible. Agarose can form hydrogels without toxic cross-linking agents and catalysts, thus exhibiting high biocompatibility. Agarose hydrogels are structurally stable and serve as reliable support materials; moreover, their large pore size allows for the entry and exit of large molecules, making them suitable for in-situ bacterial detection.

[0006] In summary, to meet the need for in-situ sensitive and accurate detection and analysis of bacterial cells on the skin and other surfaces, it is necessary to develop a flexible sensing patch based on agarose to achieve in-situ accurate identification and detection of bacteria in skin wounds. Summary of the Invention

[0007] The purpose of this invention is to solve the problems existing in the prior art and provide a hydrogel flexible SERS sensing patch and its preparation method. In addition, it combines aptamer-based targeting of bacteria and triggering CHA signal amplification reaction to construct a highly sensitive and specific bacterial SERS sensing technology, which can be efficiently used for the detection of Staphylococcus aureus in skin wounds.

[0008] The present invention is achieved as follows: a hydrogel flexible SERS sensing patch is prepared by using agarose as the gel monomer material and embedding silver nanoparticles (Ag NPs) through a physical mixing method to obtain an Ag-AG hydrogel patch. Then, an Apt-P recognition probe and hairpin DNA H1 are co-modified onto the silver nanoparticles. Finally, a SERS probe is loaded onto the hydrogel patch. The SERS probe is prepared by modifying the surface of gold nanoparticles with hairpin DNA H2 and Raman molecules.

[0009] Furthermore, Apt is a nucleic acid aptamer that can specifically recognize S. aureus, and P is a DNA single strand that is partially complementary to Apt. Apt and P hybridize to form the Apt-P recognition probe.

[0010] The nucleic acid sequence of Apt is shown in SEQ ID NO: 1: 5'-TTTTTTGCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA-3';

[0011] The nucleic acid sequence of P is shown in SEQ ID NO: 2: 5'-SH-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCCTAAGCTTAGCAAAGTAGCGTGCACTGCT-3';

[0012] The nucleic acid sequence of the hairpin DNA single-stranded H1 is shown in SEQ ID NO: 3: 5'-SH-TTTTTTGTGCACGCTACTTTGCTAAGCCGTGCACAACTAGCGCTTAGCAAAGTAG-3';

[0013] The nucleic acid sequence of the hairpin DNA single-stranded H2 is shown in SEQ ID NO: 4: 5'-GCTAAGCGCTAGTTGTGCACGGCTTAGCAAAGTTCCGTGCACAACTAGCACCGGGCAGAGCACTTTTTT-SH-3'.

[0014] The preparation method of the above-mentioned hydrogel flexible SERS sensing patch is as follows:

[0015] 1) Mix AgNO3 solution with ultrapure water and heat to boiling. While boiling, add sodium citrate solution to the boiling liquid and continue heating until the liquid color changes from colorless to yellow-green. Cool and filter to obtain silver nanoparticle solution.

[0016] 2) Mix the aqueous solution and the silver nanoparticle solution obtained in step 1) in equal volumes, add agarose, heat to dissolve the agarose, transfer to a mold and cool to form a gel, to obtain Ag-AG hydrogel flexible patch;

[0017] 3) After annealing the hairpin DNA H2, it was mixed with tris(2-carboxyethyl)phosphine (TCEP) for activation. The activated DNA H2 was mixed with buffer, and gold nanoparticles were added into the mixture for reaction. NaCl was added in small amounts several times for aging. Raman molecules were added for incubation. After centrifugation and washing, the precipitate was dispersed in buffer to prepare the SERS probe.

[0018] 4) Mix the Apt-P double-stranded solution and the hairpin DNA H1 chain solution and add them to the Ag-AG hydrogel flexible patch prepared in step 2). Incubate to modify the Apt-P recognition probe and hairpin DNA H1 onto the surface of Ag nanoparticles. Wash and set aside for use.

[0019] 5) Add the SERS probe prepared in step 3) to the hydrogel patch obtained in step 4), incubate, and wash to remove the unloaded SERS probe to obtain a flexible hydrogel SERS sensing patch.

[0020] Further, in step 1), the volume ratio of AgNO3 solution to ultrapure water is 1:5-1:20, the concentration of AgNO3 solution is 5-20 mM, the mass concentration of sodium citrate solution is 0.5%-2%, and the volume ratio of sodium citrate solution to AgNO3 solution is 1:2.5-1:10.

