A method for in-situ humification enhancement of red mud stockyard of non-biological-biological coupling

Abstract

This invention relates to a method for in-situ humification enhancement of red mud dumps through a non-biological-biological coupling process. The method includes crushing and air-drying the red mud in the dump, followed by dealkalization treatment to obtain dealkalized red mud with a pH of 8.0-9.5; adding biomass and an alkali-tolerant acid-producing compound microbial agent, mixing them evenly, and then carrying out in-situ humification of the red mud in the dump. The dealkalized red mud maintains a moisture content of 60%-80%, and undergoes in-situ natural aerobic composting for 15-90 days. The biomass is added at an amount of 2-15% of the red mud mass. The alkali-tolerant acid-producing compound microbial agent includes at least two of Penicillium oxalate, Bacillus, and Aspergillus niger. This compound microbial agent not only synergistically promotes the decomposition of biomass in the red mud, significantly increasing the humic content, but also promotes the condensation of humic acid to form stable humic matter. Simultaneously, it promotes the growth of bacteria in the red mud that decompose organic matter and cycle carbon and nitrogen, thus facilitating the continuous enhancement of red mud humification. This method can be applied to red mud soilification and dump ecological restoration.

Description

Technical Field

[0001] This invention relates to the field of ecological restoration technology for red mud dumps, and more specifically to a method for in-situ humification enhancement of red mud dumps through abiotic-biological coupling. Background Technology

[0002] Red mud is a highly saline-alkaline solid waste produced during the alumina industrial process. It is named for its red color due to its high Fe2O3 content. The main components of red mud are generally SiO2, Al2O3, CaO, Fe2O3, and Na2O. Statistics show that 1.5 to 2.0 tons of red mud are generated for every 1 ton of alumina produced. Currently, the global red mud stockpile is approximately 5 billion tons, increasing at a rate of 200 million tons per year. However, the resource utilization of red mud is difficult, and its disposal is mainly through stockpiling, which poses a significant ecological risk to the surrounding soil and water bodies. Existing research mainly focuses on red mud dealkalization, as illustrated by patents CN 109224364A, CN 115637242A, and CN107915386A. However, red mud has a poor physical structure and is lacking in nutrients, making it difficult to soilify even after dealkalization; therefore, it is generally not suitable for direct planting.

[0003] Although patent CN111014254A, a method and system for ecological restoration of red mud using biomass, proposes a method and system for preparing red mud soil matrix by mixing biomass, water, and red mud in a high-pressure reactor for hydrothermal carbonization, the decomposition rate of biomass in red mud is relatively slow, which restricts the humification process of organic carbon in red mud. Patent CN115053659A, a method for in-situ matrix improvement and direct vegetation restoration of red mud dumps, regulates the salinity of red mud by adding wood vinegar and phosphogypsum, and then sows herbaceous plant seeds on the red mud dumps for direct vegetation restoration. However, the germination rate of herbaceous plant seeds is low. In another method, after regulating the salinity of red mud, a composite amendment made of sludge, edible fungus residue, and fish manure is prepared and applied to the red mud dump before vegetation restoration. The germination rate of herbaceous plant seeds is only 76% to 87%, and the amount of amendment required is large, making it difficult to continuously promote the in-situ matrix improvement of red mud dumps. Patent CN108841742A describes a salt-tolerant Bacillus strain ZH-1, its preparation method, and its application. Although the salt-tolerant Bacillus strain ZH-1 provided by the patent is beneficial to the formation of red mud aggregates, the pH of the red mud after dealkalization is 7.5-8.8, and the aggregates are about 50%-70%, resulting in poor soilification of the red mud. Furthermore, there is no relevant experimental data indicating that the red mud treated with this strain to reduce alkali can be directly used for planting.

[0004] Our team's previous research, such as patent CN 109224364 A, on a method for reducing the alkalinity of Bayer process red mud using Penicillium oxalate, found that combining biomass with Penicillium oxalate can lower the pH value of red mud and increase its organic matter content, promoting the formation of aggregates. However, in the process of red mud soilification, humification is a crucial step in the accumulation and fixation of organic carbon. Humification refers to the process by which fresh organic matter (mainly plant and animal remains) entering the soil is transformed into humus through biochemical or chemical reactions under the action of microorganisms. Humus is the main component of soil organic matter, generally accounting for 50-70% of the total organic matter, primarily composed of humic acid and fulvic acid.

[0005] However, red mud is highly alkaline (its pH is generally 10.5-12.0) and has a high salinity (its conductivity is generally 1.4–28.4 mS / cm). -1 The poor physical structure and lack of nutrients in red mud, coupled with low microbial activity and biodiversity, result in slow decomposition of organic solid wastes such as straw and sugarcane bagasse, hindering the formation of precursors for the humification process and impeding the humification of exogenous organic solid wastes. Furthermore, red mud's high salinity and alkalinity, along with low activity of iron and aluminum oxides, slows the catalytic efficiency of organic matter humification, affecting its ability to retain organic carbon and hindering the normal growth of herbaceous plants. Therefore, research is needed to develop an ecological restoration method that can continuously promote in-situ humification of red mud dumps, fostering humus accumulation, particularly the formation of humic and fulvic acids and the retention of organic carbon, thereby promoting red mud soilification and ultimately facilitating its resource reuse. Summary of the Invention

[0006] To address the aforementioned deficiencies or improvement needs of existing technologies, this invention provides a method for in-situ humification enhancement of red mud dumps through a non-biological-biological coupling process. The purpose is to unexpectedly discover that adding at least two compound microbial agents from Penicillium oxalate, Bacillus, and Aspergillus niger not only synergistically promotes the decomposition of biomass in red mud and significantly increases humic content, but also promotes the condensation of humic acid to form stable humic substances. Simultaneously, it promotes the growth of bacteria in red mud that decompose organic matter and cycle carbon and nitrogen, thus facilitating the continuous enhancement of red mud humification. This solves the technical problems of poor soilification effects of existing red mud, the large amount of amendments required, and the difficulty in directly using the improved mud for planting.

