Metal-enhanced fluorescent probe and preparation method and detection method thereof
Patent Information
- Application Number
- CN202211195211.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-09-28
- Publication Date
- 2026-09-11
- Estimated Expiration
- 2042-09-28
AI Technical Summary
[0005]针对上述问题,本公开提供了一种金属增强荧光探针及其制备方法、检测方法,用于至少部分解决传统检测方法无法实现快速检测同时满足高灵敏度要求等技术问题
[0023] This disclosure discloses a metal-enhanced fluorescent probe and its preparation and detection methods. By using adjacent-site ligation technology, two nucleic acid aptamers of the novel coronavirus nucleocapsid protein (N protein) are modified onto the surface of gold nanomaterials, constructing a metal-enhanced fluorescent probe that selectively recognizes the N protein. This probe can highly sensitively acquire the fluorescence response signal of the N protein, and achieve rapid detection of the novel coronavirus based on the relative intensity of the fluorescence signal. The detection process for the novel coronavirus only takes 2-3 minutes, and the sensitivity is comparable to nucleic acid detection, making it suitable for rapid screening of the novel coronavirus from saliva samples, environmental samples, and object surfaces.
Smart Images

Figure CN117783518B_ABST
Abstract
Description
Technical Field
[0001] This disclosure relates to the field of biochemical analysis technology, specifically to a metal-enhanced fluorescent probe and its preparation and detection methods. Background Technology
[0002] Nucleic acid-based analyses, such as quantitative reverse transcription polymerase chain reaction (qRT-PCR), are considered the gold standard for clinical diagnosis of SARS-CoV-2 infection. However, qRT-PCR requires complex extraction and amplification procedures, which increases detection time (>2 hours), making it impossible to perform tests immediately. While immune-based antigen detection methods can achieve rapid detection, they typically have only 60-90% accuracy and low sensitivity, posing a risk of false negatives for low-abundance antigen proteins.
[0003] Therefore, the biggest challenge currently facing COVID-19 testing is twofold: firstly, while nucleic acid testing is highly sensitive, it takes approximately 2-4 hours, making real-time results impossible; secondly, while antigen testing can be completed quickly and in real-time (within 5 minutes), its low sensitivity poses a risk of false negatives for low-abundance antigen proteins. Therefore, developing a new testing method that combines the advantages of rapid real-time antigen detection with the high sensitivity requirements of nucleic acid testing, while avoiding false negatives, would be crucial for achieving the goal of dynamic zero-COVID. Summary of the Invention
[0004] (a) Technical problems to be solved
[0005] To address the aforementioned issues, this disclosure provides a metal-enhanced fluorescent probe, its preparation method, and a detection method thereof, which at least partially solves the technical problems that traditional detection methods cannot achieve rapid detection while meeting high sensitivity requirements.
[0006] (II) Technical Solution
[0007] This disclosure provides a metal-enhanced fluorescent probe for the detection of the novel coronavirus, comprising: a gold nanomaterial; a nucleic acid aptamer of the nucleocapsid protein of the novel coronavirus, the nucleic acid aptamer including a first aptamer and a second aptamer, the first aptamer and the second aptamer being at least partially complementary, and their complementary portions being completely hybridized; the first aptamer being immobilized on the surface of the gold nanomaterial; and a fluorescent group labeled on the first aptamer.
[0008] Furthermore, the first aptamer includes a first recognition unit that binds to the nucleocapsid protein of the novel coronavirus, and the second aptamer includes a second recognition unit that binds to the nucleocapsid protein of the novel coronavirus; the first recognition unit and the second recognition unit bind to different positions of the nucleocapsid protein of the novel coronavirus, so that the first aptamer and the second aptamer bind to the nucleocapsid protein of the novel coronavirus to form a closed-loop conformation.
[0009] Furthermore, the first aptamer also includes an anchoring sequence and a complementary sequence; the second aptamer also includes a complementary sequence.
[0010] Furthermore, the nucleotide sequence of the first aptamer is shown in Sequence 1, and the nucleotide sequence of the second aptamer is shown in Sequence 2.
[0011] Sequence 1: <![CDATA[ FAM- GCTGGATGTCGCTTACGACAATATTCCTTAGGGGCACCGCTACATTGACACATCCAGCGTCGTGGGTCTAAAAAAAAAA ]]> Sequence 2: <![CDATA[ AGACCCACGACTGGATGTCACCGGATTGTCGGACATCGGATTGTCTGAGTCATATGACACATCCAGC ]]>
[0012] Furthermore, the 3′ end of the first aptamer is fixed to the surface of the gold nanomaterial.
[0013] Furthermore, the molar ratio of nucleic acid aptamers to gold nanomaterials is 50:1 to 20:1.
[0014] Furthermore, gold nanomaterials include one or more of gold nanoframeworks, gold triangles, and gold cubes.
[0015] Another aspect of this disclosure provides a method for preparing a metal-enhanced fluorescent probe, comprising: S11, preparing an aqueous solution of gold nanomaterials; S12, sequentially adding a first aptamer and a second aptamer to the aqueous solution, thereby immobilizing the first aptamer on the surface of the gold nanomaterials to obtain a complex; wherein the first aptamer and the second aptamer are nucleic acid aptamers of the nucleocapsid protein of the novel coronavirus, the first aptamer and the second aptamer are at least partially complementary, and their complementary portions are completely hybridized; the first aptamer is labeled with a fluorescent group; S13, incubating the complex at room temperature, centrifuging and washing to obtain a metal-enhanced fluorescent probe.