[0021] Further, in step 3), the molar ratio of hairpin DNA H2 to TCEP is 1:200-1:1000, the activation process is carried out at 20-40℃ and 50-500rpm for 4-12h; the molar ratio of DNA H2 to gold nanoparticles is 300:1-800:1, the reaction conditions after adding gold nanoparticles to the activated DNA H2 are 20-40℃ and 50-500rpm for 8-16h; the aging reaction conditions are 20-40℃ and 50-500rpm for 6-12h; and the molar ratio of Raman molecules to gold nanoparticles is 700:1-2000:1.

[0022] Further, in step 3), the diameter of the gold nanoparticles is 10-30 nm, and the Raman molecule is selected from organic molecules containing thiol groups, including but not limited to any one of 4-mercaptobenzoic acid (4-MBA), 5,5'-dithio-bis-(2-nitrobenzoic acid) (DTNB), and 2-mercaptobenzothiazole (2-MBT).

[0023] Further, in step 4), the concentration ratio of Apt-P double-stranded solution to hairpin DNA H1 strand solution is 1:4, and the incubation time is 8-16h;

[0024] Furthermore, in step 5), the incubation environment is 20-40℃, 50-500rpm, and the constant temperature incubation time is 4-8h.

[0025] The aforementioned hydrogel flexible SERS sensing patch can be used in bacterial detection. This hydrogel flexible SERS sensing patch is effective for concentrations from 10 CFU / mL to 10... 7 S. aureus showed a linear response at CFU / mL, i.e., I 1331=525.8×lgC+564.2(R) 2 =0.9986), and the limit of detection (LOD) is 3.98 CFU / mL.

[0026] The flexible hydrogel SERS sensor patch can be applied to a wound on the skin surface to detect S. aureus in the wound exudate.

[0027] When Staphylococcus aureus in a wound comes into contact with a hydrogel flexible SERS sensing patch, the Apt in Apt-P binds to the target bacteria and detaches from the surface of Ag NPs. The remaining P chain on the Ag NPs hybridizes with H1 on the particle surface and opens the hairpin structure of the H1 chain, thereby triggering the H2 on the SERS probe to undergo a catalytic hairpin self-assembly (CHA) signal amplification reaction, capturing the SERS probe onto the Ag NPs in the hydrogel patch. Finally, the qualitative and quantitative detection of bacteria is performed by analyzing the SERS signal output by the SERS sensing patch.

[0028] Beneficial effects:

[0029] 1. The hydrogel flexible SERS sensing patch disclosed in this application is prepared by using agarose (AG) as the gel monomer material and embedding silver nanoparticles (Ag NPs) through a physical mixing method to obtain an Ag-AG hydrogel patch. Then, an Apt-P recognition probe and hairpin DNA H1 are co-modified onto the silver nanoparticles, and SERS probes are further loaded onto the hydrogel patch. It can specifically recognize Staphylococcus aureus (S. aureus) through Apt (nucleic acid aptamer) and release the P chain, thereby triggering the H2 on the SERS probe to catalyze the hairpin self-assembly (CHA) signal amplification reaction and bind the SERS probe to the Ag NPs in the patch. The qualitative and quantitative detection of S. aureus is achieved by outputting SERS signals. This application achieves the detection of S. aureus by combining SERS spectral analysis technology and nucleic acid signal amplification technology. The detection sensitivity is high and the detection limit is 3.98 CFU / mL.

[0030] 2. The hydrogel flexible SERS sensing patch disclosed in this application has good specificity, as well as good uniformity and reproducibility, which can meet the requirements for reliable detection and counting of target bacteria. It is expected to be used for reliable in-situ detection of trace amounts of S. aureus in skin wounds, providing reliable support for the detection of actual skin wounds, and also providing new ideas for the preparation of functional materials for bacterial detection.

[0031] 3. This application obtains a flexible patch by embedding silver nanoparticles in a hydrogel. On the one hand, the hydrogel has abundant pores, which can embed more silver nanoparticles to obtain a better SERS enhancement effect. On the other hand, the embedding of silver nanoparticles in the hydrogel can prevent the silver nanoparticles from being contaminated by external environmental substances. In addition, the hydrogel can achieve a flexible skin-adhering effect, which is convenient for operation.