[0007] To achieve the above objectives, according to one aspect of the present invention, a method for in-situ humification enhancement of red mud dumps through abiotic-biological coupling is provided, comprising the following steps:

[0008] (1) Red mud pretreatment: The red mud in the stockpile is crushed and air-dried and then dealkalized to obtain dealkalized red mud, wherein the pH of the dealkalized red mud is 8.0-9.5;

[0009] (2) Non-biological-biological coupling: Add biomass and alkali-tolerant acid-producing microorganisms to the dealkalized red mud obtained in step (1), mix evenly and carry out in-situ humification of red mud in the dump, wherein the moisture content of the dealkalized red mud is maintained at 60%-80%, and in-situ natural aerobic fermentation is carried out for 15-90 days.

[0010] The biomass is added at an amount of 2-15% of the mass of the red mud;

[0011] The alkali-resistant acid-producing compound bacterial agent includes at least two of Penicillium oxalate, Bacillus, and Aspergillus niger.

[0012] Preferably, in the method for in-situ humification enhancement of red mud dumps through abiotic-biological coupling, the alkali-resistant acid-producing compound bacterial agent is a compound bacterial solution of Penicillium oxalate and Aspergillus niger or Bacillus spp., with at least 1L of the compound bacterial solution added per ton of dealkali-treated red mud, and the number of live bacteria in the compound bacterial solution being ≥10. 6 per mL.

[0013] Preferably, in the method for in-situ humification enhancement of the abiotic-biological coupled red mud dump, the composite bacterial solution is obtained by mixing Penicillium oxalate fermentation solution with Aspergillus niger fermentation solution or Bacillus spp. fermentation solution at a volume ratio of 1:1, wherein the Penicillium oxalate fermentation solution is obtained according to the following preparation method:

[0014] The number of live Penicillium oxalate bacteria was 10. 6 ~10 7 A suspension of 1000 cells / mL was added to liquid culture medium and cultured until the logarithmic growth phase to obtain Penicillium oxalate suspension.

[0015] The obtained Penicillium oxalate culture solution was inoculated into a fermenter at a volume ratio of 1:(10-20) to the liquid culture medium and cultured for 3-5 days to obtain the Penicillium oxalate fermentation solution.

[0016] Preferably, in the method for in-situ humification enhancement of red mud dumps through abiotic-biological coupling, the composite bacterial solution contains 10 live bacteria. 6 ~10 8 Add 5-8L of compound bacterial solution per ton of dealkalized red mud, per mL.

[0017] Preferably, in the method for enhancing in-situ humification of red mud in a non-biological-biological coupled dump, the biomass is agricultural and forestry solid waste, and its addition amount is 4-6% of the red mud mass; the in-situ humification of the red mud dump involves maintaining the moisture content of the dealkalized red mud at 60%-75%, and natural composting for 30-50 days.

[0018] Preferably, in the method for in-situ humification enhancement of the abiotic-biological coupled red mud dump, the dealkalization treatment is carried out as follows:

[0019] After the red mud in the stockpile is crushed and air-dried, 1%-6% of calcium-containing industrial solid waste by weight of the red mud is added. After mixing evenly, water is added to make the red mud moisture content 50%-75%. After natural curing for 3-15 days, dealkalized red mud is obtained.

[0020] Preferably, in the method for in-situ humification enhancement of the non-biological-biological coupled red mud dump, the calcium-containing industrial solid waste includes one or more combinations of desulfurized gypsum and phosphogypsum, and the amount added is 3-5%.

[0021] Preferably, the method for in-situ humification enhancement of red mud in a non-biological-biological coupled dumping ground involves making the red mud have a water content of 60%-75% and a natural curing time of 7-10 days to obtain dealkalized red mud.

[0022] Preferably, in the method for enhancing in-situ humification of the abiotic-biological coupled red mud dump, the red mud dump undergoes in-situ humification, and sugars and / or nitrogen-containing compounds are added to the dealkalized red mud; the sugars include one or more of monosaccharides, disaccharides, and polysaccharides, and the nitrogen-containing compounds include one or more of ammonium nitrogen, nitrate nitrogen, and amide nitrogen.

[0023] Preferably, in the method for in-situ humification enhancement of red mud dumps through abiotic-biological coupling, the amount of added sugars is 0.1-2% of the mass of red mud, and the amount of added nitrogen compounds is 0.01-0.1‰ of the mass of red mud.

[0024] In summary, compared with the prior art, the above-described technical solution conceived by this invention, due to the addition of at least two of the compound microbial agents from Penicillium oxalate, Bacillus, and Aspergillus niger, can achieve the following beneficial effects:

[0025] The present invention provides a method for in-situ humification enhancement of red mud dumps through a non-biological-biological coupling. First, the red mud is dealkalized to reduce its pH to 8.0–9.5. Then, biomass and an alkali-tolerant acid-producing compound microbial agent are added. At least two of *Penicillium oxalate*, *Bacillus*, and *Aspergillus niger* are combined as the compound microbial agent. This not only synergistically promotes the activity of biomass-degrading enzymes, enabling rapid degradation of biomass in the red mud to form humic matter and significantly increasing the humic matter content, but also significantly promotes the activity of polyphenol oxidase, an enzyme involved in humic matter condensation, thus promoting the condensation of humic acid to form stable humic matter. Furthermore, it can regulate the formation of surface-adsorbed or free iron and aluminum oxides from iron and aluminum minerals in the red mud, acting as a non-biological catalyst for the humification process. More importantly, it also promotes the growth of bacteria in the red mud that decompose organic matter and cycle carbon and nitrogen, thereby enhancing the humification process. The precursor substances formed by the degradation of biomass in red mud under the action of compound bacteria can achieve targeted humification of organic matter in red mud through abiotic-biocatalysis at composting temperatures. This invention uses widely available and inexpensive raw materials, the addition of compound bacteria does not cause secondary pollution, and the red mud soilification effect is significant. It can be applied to red mud soilification and composting site ecological restoration. Attached Figure Description

[0026] Figure 1 The graph shows the changes in pH and EC (electrical conductivity) of red mud under different treatments;

[0027] Figure 2 A graph showing the changes in the composition of red mud humus under different treatments;

[0028] Figure 3 A diagram showing the changes in the structure of fulvic acid in red mud under different treatments;

[0029] Figure 4 A diagram showing the changes in the humic acid structure of red mud under different treatments;

[0030] Figure 5 The graph shows the changes in enzyme content in red mud under different treatments.