[0016] Further, S11 includes: S111, heating the tetrachloroauric acid solution under vigorous stirring and refluxing, adding sodium citrate solution to the boiling tetrachloroauric acid solution to obtain a mixture; S112, refluxing the mixture, stopping heating but continuing stirring; S113, after the mixture cools to room temperature, filtering it through a membrane filter to obtain an aqueous solution of gold nanomaterials.
[0017] Furthermore, prior to S12, the process also includes: labeling the fluorescent group at the 5' end of the first aptamer by chemical synthesis.
[0018] This disclosure also provides a method for preparing a metal-enhanced fluorescent probe, comprising: S21, preparing an aqueous solution of gold nanomaterials; S22, dissolving a first aptamer and a second aptamer in a phosphate buffer solution, heating and maintaining the solution in a metal bath, and then restoring the temperature to room temperature to obtain a mixed solution; wherein the first aptamer and the second aptamer are nucleic acid aptamers of the nucleocapsid protein of the novel coronavirus, the first aptamer and the second aptamer are at least partially complementary, and their complementary parts are completely hybridized; the first aptamer is labeled with a fluorescent group; S23, adding the mixed solution to the aqueous solution of gold nanomaterials to immobilize the first aptamer on the surface of the gold nanomaterials to obtain a complex; S24, incubating the complex at room temperature, centrifuging and washing to obtain a metal-enhanced fluorescent probe.
[0019] Further, S21 includes: S211, heating the tetrachloroauric acid solution under vigorous stirring and refluxing, adding sodium citrate solution to the boiling tetrachloroauric acid solution to obtain a mixture; S212, refluxing the mixture, stopping heating but continuing stirring; S213, after the mixture cools to room temperature, filtering it through a membrane filter to obtain an aqueous solution of the gold nanomaterial.
[0020] Furthermore, S2 heats the solution in a metal bath at a temperature range of 90~95°C.
[0021] This disclosure also provides a method for detecting the novel coronavirus using the aforementioned metal-enhanced fluorescent probe, for detecting saliva samples, comprising: S31, collecting a saliva sample and centrifuging the saliva sample at room temperature; S32, mixing the metal-enhanced fluorescent probe with the centrifuged saliva sample and incubating at room temperature; wherein the ratio of the metal-enhanced fluorescent probe to the saliva sample is 10:1 to 20:1; S33, detecting the fluorescence intensity and calculating the concentration of the novel coronavirus nucleocapsid protein based on the fluorescence intensity.
[0022] (III) Beneficial Effects
[0023] This disclosure discloses a metal-enhanced fluorescent probe and its preparation and detection methods. By using adjacent-site ligation technology, two nucleic acid aptamers of the novel coronavirus nucleocapsid protein (N protein) are modified onto the surface of gold nanomaterials, constructing a metal-enhanced fluorescent probe that selectively recognizes the N protein. This probe can highly sensitively acquire the fluorescence response signal of the N protein, and achieve rapid detection of the novel coronavirus based on the relative intensity of the fluorescence signal. The detection process for the novel coronavirus only takes 2-3 minutes, and the sensitivity is comparable to nucleic acid detection, making it suitable for rapid screening of the novel coronavirus from saliva samples, environmental samples, and object surfaces. Attached Figure Description
[0024] Figure 1A schematic diagram of a binding-induced metal-enhanced fluorescent probe for N protein detection according to an embodiment of the present disclosure is shown.
[0025] Figure 2 This schematically illustrates a comparison of the UV-Vis absorption spectra, dynamic light scattering, and Zeta potential before and after nucleic acid aptamer modification of gold nanomaterials according to embodiments of this disclosure.
[0026] Figure 3 The fluorescence emission spectra of Apt-1 in different mixing systems according to embodiments of the present disclosure are illustrated schematically.
[0027] Figure 4 This illustration schematically demonstrates the mechanism by which an electrochemical analysis method is used to support the detection of a metal-enhanced fluorescent probe for N protein, according to embodiments of this disclosure.
[0028] Figure 5 This schematic diagram illustrates the results of detecting the concentration of N protein in phosphate buffer using two different probe analysis methods according to embodiments of this disclosure.
[0029] Figure 6 The illustration shows a schematic diagram of the results of using a binding-induced metal-enhanced fluorescent probe for the detection of N protein in saliva according to an embodiment of the present disclosure. Detailed Implementation
[0030] To make the objectives, technical solutions, and advantages of this disclosure clearer, the following detailed description is provided in conjunction with specific embodiments and the accompanying drawings.
[0031] The terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit this disclosure. The terms “comprising,” “including,” etc., as used herein indicate the presence of the stated features, steps, operations, and / or components, but do not exclude the presence or addition of one or more other features, steps, operations, or components.
[0032] To balance the sensitivity and speed of novel coronavirus detection and achieve accurate detection of extremely low levels of antigen, this disclosure establishes a novel method for analyzing the nucleocapsid protein (N protein) of the novel coronavirus antigen with sensitivity comparable to nucleic acid detection.