[0032] 4. The nucleic acid aptamer used in this application has high specificity for recognizing Staphylococcus aureus (S. aureus). Compared with commonly used antibody recognition, the aptamer is easy to synthesize, low in cost, and has mild usage conditions and is not easily deactivated. Attached Figure Description

[0033] Figure 1 Schematic diagram illustrating the fabrication and detection principle of flexible hydrogel SERS sensing patches;

[0034] Figure 2 The images show the macroscopic and microscopic morphology of the Ag-AG hydrogel flexible patch prepared in Example 1. In the images, a is a physical image of the silver particles, b is the UV-Vis absorption spectrum of the silver particles, c is the SEM morphology of the silver particles, d is a physical image of the AG hydrogel before cooling and gelation, e is a physical image of the AG hydrogel after gelation, f is the SEM morphology of the AG hydrogel, g is a physical image of the AG-Ag hydrogel before cooling and gelation, h is a physical image of the AG-Ag hydrogel after cooling and gelation, and i is the SEM morphology of the AG-Ag hydrogel.

[0035] Figure 3 The data show the optimized detection parameters of the flexible hydrogel SERS sensing patch prepared in Example 1. In the figure, inset a shows the results of the silver particle embedding concentration optimization experiment; inset b shows the SERS detection spectrum of the cleaning optimization experiment; and inset c shows the SERS detection spectrum of the cleaning optimization experiment at 1331 cm⁻¹. -1 Peak intensity and signal-to-noise ratio; the small plot shows the comparison experiment of H1 and (Apt-P) concentrations at 1331 cm⁻¹. -1 Peak intensity histogram and signal-to-noise ratio, with the smaller graph representing C. (Apt-P) :C H1 SERS spectra at different incubation times with a ratio of 1:4 (1331 cm⁻¹) -1 Peak intensity value histogram, the smaller f-shaped plot represents C. (Apt-P) :C H1 SERS spectra at different incubation times with a ratio of 1:5 (1331 cm⁻¹) -1 Peak intensity value histogram;

[0036] Figure 4The bacterial SERS detection performance of the flexible hydrogel SERS sensing patch prepared in Example 1 is characterized. In Figure a, the smaller image shows the SERS detection spectra of target bacteria at different concentrations; in Figure b, the smaller image shows the 1331 cm⁻¹ SERS detection spectra of target bacteria at different concentrations. -1 Peak intensity values, fitted linear working curves, and detection limits;

[0037] Figure 5 The detection uniformity of the flexible hydrogel SERS sensing patch prepared in Example 1 is characterized. In Figure a, the smaller image shows the SERS spectra obtained from 50 random points detecting 500 CFU / mL bacteria; in Figure b, the SERS spectrum at 1331 cm⁻¹... -1 Signal strength value at location;

[0038] Figure 6 To demonstrate the reproducibility of the flexible hydrogel SERS sensing patch prepared in Example 1, the following figures are presented: a) Inset image shows the SERS spectra of 50 CFU / mL bacteria detected five times; b) Inset image shows the SERS spectra of 200 CFU / mL bacteria detected five times; c) Inset image shows the SERS spectra of 500 CFU / mL bacteria detected five times; d) Inset image shows the SERS spectra of three concentration tests at 1331 cm⁻¹. -1 Statistics on SERS signal strength values ​​at the location;

[0039] Figure 7 The specificity characterization of the hydrogel flexible SERS sensing patch prepared in Example 1 is shown in Figure a. In Figure a, the inset image shows the SERS detection spectra of different bacteria (Staphylococcus aureus, Pseudomonas aeruginosa, Escherichia coli) and samples without added bacteria (Blank). The inset image b shows the SERS detection spectra at 1331 cm⁻¹. -1 Statistics on SERS signal strength values ​​at the location;

[0040] Figure 8 The data obtained from the bacterial sensing test in the exudate of a pig skin wound using the flexible hydrogel SERS sensing patch prepared in Example 1 are shown in Figure a. In Figure b, the inset image (a) shows the actual bacteria detected in the exudate of the pig skin wound by the flexible hydrogel SERS sensing patch. Figure b shows the 1331 cm value obtained from the detection of *S. aureus* in the pig skin wound at different time points (0, 6, 12, 18, 24 h). -1 Bar chart of SERS signal strength values. Detailed Implementation

[0041] The preferred embodiments of the present invention will now be described in detail so that the advantages and features of the present invention can be more easily understood by those skilled in the art, thereby providing a clearer and more explicit definition of the scope of protection of the present invention.