[0031] Figure 6 A graph showing the changes in bacterial diversity in red mud under different treatments;

[0032] Figure 7 Figure showing the changes in fungal diversity in red mud under different treatments;

[0033] Figure 8 The plant growth status in red mud after treatment with Penicillium oxalate;

[0034] Figure 9 The plant growth status in red mud after treatment with a combination of Penicillium oxalicum and Aspergillus niger;

[0035] Figure 10The growth status of plants in red mud after treatment with a combination of Penicillium oxalate and Bacillus. Detailed Implementation

[0036] To further illustrate the technical means and effects of the present invention in achieving its intended purpose, the following detailed description of the specific implementation methods, structures, features, and effects of the present invention, in conjunction with the accompanying drawings and preferred embodiments, is provided below.

[0037] Ecological restoration of red mud dumps is the most effective strategy for controlling the risks of red mud storage and achieving safe management of red mud dumps. Among these strategies, the soilification of red mud is crucial to the success of ecological restoration. This invention first uses calcium-containing industrial solid waste to dealkalize the red mud (reduce its alkalinity). Then, it combines *Penicillium oxalate* with *Bacillus* and / or *Aspergillus niger* as a compound microbial agent, and treats the mud with biomass. The results show that this compound microbial agent synergistically promotes biomass degradation, significantly increases the humic content in the red mud, and promotes the condensation of humic acid to form stable humic substances. More importantly, it was found that combining *Bacillus* or *Aspergillus niger* with *Penicillium oxalate* promotes the colonization of *Penicillium oxalate* in the red mud, and the combination of the two promotes… The increased abundance of fungi with biomass degradation function in red mud further synergistically enhances the humification of red mud. At the same time, the complex bacteria can also regulate the formation of surface-adsorbed or free iron and aluminum oxides in red mud, and these substances can act as non-biological catalysts for the humification process. The precursor substances significantly promote the accumulation of humic acid in red mud through non-biological-biological catalysis at the composting temperature. In particular, the addition of exogenous sugars and nitrogen-containing compounds can further accelerate the humification process of red mud, and can realize the directional humification of organic matter in red mud.

[0038] Based on this, the present invention provides a method for in-situ humification enhancement of red mud dumps through abiotic-biological coupling, comprising the following steps:

[0039] (1) Red mud pretreatment: The red mud in the stockpile is crushed and air-dried and then dealkalized to obtain dealkalized red mud, wherein the pH of the dealkalized red mud is 8.0-9.5;

[0040] (2) Non-biological-biological coupled directional humification: Add biomass and alkali-resistant acid-producing compound bacteria to the dealkalized red mud obtained in step (1), mix evenly and carry out in-situ humification of red mud in the dump, wherein the moisture content of the dealkalized red mud is maintained at 60%-80%, and in-situ natural aerobic fermentation is carried out for 15-90 days.

[0041] The biomass is added at an amount of 2-15% of the mass of the red mud;

[0042] The alkali-resistant acid-producing compound bacterial agent includes at least two of Penicillium oxalate, Bacillus, and Aspergillus niger.

[0043] In some embodiments, the compound microbial agent is added in the form of a bacterial solution, wherein the compound microbial agent is a compound bacterial solution of Penicillium oxalate and Aspergillus niger or Bacillus spp., and more than 1L of the compound microbial solution is added per ton of dealkalized red mud, wherein the number of live bacteria in the compound microbial solution is ≥10. 6 Cells / mL;

[0044] Preferably, the Penicillium oxalate fermentation broth is obtained by mixing it with Aspergillus niger fermentation broth or Bacillus fermentation broth at a volume ratio of 1:1, wherein the Penicillium oxalate fermentation broth is obtained according to the following preparation method:

[0045] The number of live Penicillium oxalate bacteria was 10. 6 ~10 7 A suspension of 1000 cells / mL was added to liquid culture medium and cultured until the logarithmic growth phase to obtain Penicillium oxalate suspension.

[0046] The obtained Penicillium oxalate culture solution was inoculated into a fermenter at a volume ratio of 1:10 to 1:20 with the liquid culture medium and cultured for 3 to 5 days to obtain the Penicillium oxalate fermentation solution.

[0047] In some embodiments, the compound bacterial solution contains Penicillium oxalate and Aspergillus niger, or Penicillium oxalate and Bacillus, with a viable count of 10. 6 ~10 8 Add 5-8L of compound bacterial solution per ton of dealkalized red mud, per mL.

[0048] In some embodiments, the compound microbial agent is microbial powder, which is added at a mass ratio of 0.05-0.1% between the microbial powder and the mud.

[0049] Furthermore, the biomass is agricultural and forestry solid waste, and its addition amount is 4-6% of the red mud mass; the red mud is in-situ humified in the dump, wherein the moisture content of the dealkalized red mud is maintained at 60%-75%, and natural fermentation is carried out for 30-50 days.

[0050] In some embodiments, the dealkalization treatment is carried out as follows:

[0051] After crushing the red mud in the stockpile (particle size ≤ 5cm) and air-drying it, add 1%-6% of calcium-containing industrial solid waste by weight of the red mud, mix evenly, add water to make the red mud moisture content 50%-75%, and allow it to cure naturally for 3-15 days to obtain dealkalized red mud.

[0052] The calcium-containing industrial solid waste is industrial by-product gypsum, which refers to by-products or waste residues mainly composed of calcium sulfate generated by chemical reactions in industrial production. It is also called chemical gypsum or industrial waste gypsum, and includes one or more combinations of desulfurized gypsum and phosphogypsum.

[0053] In some embodiments, the calcium-containing industrial solid waste is desulfurized gypsum or phosphogypsum, which is added at 3-5% of the mass of red mud to make the red mud water content 60%-75%, and the natural curing time is 7-10 days, and the pH of the obtained dealkalized red mud is 8.5.

[0054] The biomass is agricultural and forestry solid waste, including straw, bran, sugarcane bagasse, etc., and its addition amount is 2-15% of the red mud mass; in some embodiments, the biomass is corn straw or sugarcane bagasse, and its addition amount is 4-6% of the red mud mass; the red mud is composted and humified in situ in the composting yard, maintaining the red mud moisture content at 60%-75%, and undergoing aerobic natural fermentation for 30-50 days.