[0033] This disclosure provides a metal-enhanced fluorescent probe for the detection of the novel coronavirus. Please refer to [link to relevant documentation]. Figure 1 The invention includes: gold nanomaterials; nucleic acid aptamers of the nucleocapsid protein of the novel coronavirus, the nucleic acid aptamers including a first aptamer (Apt-1) and a second aptamer (Apt-2), the first aptamer and the second aptamer being at least partially complementary, and their complementary portions being completely hybridized; the first aptamer being immobilized on the surface of the gold nanomaterials; and a fluorescent group labeled on the first aptamer.
[0034] A metal-enhanced fluorescent probe for detecting the N protein of the novel coronavirus was synthesized by modifying the surface of gold nanomaterials with two nucleic acid aptamers. Single nucleic acid aptamers have low sensitivity, while using two aptamers significantly improves sensitivity and selectivity. The first and second aptamers interact, binding the two nucleic acid chains to form a Y-shaped recognition unit similar to one closely adhering to the surface of the gold nanomaterials. Both aptamers simultaneously bind to the N protein, recognizing the target substance, N protein. The first and second aptamers form a closed-loop conformation with the N protein, moving away from the surface of the gold nanomaterials. This causes the fluorescein (FAM) on the first aptamer to also move away from the gold nanoparticle carrier surface, resulting in enhanced fluorescence. Therefore, this metal-enhanced fluorescent probe can selectively and sensitively acquire the fluorescence response signal of the N protein, enabling rapid detection of the novel coronavirus through the relative intensity of the fluorescence signal.
[0035] Based on the above embodiments, the first aptamer includes a first recognition unit that binds to the nucleocapsid protein of the novel coronavirus, and the second aptamer includes a second recognition unit that binds to the nucleocapsid protein of the novel coronavirus; the first recognition unit and the second recognition unit bind to different positions of the nucleocapsid protein of the novel coronavirus, so that the first aptamer and the second aptamer bind to the nucleocapsid protein of the novel coronavirus to form a closed-loop conformation.
[0036] The first aptamer includes an anchoring sequence, a complementary sequence, and a first recognition unit, while the second aptamer includes a complementary sequence and a second recognition unit. Specifically, the anchoring sequence of the first aptamer binds to the gold nanomaterial; the complementary sequence of the first aptamer completely hybridizes with the complementary sequence of the second aptamer; and the first recognition unit of the first aptamer and the second recognition unit of the second aptamer simultaneously bind to the N protein, forming a sandwich-like closed-loop structure.
[0037] Based on the above embodiments, the nucleotide sequence of the first aptamer is shown in Sequence 1, and the nucleotide sequence of the second aptamer is shown in Sequence 2.
[0038] name Sequence (5'-to-3') Sequence 1: <![CDATA[ FAM- GCTGGATGTCGCTTACGACAATATTCCTTAGGGGCACCGCTACATTGACACATCCAGCGTCGTGGGTCTAAAAAAAAAA ]]> Sequence 2: <![CDATA[ AGACCCACGACTGGATGTCACCGGATTGTCGGACATCGGATTGTCTGAGTCATATGACACATCCAGC ]]>
[0039] The 3′ end of the first aptamer is fixed to the surface of the gold nanomaterial, while the second aptamer does not directly bind to the gold nanomaterial. In sufficient quantities, the polyA at the 3′ end of the first aptamer preferentially binds to gold, and the second aptamer partially hybridizes with the first aptamer, resulting in a large amount of polyA binding to the gold surface. Specifically, the special structure of polyA allows for stable binding between the two to the gold nanomaterial through gold-N bonds, hydrogen bonds, and intermolecular forces.
[0040] Based on the above embodiments, the molar ratio of nucleic acid aptamers to gold nanomaterials is 50:1 to 20:1.
[0041] By estimating the required aptamer density on the surface of different gold nanomaterials and adding an excess of aptamers to ensure complete coverage of the gold nanomaterial surface, the aforementioned molar ratio range was obtained. Preferably, gold nanoparticles are used as the carrier, and the molar ratio of aptamers to gold nanomaterials is 20:1.
[0042] Based on the above embodiments, gold nanomaterials include one or more of gold nanoframeworks, gold triangles, and gold cubes.
[0043] The surface plasmon resonance effect of gold nanomaterials can affect the effect of metal-enhanced fluorescence. The gold nanomaterials disclosed herein may include a variety of structures. In addition to the three gold nanostructures mentioned above, other feasible gold nanostructures may also be applied to the methods disclosed herein.
[0044] This disclosure also provides a method for preparing a metal-enhanced fluorescent probe, comprising: S11, preparing an aqueous solution of gold nanomaterials; S12, sequentially adding a first aptamer and a second aptamer to the aqueous solution, thereby immobilizing the first aptamer on the surface of the gold nanomaterials to obtain a complex; wherein the first aptamer and the second aptamer are nucleic acid aptamers of the nucleocapsid protein of the novel coronavirus, and the first aptamer and the second aptamer are at least partially complementary, with their complementary portions completely hybridizing; the first aptamer is labeled with a fluorescent group; S13, incubating the complex at room temperature, centrifuging and washing to obtain a metal-enhanced fluorescent probe.