[0042] Example 1: Preparation of a hydrogel flexible SERS sensing patch

[0043] 1) Preparation of silver nanoparticles:

[0044] Sodium citrate solid was dissolved in ultrapure water by sonication to prepare a 1% sodium citrate solution. 5 mL of 10 mM AgNO3 solution and 50 mL of ultrapure water were simultaneously poured into an Erlenmeyer flask and heated slowly until the solution boiled. The boiling process was maintained for three minutes. Then, 1 mL of the prepared sodium citrate solution was quickly added to the Erlenmeyer flask, and heating continued for 40 minutes. The color change was colorless – pale yellow – orange-yellow – gray-green – yellow-green. After heating, the solution was cooled, filtered, and the silver nanoparticle solution was obtained. The container holding the solution was wrapped in aluminum foil and stored in a 4°C refrigerator away from light until later use.

[0045] 2) Preparation of Ag-AG hydrogel flexible patches

[0046] 10 mL of aqueous solution and 10 mL of silver nanoparticle solution were mixed thoroughly. 0.1 g of agarose (AG) was added to the mixture, and the mixture was stirred until homogeneous. The mixture was then microwaved for 60 seconds to dissolve the agarose. The solution was transferred to a mold and cooled to solidify into a gel, thus obtaining an Ag-AG hydrogel flexible patch.

[0047] 3) Preparation of SERS probes

[0048] After annealing, hairpin DNA H2 was mixed with tris(2-carboxyethyl)phosphine (TCEP) at a molar ratio of 1:1000 and brought to a final volume of 50 μM. The nucleic acid sequence of hairpin DNA H2 was: GCTAAGCGCTAGTTGTGCACGGCTTAGCAAAGTTCCGTGCACAACTAGCACCGGGCAGAGCACTTTTTT-SH(5'-3'). Activation was performed by reacting at 37°C and 300 rpm for 12 h. Then, 8 μL of 50 μM TCEP-activated DNA H2 was mixed with 50 μL of 5×TBE, and 500 μL of a 2.5 nM aqueous solution of gold nanoparticles (15 nm in diameter) was rapidly added to the mixture. The reaction was then carried out at 37°C and 300 rpm for 14 h. Subsequently, 50 μL of 2M NaCl was added in small amounts multiple times over 2 hours and aged at 37°C and 300 rpm for 6 hours. Then, 10 μL of 100 μM DTNB (5,5'-dithio-bis-(2-nitrobenzoic acid)) was added and incubated for 3 hours. After washing by multiple centrifugations (12000 rpm, 20 min) to remove excess reactants, the precipitate was finally dispersed in 0.5×TBE buffer and brought to a final volume of 50 μL to obtain the SERS probe.

[0049] 4) Fabrication of flexible hydrogel SERS sensing patches:

[0050] The Apt and P strands were mixed to prepare a 1 μM Apt-P double-stranded solution. Aptamer (Apt) is a nucleic acid aptamer that specifically recognizes *S. aureus*, and Primer (P) is a single-stranded DNA that is partially complementary to the bases in Apt. Apt and P hybridize to form a recognition probe. The nucleic acid sequence of Apt is: TTTTTGCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA (5'-3'); the nucleic acid sequence of P is: SH-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCCTAAGCTTAGCAAAGTAGCGTGCACTGCT (5'-3'); then 10 μL of 1 μM Apt-P double-stranded solution was mixed with 10 μL of 4 μM hairpin DNA H1 chain solution, added to a hydrogel and incubated for 12 h. The nucleic acid sequence of DNA H1 is: SH-TTTTTTGTGCACGCTACTTTGCTAAGCCGTGCACAACTAGCGCTTAGCAAAGTAG (5'-3'), washed and ready for use.

[0051] Then, 10 μL of the SERS probe prepared in step 3) was added to the prepared hydrogel patch and incubated at 37℃ and 300 rpm for 6 h. After washing for 12 h, the unloaded SERS probe was removed, and the flexible hydrogel SERS sensing patch was obtained.

[0052] Relevant performance tests:

[0053] 1) SEM characterization experiment:

[0054] To characterize the morphology of silver nanoparticles and gel substrate using SEM, 5 μL of silver particle solution was dropped onto a silicon wafer and allowed to dry. The prepared AG hydrogel (made by adding 0.1 g of AG to 20 mL of aqueous solution, stirring evenly, microwaving for 60 s, and then transferring the solution to a mold to cool and solidify) and AG-Ag hydrogel patch were placed in ultrapure water to swell and desalt for 12 h, then frozen in a -20 °C freezer for 5 h, and then freeze-dried in a freeze dryer for 12 h before scanning electron microscopy imaging.