[0055] Preferably, the red mud is subjected to in-situ composting and humification at the red mud dump, and sugars and / or nitrogen-containing compounds are added to the dealkalized red mud. The sugars include one or more of monosaccharides, disaccharides, and polysaccharides, and the nitrogen-containing compounds include one or more of ammonium nitrogen, nitrate nitrogen, and amide nitrogen. The amount of sugars added is 0.1-2% of the red mud mass, and the amount of nitrogen-containing compounds added is 0.01-0.1‰ of the red mud mass. More preferably, sugars and nitrogen-containing compounds are added to the dealkalized red mud.

[0056] The following are examples.

[0057] Example 1: Humification of Red Mud Dumps

[0058] This embodiment provides a method for in-situ humification enhancement of red mud dumps through non-biological-biological coupling, which includes the following steps:

[0059] (1) Red mud pretreatment

[0060] After crushing the red mud from the stockpile (the particle size of the crushed red mud is ≤2cm) and air-drying it, add calcium-containing industrial solid waste such as phosphogypsum at a rate of 3% of the red mud mass. After mixing evenly, add water to make the red mud moisture content 60%-75% and allow it to cure naturally for 7-10 days to obtain dealkalized red mud with a pH of about 8.5.

[0061] (2) Abiotic-biogenic coupling

[0062] Add pretreated biomass, such as corn stalks (which are crushed and passed through a 60-80 mesh sieve), to the dealkalized red mud obtained in step (1). The amount of biomass added accounts for 4% of the mass of the red mud. Mix it evenly and inoculate it with 8L of compound bacterial solution SJ1 (containing alkali-tolerant acid-producing microorganisms) containing Penicillium oxalate fermentation solution and Aspergillus niger fermentation solution, with a volume ratio of Penicillium oxalate fermentation solution to Aspergillus niger fermentation solution of 1:1) per ton of dealkalized red mud. Then carry out in-situ composting and humification of the red mud in the composting yard. The moisture content of the dealkalized red mud is maintained at 60%-75%. In-situ aerobic natural composting is carried out for 30-50 days.

[0063] The screening of Penicillium oxalate and the preparation of its fermentation broth are detailed below:

[0064] (a) Screening for strains with alkali-tolerant and acid-producing functions: 10g of red mud sample was collected from a red mud dump in Pingguo, Guangxi. The sample was then placed in 90mL of sterile water and shaken at 150r / min for 30min to obtain a dilution. The dilution was then spread on Martin Bengal red agar plates and incubated at 28℃ for 3-5 days. Single colonies were selected and streaked onto a primary screening plate and incubated at 28℃ for 3-5 days. Single colonies were selected and streaked to obtain a pure culture strain, which was identified as Penicillium oxalicum.

[0065] (b) Preparation of PDB medium: Add the medium to ten 200mL Erlenmeyer flasks. The medium consists of 10g peptone, 20g glucose, 8g NaCl, and 1000mL distilled water. Sterilize the medium using an autoclave (sterilization conditions: 121℃, 20min). After cooling to room temperature (25℃), pour the medium onto plates and wait for it to solidify. Place the plates in an incubator and incubate at 30-37℃ for 24h. Once sterile growth is observed, the medium is ready for use.

[0066] (c) Inoculation strain: The fungi in (a) were picked up with an inoculation loop and inoculated onto solid PDB medium. The medium was then inverted and placed in an incubator for 5 days at a temperature of 20-30°C. The culture was then used to prepare bacterial suspension.

[0067] (d) Preparation of bacterial suspension: Using a sterile cotton swab moistened with sterile water, gently scrape the surface of the solid culture medium to collect viable bacteria, then transfer it to sterile water and mix thoroughly to obtain a suspension. The number of viable bacteria is counted using a hemocytometer-microscope. By repeatedly adjusting the viable bacteria concentration of the suspension, the concentration is maintained at approximately 10⁻⁶. 7 / mL. In a clean bench, take 1.5mL of the prepared suspension and add it to sterile liquid culture medium (inoculate 1% by volume into 150mL of PDB liquid culture medium), and then place it in a 28℃, 150rpm water bath constant temperature shaking incubator for 3 days to the logarithmic growth phase;

[0068] (e) Fermentation and expansion: The Penicillium oxalate culture obtained in (d) was inoculated into the liquid culture medium in the fermenter at a volume ratio of 1:10 for expansion. The expansion time was 3-5 days, and the viable cell concentration after expansion was approximately 10. 7 per mL.

[0069] Aspergillus niger was cultured using a suitable fermentation method, and the viable cell concentration was increased to approximately 10. 7The two bacterial solutions were mixed at a volume ratio of 1:1 to obtain composite bacterial solution SJ1. Then, 8L of composite bacterial solution SJ1 was added to 1t of dealkalized red mud for humification in the red mud dump.

[0070] Example 2: Humification of Red Mud Dumps

[0071] In this embodiment, sugars and / or nitrogen-containing compounds may be added to the dealkalized red mud. The added sugars are 0.1-2% of the red mud mass, and the added nitrogen-containing compounds are 0.01-0.1‰ of the red mud mass. The sugars include one or more of monosaccharides, disaccharides, and polysaccharides, and the nitrogen-containing compounds include ammonium nitrogen, nitrate nitrogen, and amide nitrogen. Specifically:

[0072] Red mud pretreatment: The red mud in the stockpile is crushed (the particle size of the crushed red mud in the stockpile is ≤2cm), air-dried, and then calcium-containing industrial solid waste such as desulfurization gypsum is added. The amount added is 3% of the red mud mass. After mixing evenly, water is added to make the red mud moisture content 60%-75%. It is then naturally cured for 7-10 days to obtain dealkalized red mud with a pH of about 8.5.

[0073] Non-biological-biological coupling: Pretreated biomass, such as sugarcane bagasse (which has been crushed and passed through a 60-80 mesh sieve), is added to the dealkalized red mud obtained above. The amount added accounts for 5% of the red mud mass. The mixture is thoroughly mixed, and 8L of a compound bacterial solution SJ2 containing alkali-tolerant and acid-producing microorganisms is inoculated per ton of red mud (Penicillium oxalate fermentation solution and Bacillus fermentation solution, wherein the volume ratio of Penicillium oxalate fermentation solution to Bacillus fermentation solution is 1:1, and the viable bacteria concentration in the compound bacterial solution is approximately 10%. 7 (number / mL), wherein the preparation of Penicillium oxalate fermentation broth is the same as in Example 1;

[0074] Bacillus was cultured using a suitable fermentation method, and the viable cell concentration was increased to approximately 10. 7 The volume ratio of the two fermentation broths was 1:1 to obtain the compound bacterial broth SJ2.