[0045] The first method for preparing a metal-enhanced fluorescent probe involves: first adding Apt-1 to an aqueous solution of gold nanomaterials. Apt-1 interacts with the gold nanomaterials, and the Poly A aptamer of the first aptamer binds tightly to the gold nanoparticles. Then, immediately afterward, Apt-2 is added to the aqueous solution of the gold nanomaterials. At this point, the sequences of Apt-2 and the complementary regions of Apt-1 completely hybridize. Before adding the first aptamer, the fluorescent group is already bound to it via chemical modification. The fluorophore FAM is chemically labeled at the 5' end of the first aptamer. The purpose of incubating the complex is to ensure complete hybridization of the complementary sequences of the aptamers.
[0046] Based on the above embodiments, S11 includes: S111, heating the tetrachloroauric acid solution under vigorous stirring and refluxing, adding sodium citrate solution to the boiling tetrachloroauric acid solution to obtain a mixture; S112, refluxing the mixture, stopping heating but continuing stirring; S113, after the mixture cools to room temperature, filtering it through a membrane filter to obtain an aqueous solution of gold nanomaterials.
[0047] The method for preparing aqueous solutions of gold nanomaterials employs the sodium citrate reduction method. After the reaction of tetrachloroauric acid with sodium citrate is completed, a membrane filter is used to remove excess inorganic salt impurities. The gold nanomaterials obtained by this preparation method have the characteristics of good dispersibility and uniform particle size.
[0048] This disclosure also provides another method for preparing a metal-enhanced fluorescent probe, comprising: S21, preparing an aqueous solution of gold nanomaterials; S22, dissolving a first aptamer and a second aptamer in a phosphate buffer solution, heating and maintaining the solution in a metal bath, and then restoring the temperature to room temperature to obtain a mixed solution; wherein the first aptamer and the second aptamer are nucleic acid aptamers of the nucleocapsid protein of the novel coronavirus, the first aptamer and the second aptamer are at least partially complementary, and their complementary parts are completely hybridized; the first aptamer is labeled with a fluorescent group; S23, adding the mixed solution to the aqueous solution of gold nanomaterials to immobilize the first aptamer on the surface of the gold nanomaterials to obtain a complex; S24, incubating the complex at room temperature, centrifuging and washing to obtain a metal-enhanced fluorescent probe.
[0049] The second method for preparing metal-enhanced fluorescent probes involves: first, mixing Apt-1 and Apt-2 to completely hybridize the complementary sequences of Apt-1 and Apt-2; then, adding the hybridized Apt-1 and Apt-2 to an aqueous solution of gold nanomaterials to allow Apt-1 to bind to the gold nanomaterials. This method differs from the first method in that the aptamer binding is stronger and the hybridization effect is better.
[0050] Based on the above embodiments, in S2, the temperature range for heating the solution in the metal bath is 90~95°C.
[0051] Metal baths have the advantages of rapid heating and ease of use, and are conducive to DNA hybridization within the above temperature range.
[0052] This disclosure also provides a method for detecting the novel coronavirus using the aforementioned metal-enhanced fluorescent probe, for detecting saliva samples, comprising: S31, collecting a saliva sample and centrifuging the saliva sample at room temperature; S32, mixing the metal-enhanced fluorescent probe with the centrifuged saliva sample and incubating at room temperature; wherein the ratio of the metal-enhanced fluorescent probe to the saliva sample is 10:1 to 20:1; S33, detecting the fluorescence intensity and calculating the concentration of the novel coronavirus nucleocapsid protein based on the fluorescence intensity.
[0053] When using the aforementioned metal-enhanced fluorescent probe to detect the novel coronavirus in saliva samples, the saliva sample must first be centrifuged to remove precipitates, then mixed with the metal-enhanced fluorescent probe and incubated at room temperature. Finally, the concentration of the novel coronavirus nucleocapsid protein is obtained based on the detected fluorescence intensity. It should be noted that before step S32, the metal-enhanced fluorescent probe can be further treated with bovine serum albumin to passivate excess active sites on the surface of the gold nanoparticles.
[0054] The metal-enhanced fluorescent probe disclosed herein can also be used for the detection of novel coronavirus on object surface samples. The pretreatment method for object surface samples includes smear sampling, inactivation, centrifugation, enrichment, and concentration. Subsequent detection steps are the same as S32-S33 for saliva samples described above. This detection method is simple, highly sensitive, and quick.
[0055] This disclosure constructs a metal-enhanced fluorescent probe that selectively recognizes the SARS-CoV-2 nucleocapsid protein (N protein). It can highly sensitively acquire the fluorescence response signal of the N protein and achieve rapid detection of SARS-CoV-2 in saliva samples or on object surfaces by measuring the relative intensity of the fluorescence signal. The detection process for SARS-CoV-2 using this disclosure takes only 2-3 minutes, and the sensitivity is comparable to nucleic acid detection, making it suitable for rapid screening of SARS-CoV-2 in saliva samples, environmental samples, and on object surfaces.
[0056] The present disclosure will be further described below through specific embodiments. The following embodiments specifically illustrate the above-mentioned metal-enhanced fluorescent probe and its preparation and detection methods. However, the following embodiments are merely illustrative of the present disclosure, and the scope of the present disclosure is not limited thereto.