[0055] The results are as follows Figure 2 As shown, Figure 2Image a shows the actual silver particle solution, which is silvery-white; image b is the absorption spectrum, showing an absorption peak at 426 nm for the prepared silver particles; image c is the morphology of the silver particles characterized by SEM, showing that the prepared silver particles are spherical, uniform in size, and approximately 80 nm in diameter; images d and e are actual images of the AG hydrogel before and after gelation, showing a colorless and transparent state; image f is the morphology of the AG hydrogel characterized by SEM, showing a network structure; images g and h are actual images of the AG-Ag hydrogel patch before and after gelation, showing a silvery-white and transparent state; image i is the morphology of the AG-Ag hydrogel patch characterized by SEM, showing a network structure with obvious particles at the cross-linking points.

[0056] 2) Optimization of sensing parameters for flexible hydrogel SERS sensing patches

[0057] To obtain optimal experimental conditions, the experimental methods and parameters were optimized.

[0058] Different concentrations of Ag particles embedded in the hydrogel result in different amounts of chains that can be modified to participate in the reaction. To embed as many Ag particles as possible into the hydrogel to obtain optimal performance, the detection performance of AG-Ag hydrogels prepared with different concentrations of Ag particles was experimentally studied. Specifically, the initial silver nanoparticle colloidal solution prepared in Example 1 was concentrated to 2 times its original concentration, and diluted by 2, 3, 5, and 10 times. 10 mL of aqueous solution was mixed with 10 mL of Ag solution of different concentrations, and 0.1 g of AG was added to the mixture and stirred until homogeneous. The mixture was microwaved for 60 s to dissolve the agarose, cooled, and solidified into a gel to prepare different AG-Ag hydrogel flexible patches. 20 μL of 1 mM DTNB solution was added to the patches for incubation, and four regions of each sample were selected for SERS detection.

[0059] Figure 3 The smaller image (a) shows the 1331 cm⁻¹ region in the detected spectrum. -1 The bar chart of signal intensity values ​​shows that the SERS signal increases with the increase of Ag particle concentration embedded in the hydrogel. When the Ag particle concentration reaches the original concentration, the signal tends to stabilize, and the relative standard deviation of the signal intensity values ​​in the four regions is less than 7.2%, indicating that the prepared substrate has good uniformity. Based on the characterization structure, the original Ag particle concentration was selected for subsequent experiments.

[0060] Since the prepared AG-Ag hydrogel flexible patch will be used for in situ detection of target bacteria, it is desirable to incubate the SERS probe in the hydrogel water environment to facilitate subsequent one-step detection. However, the SERS probe incubated in the hydrogel water environment will also generate SERS signal. Therefore, after incubating the SERS probe on the AG-Ag hydrogel flexible patch, a comparative experiment was conducted using two methods: permeation washing and no washing.

[0061] Figure 3 The smaller image (b) shows the SERS spectra obtained using several different methods. Figure 3 The smaller image in the middle (c) shows the SERS spectrum at 1331 cm⁻¹. -1 A bar chart of signal strength values ​​at the location. Based on... Figure 3 As shown in subplots b and c, the signal intensity of the permeation-washed group was lower than that of the unwashed group, but the signal-to-noise ratio was higher. Therefore, it was chosen to incubate the SERS probe on the AG-Ag hydrogel flexible patch, followed by permeation washing, before subsequent experiments. The detection results after the reaction showed little difference between permeation washing and non-permeation washing of the bacterial solution; therefore, non-permeation washing of the bacterial solution after the reaction was chosen as the optimized experimental protocol for subsequent experiments.