[0075] Add 1% of sugars such as monosaccharides and 0.05% of nitrogenous compounds such as urea by weight of red mud to the red mud, and carry out composting in situ in the composting yard, maintaining the red mud moisture content at 60%-75%, and carry out aerobic natural fermentation. The composting time is the same as in Example 1 to obtain humified red mud.

[0076] The biomass, exogenous sugars, and nitrogen-containing compounds added in this invention not only form precursors for the humification process under the action of the compound bacteria, but also serve as sources of carbon and nitrogen required for the growth of the compound bacteria, promoting their growth during the humification process and continuously enhancing the humification of red mud. Furthermore, the aforementioned compound bacteria can regulate the formation of surface-adsorbed or free iron and aluminum oxides from iron and aluminum minerals in red mud. These substances can act as non-biological catalysts for the humification process, further enhancing the humification of red mud.

[0077] Comparative Example 1: Humification of Red Mud Dump

[0078] In an experiment comparing the effects of single-strain solutions of Penicillium oxalate, Bacillus niger, and Aspergillus niger on the humification of red mud, the improvement effect on red mud soil was found to be in the order of Penicillium oxalate > Aspergillus niger > Bacillus niger. The following explanation focuses on Penicillium oxalate, which showed the best improvement effect:

[0079] Red mud pretreatment: The red mud in the stockpile is crushed (the particle size of the crushed red mud in the stockpile is ≤2cm), air-dried, and then calcium-containing industrial solid waste such as desulfurization gypsum is added. The amount added is 3% of the red mud mass. After mixing evenly, water is added to make the red mud moisture content 60%-75%. It is then naturally cured for 7-10 days to obtain dealkalized red mud with a pH of about 8.5.

[0080] Abiotic-biosynthetic coupling: Add pretreated biomass, such as bagasse (which has been crushed and passed through a 60-80 mesh sieve), to the dealkalized red mud obtained above. The amount added is 5% of the red mud mass. Mix thoroughly and inoculate 8L of a single-strain solution containing alkali-tolerant acid-producing microorganisms (Penicillium oxalate, with a viable bacterial concentration of approximately 10) per ton of red mud. 7 (pcs / mL);

[0081] Add 1% of sugars such as monosaccharides and 0.05% of nitrogenous compounds such as urea by weight of red mud to the red mud, and carry out composting in situ in the composting yard, maintaining the red mud moisture content at 60%-75%, and carry out aerobic natural fermentation. The composting time is the same as in Example 1 to obtain humified red mud.

[0082] Example 3: Changes in pH and EC after humification in different red mud dumps

[0083] The pH and EC of red mud from Examples 1, 2, and 1 after humification treatment in different composting sites are compared as follows:

[0084] Weigh 5g of red mud sample and place it in a 50mL centrifuge tube. Add 25mL of cooled distilled water and mix thoroughly. Stir with a glass rod for 1 minute, let stand for 30 minutes, and then test the pH and conductivity (EC). The instrument used for pH testing was a Leici PHS-3C pH meter; the instrument used for conductivity measurement was a Leici DDS-307 conductivity meter. The test results for pH and EC are as follows: Figure 1 As shown; in addition, the salinity and alkalinity index and carbon content of each component of red mud treated with different humification methods are as follows: Figure 2 As shown.

[0085] Depend on Figure 1 As can be seen from the left, the pH value of the red mud after single-strain humification treatment in Comparative Example 1 (CK group) was 8.17, while the pH values ​​of the red mud after humification treatment in Example 1 (compound bacterial solution SJ1) and Example 2 (compound bacterial solution SJ2) were 7.76 and 7.52, respectively. Compared with single-strain treatment, the above-mentioned compound bacteria can further reduce the alkalinity of the red mud.

[0086] Depend on Figure 1 As shown in the right-hand side, compared with the humification treatment of Comparative Example 1 (CK group), the EC values ​​of the red mud after humification treatment in Example 1 (compound bacterial solution SJ1) and Example 2 (compound bacterial solution SJ2) decreased by 28.19% and 33.08%, respectively. This may be because the organic acids produced after adding the above-mentioned compound bacterial agent react with alkaline ions, reducing the ion content. On the other hand, the metabolism of microorganisms changes the physical structure and pore characteristics of the red mud, causing soluble salts to be leached out with water during soil cultivation, thereby reducing the EC value of the red mud.

[0087] Example 4: Changes in organic carbon content and humic composition of red mud after humification in a red mud dump.

[0088] The main components of humic substances are carbon, hydrogen, oxygen, nitrogen, sulfur, and phosphorus. Humic substances are not a single organic compound, but a mixture of a series of organic compounds that share commonalities and differences in composition, structure, and properties, with humic acid and fulvic acid being the main components. This example compares the organic carbon content and humic substance composition of red mud after humification treatment in different stockpiles in Examples 1, 2, and Comparative Example 1, as follows:

[0089] The total organic carbon (TOC) content was determined using the potassium dichromate oxidation-external heating method: after filtration through a 0.45µm membrane filter; the dissolved organic carbon (DOC) concentration was determined using a TOC analyzer, and the results are as follows. Figure 2 As shown in the middle left.

[0090] Humic component determination: Red mud samples were extracted with distilled water and 0.1M NaOH + 0.1M Na4P2O7 solution to obtain humic substances (HS);

[0091] The alkaline supernatant was acidified to pH 1.0 to separate the humic acid (HA, also known as humic acid) fraction from the humic material; the alkaline supernatant was then acidified to pH 3 with 0.5M H2SO4 to separate the acid-soluble fulvic acid carbon (FA).

[0092] For insoluble HA, the attached FA was removed using 0.025M H2SO4 and 0.05M NaOH. The carbon content of HA was determined by the K2Cr2O7 oxidation method, and the FA content was calculated by the difference between HA and HS. The results of HS, HA, and FA determinations are as follows: Figure 2 As shown in the middle right.