[0057] This embodiment utilizes adjacent-site linkage technology to modify the surface of gold nanomaterials with nucleic acid aptamers, synthesizing a metal-enhanced fluorescent probe for N protein detection. The surface chemical properties of the probe are characterized, analytical testing conditions are optimized to improve detection sensitivity, a working curve for N protein standards is tested, and the detection limit and selectivity of N protein are determined by spiked saliva samples. The accuracy and precision of the method are evaluated by comparing it with a commercial N protein kit. A feasibility study demonstrates that the established method can be sensitively and reliably used for rapid screening of saliva samples. A schematic diagram of the specific detection principle is shown below. Figure 1 As shown, Figure 1 (a) shows the anchoring pattern of two nucleic acid aptamers on the surface of the gold nanoparticle; Figure 1 (b) illustrates a fluorescence detection method for the simultaneous recognition of N protein by inducing the assembly of two aptamers through binding; Figure 1 Figure (c) shows a performance comparison between nucleic acid detection and N protein antigen testing based on this method. It can be seen that the detection accuracy, detection time and detection limit of this method are all superior to the nucleic acid detection method.
[0058] Experimental steps:
[0059] 1. Synthesis of Gold Nanoparticles: Water-soluble gold nanoparticles were synthesized using the classic sodium citrate reduction method. 100 mL of 1 mM HAuCl4·4H2O solution was added to a three-necked flask and heated under reflux for 5–10 minutes with vigorous stirring. Immediately afterwards, 10 mL of 38.8 mM sodium citrate solution was added to the boiling solution, causing the color to change from pale yellow to wine red. The mixture was refluxed for 15 minutes, then heating was stopped, but stirring continued. The solution was then cooled to room temperature. After filtering through a 0.22 μm membrane filter, the solution was stored at 4°C for use. Gold nanomaterials can also include gold nanoframeworks, gold triangles, gold cubes, and other gold nanomaterials.
[0060] 2. Synthesis of Metal-Enhanced Fluorescent Probe: The first aptamer Apt-1 (20 μL, 1.0 μM) of the SARS-CoV-2 nucleocapsid protein was added to a solution of gold nanoparticles (Apt-1 / gold nanoparticle molar ratio approximately 20:1). Immediately afterward, the second aptamer Apt-2 (20 μL, 1.0 μM) was added to the complex to form a metal-enhanced fluorescence probe. The nucleotide sequences of Apt-1 and Apt-2 are shown in Table 1. After incubating the resulting complex at room temperature for 10 minutes, the probe was used to detect the target protein. This probe synthesis method is suitable for on-site detection requiring rapid detection and can also be used to prepare kits.
[0061] Table 1
[0062] name Sequence (5'-to-3') Apt-1 FAM- GCTGGATGTCGCTTACGACAATATTCCTTAGGGGCACCGCTACATTGACACATCCAGCGTCGTGGGTCTAAAAAAAAAA Apt-2 AGACCCACGACTGGATGTCACCGGATTGTCGGACATCGGATTGTCTGAGTCATATGACACATCCAGC Apt-3 Fer-GCTGGATGTCGCTTACGACAATATTCCTTAGGGGCACCGCTACATTGACACATCCAGCGTCGTGGGTCTAAAAAAAAAA-SH Apt-4 FAM- GGGGTTGGTTGTGTTGGGTGTTGTGTGTCGTGGGTCTAAAAAAAAAA Apt-5 AGACCCACGACCCGCCCAAATCCCTAAGAGAAGACTGTAATGACATCAAACCAGACACACTACACACGCA
[0063] For laboratory testing, probes can be prepared using the following method: Aptamers Apt-1 (20 µL, 1.0 µM) and Apt-2 (20 µL, 1.0 μM) are dissolved in phosphate buffered saline (PBS, pH 7.4, 10 mM). The solution is heated to 95°C in a metal bath and held for 10 minutes, then allowed to return to room temperature. Next, the above solution is added to a gold nanoparticle solution (aptamer / gold nanoparticle molar ratio of 20:1), and the mixture is incubated at room temperature for another 10 minutes. This probe preparation method ensures complete hybridization of the complementary sequences of the two aptamers. Finally, the mixture is centrifuged and washed three times with phosphate buffered saline. The resulting binding-induced metal-enhanced fluorescent probe can be used to analyze the SARS-CoV-2 antigen N protein. For saliva sample detection, the mixture is further treated with bovine serum albumin (BSA) (w / v, 0.5%) at 37°C for 10 minutes to passivate excess active sites on the gold nanoparticle surface. This method reduces non-specific adsorption of non-target substances.
[0064] 3. Characterization of the probe: The synthesized metal-enhanced fluorescent probe was characterized using UV-Vis absorption spectroscopy, dynamic light scattering, and Zeta potential. Figure 2 The optical properties of gold nanoparticles before and after modification with nucleic acid aptamers were characterized by UV-Vis absorption spectroscopy, dynamic light scattering (DLS), and Zeta potential. The results showed that after functionalizing the gold nanoparticles with two aptamers, the characteristic peak of the aptamers at 260 nm significantly increased. Furthermore, DLS experiments indicated that the average hydrodynamic size increased by approximately 8–10 nm after functionalizing the surface of the gold nanoparticles with two aptamers. Additionally, Zeta potential analysis showed that the metal-enhanced fluorescent probe exhibited a more negative Zeta potential (-45.8 mV) compared to the unmodified gold nanoparticles (-23.8 mV). These results further confirm the successful synthesis of the probe.