[0062] Since the 5' end of the P strand that triggers the CHA signal amplification strategy is modified on the silver particle, P can only generate local CHA with the DNAH1 strand near the trigger. Therefore, the concentration ratio of (Apt-P) to DNA H1 will affect the subsequent reaction time and the output signal intensity. Figure 3 The smaller image in the middle (d) shows the comparison experiment of (Apt-P) and DNA H1 concentrations (1331 cm). -1 The signal intensity and signal-to-noise ratio (SNR) are shown in the bar chart. Both the signal and SNR change with increasing (Apt-P) to DNA H1 concentration ratio. The highest signal intensity and SNR are observed at (Apt-P) to DNA H1 concentration ratios of 1:4 and 1:5. Therefore, the reaction time for these two concentration ratios is optimized to select the optimal ratio. To obtain a suitable reaction time, a concentration of 10... 5 CFU / mL of bacteria were used to test the SERS sensor patch signal output results at different reaction times (0, 30, 60, 90, 105, 120, 135, 150 and 180 min). Figure 3 The small diagram in the middle shows C (Apt-P) :C H1 SERS spectra at different incubation times with a ratio of 1:4 (1331 cm⁻¹) -1 Signal strength value histogram, Figure 3 The small figure in the middle shows C (Apt-P) :C H1 SERS spectra at different reaction times with a ratio of 1:5 (1331 cm⁻¹)-1 A bar chart showing the signal strength values ​​at the location. From... Figure 3 As can be seen from the small image, C (Apt-P) :C H1 In the 1:4 experimental group, the signal intensity tended to stabilize after 105 minutes of co-incubation, indicating that equilibrium was reached after 105 minutes of co-incubation. Figure 3 As can be seen from the small graph, C (Apt-P) :C H1 In the 1:5 experimental group, the signal intensity tended to stabilize after 135 minutes of reaction, i.e., at a bacterial concentration of 10... 5 CFU / mL, C (Apt-P) :C H1 =1:5 groups require 135 minutes to reach equilibrium. Therefore, C is preferred. (Apt-P) :C H1 Subsequent experiments were conducted using an incubation time of 105 min and a ratio of 1:4.

[0063] 3) Capture and detection of S. aureus

[0064] The principle of the flexible hydrogel SERS sensing patch prepared in Example 1 for detecting Staphylococcus aureus is as follows: Figure 1 As shown. The prepared flexible hydrogel SERS sensing patch was used to detect S. aureus. The bacterial counting analysis of this flexible hydrogel SERS sensing patch uses the Raman signal molecule DTNB on the SERS probe as the signal source. The specific detection steps are as follows: Take 5 μL of 1×PBS containing different concentrations (10, 50, 10... 2 10 3 10 4 10 5 10 6 and 10 7 S. aureus (CFU / mL) was placed on a prepared flexible hydrogel SERS sensing patch, with a blank sample without bacteria as a control. The patch was incubated at 37℃ and 300rpm for 105 min in a small shaker. The Apt in Apt-P modified on the AgNRs in the patch recognizes bacteria. The Apt in Apt-P modified on the Ag particles in the patch binds to the target bacteria and detaches from the Ag particle surface. The remaining P chain on the silver particles hybridizes with DNA H1 on the particle surface, opening the hairpin structure of the DNA H1 chain. This triggers a CHA signal amplification reaction with the hairpin-type DNA H2 on the SERS probe, capturing the SERS probe onto the patch. The SERS signal was then collected for data analysis.

[0065] Figure 4 The smaller figure in the middle (a) shows the SERS spectra obtained after incubation of different concentrations of S. aureus for 105 min. Figure 4The smaller image (b) is the SERS spectrum at 1331 cm⁻¹ from the smaller image (a). -1 Peak intensity values ​​and the fitted linear calibration curve (working curve). It can be seen that the Raman signal intensity gradually increases with increasing *S. aureus* cell concentration; even at a *S. aureus* concentration of only 10 CFU / mL, the signal intensity is still significantly higher than that of the blank control group. For each *S. aureus* concentration in the SERS spectrum at 1331 cm⁻¹... -1 A linear fit was performed between the signal intensity at a given location and the concentration value of *S. aureus*, and the results are as follows: Figure 4 As shown in the small figure (b), the concentration of S. aureus ranged from 10 CFU / mL to 10... 7 A good linear relationship was observed between CFU / mL, i.e., I 1331 =525.8×lgC+564.2(R) 2 =0.9986). According to the definition of the limit of detection (LOD), which is that the LOD value is equal to 3σ / K (K is the slope of the working curve; σ is the relative standard deviation of the blank control group), the LOD was calculated to be 3.98 CFU / mL.

[0066] To characterize the uniformity of the sensing patch, SERS detection was performed using S. aureus at a concentration of 500 CFU / mL. After detection, SERS signals were acquired from 50 random points on the capture substrate. The results are as follows: Figure 5 As shown. Figure 5 The smaller image (b) shows the SERS spectrum at 1331 cm⁻¹. -1 Signal strength value histogram, 50 points, 1331cm -1 The SERS intensity value showed little variation, with a relative standard deviation (RSD) of 8.18%, indicating that the SERS sensing patch has good uniformity.