[0093] Depend on Figure 2 As can be seen from the left, compared with Comparative Example 1, the total organic carbon (TOC) and dissolved organic carbon (DOC) content in the red mud increased after treatment in Examples 1 and 2. In Comparative Example 1, after treatment with a single bacterial solution, the TOC and DOC content in the red mud were 10.68 g / kg and 0.47 g / kg, respectively.

[0094] In Example 1, after treatment with the composite bacterial solution SJ1, the TOC and DOC contents in the red mud were 16.42 g / kg and 0.66 g / kg, respectively. In Example 2, after treatment with the composite bacterial solution SJ2, the TOC and DOC contents in the red mud were 15.49 g / kg and 0.78 g / kg, respectively. It is evident that compared to single-strain treatment, the TOC and DOC contents in the red mud were significantly increased after treatment with the above composite bacterial solutions. This indicates that the added composite bacterial solution can synergistically promote the decomposition of biomass, effectively increasing the organic carbon content of the red mud, resulting in a significant increase in the TOC and DOC contents after treatment. The abiotic-biobiotic coupling effect further increased the DOC content in the red mud.

[0095] Depend on Figure 2 As shown on the right, compared with single bacterial solution, after adding compound bacterial solution SJ1 or SJ2 for humification treatment, although the fulvic acid (FA) content in red mud did not change significantly, the humic substances (HS) and humic acid (HA) both increased significantly. Among them, the addition of compound bacterial solution SJ1 and SJ2 increased by 9% and 6% respectively, indicating that the above compound bacterial solutions can synergistically promote the accumulation of humic substances in red mud.

[0096] In summary, inoculating red mud with the above-mentioned compound bacterial solution can significantly increase the humic content of red mud and promote its humification. At the same time, the addition of monosaccharides and urea has a certain enhancing effect on the humification of red mud.

[0097] Example 5: Changes in the structure of fulvic acid in red mud after humification in a red mud dump.

[0098] EEM fluorescence is a simple and accurate method for evaluating humification characteristics. In this example, red mud samples from Examples 1, 2, and Comparative Example 1, with different humification treatments, were used as test samples. A fluorescence spectrometer (F-4600, Hitachi, Japan) was used to measure the three-dimensional excitation-emission matrix (3D-EEM) at room temperature (25°C). The scan rate was 12000 nm / min, the excitation wavelength was 200–500 nm with a step size of 2 nm, and the emission wavelength was 250–650 nm with a step size of 2 nm. The instrument's spectral calibration was set to automatic calibration. Protein substances are easily decomposed and biodegraded, and can be converted into humic substances. The three-dimensional EEM fluorescence spectra of the DOM of red mud with different humification treatments are shown below. Figure 3 As shown.

[0099] Figure 3 The red mud after humification treatment contains peaks A, B, C, and D, but their fluorescence intensities differ. Specifically, the B region (EX / EM) at 210-230 / 270-320 nm and the D region (270-280 / 330-370 nm) are protein-like and tryptophan-like fluorescence regions, respectively, originating from protein-like substances and phenolic compounds. Meanwhile, the A region (EX / EM) at 230-260 / 380-460 nm and the C region (310-330 / 410-450 nm) are fulvic acid-like and humic acid-like fluorescence regions, respectively, related to humic substance formation.

[0100] Depend on Figure 3 It can be seen that, compared with the single bacterial solution of Comparative Example 1, the fluorescence intensity of peaks A, B, C, and D of the red mud treated with the composite bacterial solution of Examples 1 and 2 increased, indicating an increase in protein-like substances and humic substances. Among them, peaks A and C are produced by humic substances and have complex molecular structures, while peaks B and D mainly originate from microbial metabolites.

[0101] Compared with single bacteria, the red mud treated with the above-mentioned compound bacteria exhibited higher microbial activity. The addition of the compound bacterial solution significantly enhanced the fluorescence intensity of fulvic acid and synergistically promoted the humification of the red mud.

[0102] Example 6: Changes in the structure of humic acid in red mud after humification in a red mud dump.

[0103] Infrared spectroscopy can roughly show the composition and structure of humus. In this embodiment, FTIR spectroscopy (Magna-IR750, Nicolet, WA, USA) was used to evaluate the functional groups of red mud treated with different methods in Example 1, Example 2 and Comparative Example 1, as follows:

[0104] 1 mg of red mud sample and 200 mg of dry KBr were weighed, mixed and ground, placed in a mold, and pressed into a transparent sheet using a tablet press. After testing the background value, the sample was placed in a spectrometer, and the spectrum was obtained by scanning in the range of 4000-400 cm⁻¹. The results are as follows. Figure 4 As shown.

[0105] Depend on Figure 4 It can be seen that there are some subtle differences in the humic acid structure in red mud after different humification treatments, as follows:

[0106] The main functional groups of humic substances are methyl, methylene, methine, carboxyl, amide, hydroxyl, and benzene rings. The compounds are mainly composed of sugars, aliphatic and aromatic organic acids, amides, alcohols, and phenols. The absorption band at 3420 cm⁻¹ is due to the stretching of OH groups in carbohydrates or NH groups in amides; the absorption band at 1650 cm⁻¹ is due to the stretching of COOH or C=O groups of ketones and the stretching of C=C groups of aromatic compounds; the absorption band at 1450 cm⁻¹ also indicates the stretching of C=C groups of aromatic compounds; and in the absorption band at 1120 cm⁻¹, the absorption bands of polysaccharide skeletal vibrations, phenols, and carboxylic acids (CO(H)) show large peaks.

[0107] In this embodiment, FTIR was used to investigate the effect of abiotic-biotic interactions on the organic functional groups of red mud. The results showed that, compared with the single bacteria in Comparative Example 1, the absorption intensity at 1128 cm⁻¹ and 3424 cm⁻¹ decreased, as did the intensity of functional groups such as hydroxyl groups, after the addition of the compound bacterial solution in Examples 1 and 2, while the absorption intensity at 1450 cm⁻¹ increased.