[0065] 4. Feasibility Analysis: To verify the feasibility of using the designed probe for N protein analysis, the fluorescence spectra of Apt-1 in different mixed systems were tested (100 nM). Phosphate-buffered saline (PBS, 10 mM) containing 40 pg / mL N protein was used as the target protein. The designed probe was incubated with N protein at room temperature for 3 minutes. The fluorescence intensities of pure FAM-Apt-1, Au+FAM-Apt-1, Au+FAM-Apt-1+Apt-2, Au+FAM-Apt-1+Apt-2+N protein, and Au+FAM-Apt-1+N protein were then recorded. Figure 3 As shown, the fluorescence emission spectra of Apt-1 (λem = 524 nm) in the presence of different mixtures were tested. Naked FAM-labeled Apt-1 showed negligible fluorescence intensity. Apt-2 partially hybridized with Apt-1, forming a stable partially hybridized FAM-Apt-1 / Apt-2 double strand, immobilized on the AuNP surface. Due to the unique optical property of gold nanoparticles enhancing FAM fluorescence, the fluorescence was slightly enhanced compared to Apt-1-modified AuNP. This indicates that without N protein, binding-induced DNA assembly is inactive. With the addition of N protein, the binding of N protein to Apt-1 and Apt-2 enables the two aptamers to recognize the protein by forming a closed-loop conformation. The fluorescence of the mixture increased significantly, almost doubling. This is because, in the absence of Apt-2, no binding-induced DNA assembly occurred (green curve).
[0066] 5. Electrochemical analysis further validated the feasibility of the probe: Two aptamers of the N protein were modified onto the gold working electrode using a method similar to that reported in conventional studies. Ferrocene was conjugated to the 5′ end of Apt-1 (Fer-Apt-1-SH, abbreviated as Apt-3, the nucleotide sequence of Apt-3 is shown in Table 1), and then partially hybridized with Apt-2. Before modification onto the gold electrode, the resulting partially hybridized aptamer was reduced in 10 mM TCEP solution (0.02 mM) for 1 hour to cleave disulfide bonds. The solution was then diluted in HEPES buffer to achieve the desired aptamer concentration (approximately 0.5–8 μM). For aptamer immobilization, the gold electrode was kept in the thiolized aptamer solution at 4°C in the dark for 16 hours. The electrode surface was then passivated by incubation in 3 mM MCH solution for 1 hour. Changes in the redox current of the system were measured using differential pulse voltammetry. The binding of the N protein leads to a closed-loop conformation between the two aptamers and the N protein, reducing the electron transfer efficiency from the ferrocene to the gold electrode. Figure 4 illustrates the mechanism of metal-enhanced fluorescence probes for N protein detection using electrochemical analysis. Figure 4(a) shows the assembly and electron transfer pathway of the aptamer on the gold electrode surface; Figure 4(b) shows the change in current before and after N protein binding, measured using differential pulse voltammetry. These results indicate that target-binding-induced aptamer assembly alters the distance between the redox-labeled ferrocene and the gold electrode. This further demonstrates that the distance from the aptamer to the gold nanoparticles changes before and after N protein binding to the probe. Electrochemical analysis supports the feasibility of metal-enhanced fluorescence.
[0067] 6. Detection of N protein in phosphate buffer: In the N protein detection step, the previously synthesized metal-enhanced fluorescent probe was reacted with different concentrations of N protein (0.5 pg / mL) in 10 μL of phosphate buffer. -1 Up to 0.1 ng mL -1 Incubate at room temperature for 3 minutes, then dilute with deionized water to a total volume of 200 μL. Transfer the mixture to a 96-well plate and perform fluorescence spectroscopy using a microplate reader. Each group of measurements is performed in triplicate.
[0068] 7. Probe Performance Comparison: Using the gold nanoparticle probe modified with aptamer Apt-1 as a reference, the performance of gold nanoparticle probes simultaneously modified with Apt-1 and Apt-2 was compared. Figure 5 As shown, probes without Apt-2 involvement are less sensitive than the binding-induced metal-enhanced fluorescent probes described above. Figure 5 Figure (a) shows that only Apt-1 modified gold nanoparticle probes at 0.5 pg mL -1 Up to 0.1 ng mL -1 The fluorescence intensity of the N protein sensing system. For example... Figure 5 As shown in (b), the fluorescence intensity at 524 nm exhibits a very poor linear correlation with the N protein concentration. In contrast, as... Figure 5 As shown in (c), the fluorescence intensity of the metal-enhanced fluorescent probe at 524 nm is linearly correlated with the N protein concentration. This is because the synergistic effect of two aptamers simultaneously targeting the N protein, compared to one aptamer, helps improve sensitivity. In the presence of Apt-2, the recognition rate of the N protein by the binding-induced assembly of two aptamers is higher than that of the gold nanoparticle probe modified only by Apt-1. This result strongly validates the feasibility of N protein profiling. The linear equation is F = 2.35C + 132.25, and the correlation coefficient (R²) is [missing value]. 2 The value is 0.985, such as Figure 5 As shown in Figure (d), where the C-axis represents the concentration of N protein in PBS, and the ordinate FL represents the fluorescence intensity of FAM at 524 nm. Based on 3σ / k (σ, standard deviation of the blank sample; k, slope of the standard curve), the limit of detection (LOD) for N protein was calculated to be approximately 190 fg / mL. -1 .