[0067] Repeatability is another important indicator of detection reliability. To characterize the repeatability of SERS analysis, the experiment investigated repeatability by testing three different concentrations (50, 200, and 500 CFU / mL) of S. aureus. Five parallel control groups were set up for each concentration of S. aureus, and 50 different points were randomly selected from each group for SERS testing. The average SERS spectrum was obtained, and the specific results are presented in [the table below]. Figure 6 middle. Figure 6 The smaller images in the middle correspond to the SERS spectra of five parallel control groups at concentrations of 50, 200, and 500 CFU / mL S. aureus. Figure 6 The smaller image is 1331cm. -1The bar chart of SERS signal values ​​shows that the SERS signal intensity increases with increasing S. aureus concentration. The SERS signal intensity in each parallel experimental group at each concentration exhibits small relative changes, with RSDs of 1.46%, 3.27%, and 1.28%, respectively. This indicates that the SERS sensing patch has good reproducibility.

[0068] In the design of the sensor patch, the selected aptamer specifically recognizes *S. aureus*, ensuring the reliability of the detection results. To verify the detection specificity, *Pseudomonas aeruginosa*, *Escherichia coli*, and a bacterial blank sample were selected as the detection targets. Figure 7 The smaller image in the middle is 10. 5 SERS spectra corresponding to different bacterial concentrations of CFU / mL after incubation for 105 min Figure 7 The smaller image (b) shows the SERS spectrum at 1331 cm⁻¹. -1 Peak intensity histogram. The SERS spectra of *P. aeruginosa* and *E. coli* show weak signals, while the SERS signal value of *S. aureus* is significantly stronger than the other groups. This demonstrates that the sensor patch can effectively distinguish target bacteria from other bacteria, proving that the sensor patch has good detection specificity.

[0069] 4) Practicality analysis of hydrogel flexible SERS sensing patch

[0070] To investigate the practical reliability of hydrogel flexible SERS sensing patches for detecting S. aureus in wound exudate, a pigskin wound was constructed as a model for detecting wound exudate. Figure 8 The smaller image (a) shows the actual physical image of the flexible hydrogel SERS sensing patch used to detect exudate from a pigskin wound. In the experiment, wounds with a diameter of 1 cm were created on five pigskins of the same size and grown in the same environment. 10 μL of [unspecified substance] was added to the wound surface. 2 CFU / mL S. aureus solution was used to co-culture the prepared hydrogel flexible SERS sensing patch with wound exudate for 105 min at 0, 6, 12, 18, and 24 h after wound formation. Figure 8 The small image (b) shows the results of S. aureus examination of pigskin wounds at different times (1331 cm). -1 The bar chart of SERS signal intensity values ​​shows that the SERS signal intensity increases continuously over time, indicating that the hydrogel flexible SERS biosensor patch can be practically applied to the detection of trace amounts of S. aureus in wound exudate.

[0071] The above description is merely an embodiment of the present invention and does not limit the patent scope of the present invention. Any equivalent structural or procedural transformations made based on the content of the present invention's specification and drawings, or direct or indirect applications in other related technical fields, are similarly included within the patent protection scope of the present invention.

Claims

1. A hydrogel flexible SERS sensing patch, characterized in that, It is prepared by using agarose as a gel monomer material and embedding silver nanoparticles through physical mixing to obtain Ag-AG hydrogel patch. Then, Apt-P recognition probe and hairpin DNA H1 are jointly modified onto silver nanoparticles, and SERS probe is further loaded onto the hydrogel patch to finally obtain the final product. The SERS probe was prepared by modifying the surface of gold nanoparticles with hairpin DNA H2 and Raman molecules; Apt is capable of specific identification S.aureus The nucleic acid aptamer, P, is a DNA single strand that is partially complementary to Apt. Apt and P hybridize to form the Apt-P recognition probe. The nucleic acid sequence of Apt is shown in SEQ ID NO: 1: 5'-TTTTTTGCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA-3'; The nucleic acid sequence of P is shown in SEQ ID NO: 2: 5'-SH-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCCTAAGCTTAGCAAAGTAGCGTGCACTGCT-3'; The nucleic acid sequence of the hairpin DNA single-stranded H1 is shown in SEQ ID NO: 3: 5'-SH-TTTTTTGTGCACGCTACTTTGCTAAGCCGTGCACAACTAGCGCTTAGCAAAGTAG-3'; The nucleic acid sequence of the hairpin DNA single-stranded H2 is shown in SEQ ID NO: 4: 5'-GCTAAGCGCTAGTTGTGCACGGCTTAGCAAAGTTCCGTGCACAACTAGCACCGGGCAGAGCACTTTTTT-SH-3'.