[0108] The decreased absorption intensity at 1128 cm⁻¹ indicates that the combined microbial agent reduced simple sugars in the red mud, promoting the condensation of humic acid. Simultaneously, the decreased absorption intensity at 3424 cm⁻¹ and the reduced strength of functional groups such as hydroxyl groups indicate that the combined microbial agent promoted the degree of humic acid condensation. Conversely, the increased absorption intensity at 1450 cm⁻¹ indicates that the combined microbial agent promoted the accumulation of aromatic functional groups in humic acid. This suggests that abiotic-biotic coupling enhanced the degree of humic acid condensation in red mud humic material, thereby improving the structural stability of the red mud humic material.

[0109] Example 7: Changes in enzyme activity in red mud after humification in a red mud dump.

[0110] In this embodiment, red mud from Examples 1, 2, and Comparative Example 1, treated with different humification processes, was used as test samples. Fluorescence analysis was performed using a 96-well plate to determine the activities of β-glucosidase, xylanase, N-acetyl-β-glucosidase, and BD-cellulosidase, as detailed below:

[0111] Weigh 1.00 g of red mud sample and add 125 mL of 50 mM acetate buffer to a 500 mL beaker. Prepare a red mud suspension by continuous stirring with a magnetic stirrer until homogeneous. Using an 8-channel pipette, sequentially adsorb 150 mL of the red mud suspension and the fluorescent substrate (200 mM) of the relevant enzyme onto 96 wells of a microplate and incubate in the dark at 25 °C for 4 h. After incubation, add 10 μL of 1 mol NaOH solution to the plate to terminate the reaction. A standard curve should be plotted for each red mud sample to eliminate the influence of different matrices. Finally, measure the fluorescence value using a microplate reader with an excitation wavelength of 365 nm and an emission wavelength of 450 nm (Tecan Infinite 200PRO Multilabel Reader, Tecan Trading AG, Switzerland).

[0112] Polyphenol oxidase (PPO) catalyzes the oxidation of various phenols to quinones by O2. This experiment used catechol as a substrate in a reaction system of 0.2M disodium hydrogen phosphate-0.1M citrate buffer at pH 6.0. PPO catalyzed the formation of brown quinones from catechol. The OD value of the reaction system at 410 nm was measured using a spectrophotometer, and the enzyme activity of PPO was determined by the change in OD value. The results are as follows: Figure 5 As shown.

[0113] Depend on Figure 5 It can be seen that the activities of carbon cycle-related enzymes (β-glucosidase, xylanase, polyphenol oxidase, acetylglucosidase and cellulosidase) after treatment with compound bacterial solutions SJ1 and SJ2 in Examples 1 and 2 were significantly stronger than those of single-strain humification treatment in Comparative Example 1.

[0114] Furthermore, the enzyme activities related to cellulose and hemicellulose degradation were significantly stronger than those in the humification treatment of Comparative Example 1. The activities of glucose-metabolizing enzymes such as α-glucosidase were also enhanced in the treatments of Examples 1 and 2. Among them, polyphenol oxidase is a type of terminal oxidase that can directly transfer electrons to molecular oxygen. Its main function is to catalyze the formation of quinones from phenols, which further form humic substances, indicating that the decomposition reaction of straw and bagasse is vigorous and the related microbial activities are high.

[0115] Compared to Comparative Example 1, the addition of the aforementioned compound microbial agent also promoted the activity of polyphenol oxidase in red mud. Microorganisms play a dominant role in the humification process. Furthermore, microorganisms metabolize organic matter by secreting various hydrolytic enzymes, which control the degradation rate of each component. Monitoring the activity of these enzymes can provide useful information about the dynamics of important nutrients such as carbon. Biodegradable organic components stimulate microbial growth, and the synthetic activity of enzymes related to the degradation of cellulose, hemicellulose, proteins, carbohydrates, etc., indicates the transformation of organic matter during humification.

[0116] Overall, the addition of the above-mentioned compound microbial agent can synergistically promote the activity of biomass degradation enzymes, and at the same time, it has a significant promoting effect on the activity of polyphenol oxidase, an enzyme involved in humic condensation.

[0117] Example 8: Changes in bacterial diversity in red mud after humification in a red mud dump.

[0118] In this embodiment, red mud treated with different humification processes (Examples 1, 2, and Comparative Example 1) was used as test samples. The purity and concentration of DNA were determined using the NanoDrop 2000 method. A 1% agarose gel was used for agarose gel electrophoresis at 5V / cm to detect DNA integrity. After sample quality control, PCR (ABI) was performed. Amplification experiment (Type 9700). The primers for PCR amplification of the bacterial 16S rRNA gene are:

[0119] 338F(ACTCCTACGGGAGGCAGCAG);

[0120] 806R(GGACTACHVGGGTWTCTAAT);

[0121] The specific PCR amplification parameters are as follows:

[0122] Pre-denaturation: 95℃, 3 min; denaturation: 95℃, 30 s; degradation: 55℃, 30 s; extension: 72℃, 45 s; this operation was repeated 27 times for the bacteria; extension at 72℃ for 10 min; the system was maintained at 10℃ until discontinued. Subsequent high-throughput sequencing was performed on the IlluminaMiSeq platform of Meiji Biotechnology, and the results are as follows: Figure 6 As shown.

[0123] Figure 6 The changes in bacterial community alpha diversity index and community diversity are shown. The Chao index can be used to assess community richness, and the Shannon index can be used to assess community diversity.

[0124] Depend on Figure 6 It can be seen that, compared with single-strain treatment, the Chao index of red mud in Examples 1 and 2 increased slightly and the Shannon index decreased significantly after treatment with compound bacterial solution.

[0125] At the phylum level, the dominant bacteria were Actinobacteria, Myxococcota, Gemmatimonadota, Verrucomicrobiota, Acidobacteria, Bacteroidota, Enterobacteriaceae, Proteobacteria, Methylomirabilota, and Chloroflexi.

[0126] At the genus level, under the Comparative Example 1 treatment, the relative abundance of *Vicinamibacteraceae*, *RB41*, *Rubrobacter*, and *Gaiellales* was relatively high in the red mud bacterial community. In contrast, the dominant genera after the SJ2 treatment included *Rubrobacter*, *Flavobacterium*, and *Vicinamibacteraceae*, all of which have the function of decomposing organic matter. The SJ1 treatment showed a significant difference in the structure of the red mud bacterial community, with the dominant genera being mainly *Mycobacterium* and *Bradyrhizobium*. *Bradyrhizobium* has nitrogen-fixing capabilities, indicating that the addition of *Penicillium oxalate* and *Aspergillus niger* can promote the growth of genera in red mud that have the function of decomposing organic matter and cycling carbon and nitrogen.