[0069] 8. Detection of N protein in saliva samples: The clinical applicability of the probe was further investigated by analyzing N protein in human saliva using a standard curve constructed in phosphate buffer solution. Healthy saliva samples were collected from the oral cavity of volunteers who had abstained from food or water for 2 hours prior to collection. After centrifugation at 12,000 rpm at room temperature for approximately 5 minutes, the precipitate was removed, and the supernatant was stored at −20°C for further use. The selectivity of the probe for other non-target proteins (bovine serum albumin, lysozyme, chicken ovalbumin, myoglobin, cytochrome C, interferon, and SARS-CoV-2 spike protein S1) was first evaluated, with a N protein concentration of 80 pg / mL. -1 The concentration of the SARS-CoV-2 spike protein was 4.0 μg / ml. -1 The concentration of the remaining proteins was 1.0 μg / ml. -1 . Figure 6 Figures (a) and (b) illustrate the detection selectivity of the metal-enhanced fluorescent probe. The designed binding-induced metal-enhanced fluorescent probe exhibits excellent selectivity for N protein. Then, different concentrations of N protein (0.4, 0.8, 1.6, 2, 4, 8, 16, 20, 40 pg / mL) were spiked using a spiking method. -1 The probe was added to diluted saliva. The fluorescence response of the probe to saliva diluted with N protein was then evaluated. The probe was incubated with the saliva mixture at room temperature for 5 minutes. Figure 6 Figures (c) and (d) show the sensitivity and linearity of the metal-enhanced fluorescent probe. Figure 6 Image (c) shows that the intensity of the fluorescence emission peak of FAM increases with increasing N protein concentration. Figure 6 Figure (d) shows the linear correlation between fluorescence intensity and N protein concentration. The linear equation is F = 18.80C + 52.83, and the correlation coefficient (R²) is [missing value]. 2 The value was 0.974, where the x-axis C represents the concentration of N protein added to the saliva, and the y-axis FL represents the fluorescence intensity of FAM at 524 nm. Based on 3σ / k, the limit of detection (LoD) for N protein was calculated to be approximately 150 fg / mL. -1 (Equivalent to 180 copies / mL).
[0070] 9. Validation of the method's universality: By replacing the nucleic acid aptamers, the method can detect other biomolecules. For example, by replacing the two aptamers with Apt-4 and Apt-5 (the nucleotide sequences of Apt-4 and Apt-5 are shown in Table 1), a metal-enhanced fluorescence probe can be designed to detect interferon-γ. The specific detection steps and methods are the same as described above, only the target substance and the aptamers used for detection are changed.
[0071] 10. This method can also be used to collect samples from object surfaces, focusing on untreated surfaces such as express delivery packaging, elevator buttons, door handles, faucets, and switches. After inactivation, the samples are centrifuged and concentrated. The pretreated surface samples are then interacted with a metal-enhanced fluorescent probe to determine the detection curve. Based on the relative intensity of the fluorescence response signal, the negative and positive thresholds for the probe's response to N protein are determined. Negative / positive control samples from commercially available N protein antigen kits are used as negative / positive control samples for this method, enabling the detection of N protein in key environmental samples such as express delivery packaging surfaces.
[0072] This disclosure presents a method for the direct detection of SARS-CoV-2 nucleocapsid protein based on binding-induced metal-enhanced fluorescent probes. Utilizing binding-induced assembly of two aptamers and AuNP-induced metal-enhanced fluorescence, a highly sensitive spectral analysis of the N protein in human saliva is achieved. This addresses the pressing issue of balancing sensitivity and reporting speed in SARS-CoV-2 infection detection. Compared to other methods, this method exhibits superior performance in terms of testing time and sensitivity. The testing time (<3 minutes) is significantly faster than existing nucleic acid testing technologies such as qRT PCR (25–420 minutes), RT-LAMP (15–60 minutes), CRISPR (>20 minutes), electrochemical assays (<120 minutes), and commercial ELISA kits. The detection limit reaches 150 fg / mL. -1(Equivalent to 180 copies / mL, at least 20 times lower than the qRT-PCR assay (0.6–3.2 copies / μL) approved by the US Centers for Disease Control and Prevention (CDC) / China National Medical Products Administration (NMPA).) The concepts and strategies of this disclosed method can also be used to construct assays for other molecular targets, and it is expected to become a comprehensive tool for screening the entire population for SARS-CoV-2 infection and other epidemics such as monkeypox.
[0073] The above specific embodiments further illustrate the purpose, technical solutions and beneficial effects of this disclosure. It should be understood that the above are only specific embodiments of this disclosure and are not intended to limit this disclosure. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this disclosure should be included within the protection scope of this disclosure.
Claims
1. A metal-enhanced fluorescent probe, characterized in that, include: Gold nanomaterials; The nucleic acid aptamer for the nucleocapsid protein of the novel coronavirus includes a first aptamer and a second aptamer, wherein the first aptamer and the second aptamer are at least partially complementary, and their complementary portions completely hybridize; the first aptamer is immobilized on the surface of the gold nanomaterial. A fluorescent group is labeled on the first aptamer; The first aptamer includes a first recognition unit that binds to the nucleocapsid protein of the novel coronavirus, and the second aptamer includes a second recognition unit that binds to the nucleocapsid protein of the novel coronavirus. The first recognition unit and the second recognition unit bind to different positions of the novel coronavirus nucleocapsid protein, so that the first aptamer and the second aptamer bind to the novel coronavirus nucleocapsid protein to form a closed-loop conformation.