2. The method for preparing a hydrogel flexible SERS sensing patch as described in claim 1, characterized in that, Includes the following steps: 1) Mix AgNO3 solution with ultrapure water and heat to boiling. While boiling, add sodium citrate solution to the boiling liquid and continue heating until the liquid color changes from colorless to yellow-green. Cool and filter to obtain silver nanoparticle solution. 2) Mix the aqueous solution and the silver nanoparticle solution obtained in step 1) in equal volumes, add agarose, heat to dissolve the agarose, transfer to a mold and cool to form a gel, to obtain Ag-AG hydrogel flexible patch; 3) After annealing the hairpin DNA H2, it was mixed with tris(2-carboxyethyl)phosphine for activation. The activated DNA H2 was mixed with buffer, and gold nanoparticles were added into the mixture for reaction. NaCl was added in small amounts several times for aging. Raman molecules were added for incubation. After centrifugation and washing, the precipitate was dispersed in buffer to obtain the SERS probe. 4) Mix the Apt-P double-stranded solution and the hairpin DNA H1 chain solution and add them to the Ag-AG hydrogel flexible patch prepared in step 2). Incubate to modify the Apt-P recognition probe and hairpin DNA H1 onto the surface of Ag nanoparticles. Wash and set aside for use. 5) Add the SERS probe prepared in step 3) to the hydrogel patch obtained in step 4), incubate, and wash to remove the unloaded SERS probe to obtain a flexible hydrogel SERS sensing patch.

3. The method for preparing a hydrogel flexible SERS sensing patch as described in claim 2, characterized in that, In step 1), the volume ratio of AgNO3 solution to ultrapure water is 1:5-1:20, the concentration of AgNO3 solution is 5-20 mM, the mass concentration of sodium citrate solution is 0.5%-2%, and the volume ratio of sodium citrate solution to AgNO3 solution is 1:2.5-1:

10.

4. The method for preparing a hydrogel flexible SERS sensing patch as described in claim 2, characterized in that, In step 3), the molar ratio of hairpin DNA H2 to tris(2-carboxyethyl)phosphine is 1:200-1:1000, and the activation process is carried out at 20-40°C and 50-500 rpm for 4-12 h; the molar ratio of DNA H2 to gold nanoparticles is 300:1-800:1, and the reaction conditions after adding gold nanoparticles to the activated DNA H2 are 20-40°C and 50-500 rpm for 8-16 h; the aging reaction conditions are 20-40°C and 50-500 rpm for 6-12 h; and the molar ratio of Raman molecules to gold nanoparticles is 700:1-2000:

1.

5. The method for preparing a hydrogel flexible SERS sensing patch as described in claim 2, characterized in that, In step 3), the diameter of the gold nanoparticles is 10-30 nm, and the Raman molecule is an organic molecule containing a thiol group, selected from any one of 4-mercaptobenzoic acid, 5,5'-dithio-bis-(2-nitrobenzoic acid), and 2-mercaptobenzothiazole.

6. The method for preparing a hydrogel flexible SERS sensing patch as described in claim 2, characterized in that, In step 4), the molar concentration ratio of the Apt-P double-stranded solution and the hairpin DNA H1 chain solution is 1:4, and the incubation time is 8-16 hours.

7. The method for preparing a hydrogel flexible SERS sensing patch as described in claim 2, characterized in that, In step 5), the incubation environment is 20-40°C, 50-500 rpm, and the constant temperature incubation time is 4-8 h.

8. The application of the hydrogel flexible SERS sensing patch as described in claim 1 in bacterial detection, characterized in that, This hydrogel flexible SERS sensing patch is suitable for concentrations from 10 CFU / mL to 10 7 CFU / mL S.aureus It exhibits a linear response, that is I 1331 =525.8×lg C +564.2, R 2 =0.9986, and the limit of detection (LOD) is 3.98 CFU / mL.

9. The application of the hydrogel flexible SERS sensing patch as described in claim 1 in bacterial detection, characterized in that, The hydrogel flexible SERS sensor patch can be applied to wounds on the skin surface to detect the presence of SERS in wound exudate. S.aureus .

Images