2. The metal-enhanced fluorescent probe according to claim 1, characterized in that, The first aptamer also includes an anchoring sequence and a complementary sequence; The second aptamer also includes a complementary sequence.
3. The metal-enhanced fluorescent probe according to claim 2, characterized in that, The nucleotide sequence of the first aptamer is shown in Sequence 1, and the nucleotide sequence of the second aptamer is shown in Sequence 2.
4. The metal-enhanced fluorescent probe according to claim 3, characterized in that, The 3' end of the first aptamer is fixed to the surface of the gold nanomaterial.
5. The metal-enhanced fluorescent probe according to claim 1, characterized in that, The molar ratio of the nucleic acid aptamer to the gold nanomaterial is 50:1 to 20:
1.
6. The metal-enhanced fluorescent probe according to claim 1, characterized in that, The gold nanomaterials include one or more of the following: gold nanoframeworks, gold triangles, and gold cubes.
7. A method for preparing a metal-enhanced fluorescent probe, characterized in that, include: S11, an aqueous solution for preparing gold nanomaterials; S12, a first aptamer and a second aptamer are sequentially added to the aqueous solution, immobilizing the first aptamer on the surface of the gold nanomaterial to obtain a complex; wherein the first aptamer and the second aptamer are nucleic acid aptamers of the novel coronavirus nucleocapsid protein, the first aptamer and the second aptamer are at least partially complementary, and their complementary portions completely hybridize; the first aptamer is labeled with a fluorescent group; wherein the first aptamer includes a first recognition unit that binds to the novel coronavirus nucleocapsid protein, and the second aptamer includes a second recognition unit that binds to the novel coronavirus nucleocapsid protein; the first recognition unit and the second recognition unit bind to different positions of the novel coronavirus nucleocapsid protein, so that the first aptamer and the second aptamer bind to the novel coronavirus nucleocapsid protein to form a closed-loop conformation; S13, the complex is incubated at room temperature, centrifuged and washed to obtain a metal-enhanced fluorescent probe.
8. The method for preparing the metal-enhanced fluorescent probe according to claim 7, characterized in that, S11 includes: S111, the tetrachloroauric acid solution is heated to reflux under vigorous stirring, and sodium citrate solution is added to the boiling tetrachloroauric acid solution to obtain a mixture; S112, reflux the mixture, stop heating but continue stirring; S113, after the mixture is cooled to room temperature, it is filtered through a membrane filter to obtain an aqueous solution of the gold nanomaterial.
9. The method for preparing the metal-enhanced fluorescent probe according to claim 7, characterized in that, Before S12, the following is also included: The fluorescent group is chemically labeled at the 5' end of the first aptamer.
10. A method for preparing a metal-enhanced fluorescent probe, characterized in that, include: S21, an aqueous solution for preparing gold nanomaterials; S22, the first aptamer and the second aptamer are dissolved in a phosphate buffer solution, the solution is heated and maintained in a metal bath, and then the temperature is restored to room temperature to obtain a mixed solution; wherein, the first aptamer and the second aptamer are nucleic acid aptamers of the novel coronavirus nucleocapsid protein, the first aptamer and the second aptamer are at least partially complementary, and their complementary portions completely hybridize; the first aptamer is labeled with a fluorescent group; wherein, the first aptamer includes a first recognition unit that binds to the novel coronavirus nucleocapsid protein, and the second aptamer includes a second recognition unit that binds to the novel coronavirus nucleocapsid protein; the first recognition unit and the second recognition unit bind to different positions of the novel coronavirus nucleocapsid protein, so that the first aptamer and the second aptamer bind to the novel coronavirus nucleocapsid protein to form a closed-loop conformation; S23, the mixed solution is added to the aqueous solution of the gold nanomaterial to fix the first aptamer on the surface of the gold nanomaterial to obtain a complex; S24. The complex is incubated at room temperature, centrifuged and washed to obtain a metal-enhanced fluorescent probe.
11. The method for preparing the metal-enhanced fluorescent probe according to claim 10, characterized in that, S21 includes: S211, the tetrachloroauric acid solution is heated to reflux under vigorous stirring, and sodium citrate solution is added to the boiling tetrachloroauric acid solution to obtain a mixture; S212, reflux the mixture, stop heating but continue stirring; S213, after the mixture is cooled to room temperature, it is filtered through a membrane filter to obtain an aqueous solution of the gold nanomaterial.
12. The method for preparing the metal-enhanced fluorescent probe according to claim 10, characterized in that, In step S2, the temperature range for heating the solution in the metal bath is 90~95℃.
13. A method for detecting the novel coronavirus using a metal-enhanced fluorescent probe according to any one of claims 1 to 6, for detecting saliva samples, characterized in that, include: S31, Collect a saliva sample and centrifuge the saliva sample at room temperature; S32, the metal-enhanced fluorescent probe is mixed with the centrifuged saliva sample and incubated at room temperature; wherein the ratio of the metal-enhanced fluorescent probe to the saliva sample is 10:1 to 20:1; S33, detect fluorescence intensity, and calculate the concentration of the novel coronavirus nucleocapsid protein based on the fluorescence intensity.