[0127] Example 9: Changes in fungal diversity in red mud after humification in red mud dumps

[0128] In this embodiment, red mud treated with different humification processes (Examples 1, 2, and Comparative Example 1) was used as test samples. The purity and concentration of DNA were determined using the NanoDrop 2000 method. A 1% agarose gel was used for agarose gel electrophoresis at 5V / cm to detect DNA integrity. After sample quality control, PCR (ABI) was performed. Amplification experiment (Type 9700).

[0129] The primers for PCR amplification of the fungal ITS gene are:

[0130] ITS1F(CTTGGTCATTTAGAGGAAGTAA);

[0131] ITS2R(GCTGGCGTTCTTCATCGATGC).

[0132] The specific PCR amplification parameters were as follows: pre-denaturation: 95℃, 3 min; denaturation: 95℃, 30 s; degeneration: 55℃, 30 s; extension: 72℃, 45 s; this operation was repeated 35 times by fungi; extension at 72℃ for 10 min; and the system was maintained at 10℃ until discontinued. Subsequent high-throughput sequencing was performed on the IlluminaMiSeq platform of Meiji Biotechnology, and the results are as follows. Figure 7 As shown.

[0133] Figure 7 The changes in fungal community alpha diversity index and community diversity after red mud treatment are shown. The Chao index can be used to assess the richness of the compound inoculant community, while the Shannon index can be used to assess fungal community diversity.

[0134] Compared with Comparative Example 1, the Chao and Shannon indices of red mud were significantly reduced after the addition of the compound microbial agent. At the phylum level, the relative abundance of Basidiomycota and Mortierellomycota increased after the treatment with the compound microbial agent, while the relative abundance of Glomeromycota and Rozellomycota increased significantly.

[0135] At the genus level, *Russula* and *Cladophialophora* were significantly dominant in the red mud after a single treatment with the compound microbial agent. *Penicillium* was present in the red mud after all three treatments. Compared to the addition of a single *Penicillium oxalate* fungus, the abundance of *Russula* and *Cladophialophora* increased in the red mud treated with the compound microbial agent. *Russula* belongs to the Basidiomycota, and *Cladophialophora* belongs to the Molds; both fungi secrete organic matter-related degrading enzymes and have the function of decomposing organic matter. Furthermore, the abundance of *Penicillium* significantly increased with the addition of compound microbial agents SJ1 and SJ2, indicating that the combination of *Bacillus* or *Aspergillus niger* with *Penicillium oxalate* in this embodiment can promote the colonization of *Penicillium oxalate* in the red mud, and the combination can promote the increase of fungi that enhance biomass degradation, further synergistically enhancing the humification of the red mud.

[0136] Example 9: Effects of Humification in Different Red Mud Dumps on Plant Growth

[0137] This embodiment compares the effects of red mud composting and humification treatments (Comparative Example 1, Example 1, and Example 2) on plant growth. The plant growth conditions are as follows: Figure 8 , Figure 9 and Figure 10 As shown.

[0138] Depend on Figure 9 and Figure 10It is known that by using the red mud humification method provided by this invention, the humified red mud can be used as a growth substrate, in which herbaceous plants such as bermudagrass, tall fescue, and ryegrass have a germination rate of over 95% and can grow normally.

[0139] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make some modifications or alterations to the above-disclosed technical content to create equivalent embodiments without departing from the scope of the present invention. Any simple modifications, equivalent changes and alterations made to the above embodiments based on the technical essence of the present invention without departing from the scope of the present invention shall still fall within the scope of the present invention.

Claims

1. A method for in-situ humification enhancement of red mud dumps through abiotic-biological coupling, characterized in that, Includes the following steps: (1) Red mud pretreatment: The red mud in the stockpile is crushed and air-dried and then dealkalized to obtain dealkalized red mud, wherein the pH of the dealkalized red mud is 8.0-9.5; (2) Non-biological-biological coupled directional humification: Add biomass and alkali-resistant acid-producing compound bacteria to the dealkalized red mud obtained in step (1), mix evenly and carry out in-situ humification of red mud in the dump, wherein the moisture content of the dealkalized red mud is maintained at 60%-80%, and in-situ natural aerobic fermentation is carried out for 15-90 days. The biomass is added at an amount of 2-15% of the mass of the red mud; The alkali-resistant acid-producing compound bacterial agent is a compound bacterial solution of Penicillium oxalate and Aspergillus niger or Bacillus spp., with at least 1L of the compound bacterial solution added per ton of dealkali-treated red mud. The number of live bacteria in the compound bacterial solution is ≥10. 6 Cells / mL; The composite bacterial solution is obtained by mixing Penicillium oxalate fermentation bacterial solution with Aspergillus niger fermentation bacterial solution or Bacillus fermentation bacterial solution at a volume ratio of 1:1, wherein the Penicillium oxalate fermentation bacterial solution is obtained by the following preparation method: The number of live Penicillium oxalate bacteria was 10. 6 ~10 7 A suspension of 1000 cells / mL was added to liquid culture medium and cultured until the logarithmic growth phase to obtain Penicillium oxalate suspension. The obtained Penicillium oxalate culture solution was inoculated into a fermenter at a volume ratio of 1:(10-20) to liquid culture medium and cultured for 3-5 days to obtain Penicillium oxalate fermentation solution. The composite bacterial solution contains 10 live bacteria. 6 ~10 8 Add 5-8L of compound bacterial solution per ton of dealkalized red mud; The dealkali removal treatment is carried out as follows: After the red mud in the stockpile is crushed and air-dried, 1%-6% of calcium-containing industrial solid waste by weight of red mud is added, mixed evenly, and water is added to make the red mud moisture content 50%-75%. After natural curing for 3-15 days, dealkalized red mud is obtained. The calcium-containing industrial solid waste includes one or more combinations of desulfurized gypsum and phosphogypsum, with an addition amount of 3-5%. The red mud is kept at a moisture content of 60%-75% and naturally cured for 7-10 days to obtain dealkalized red mud. The compound microbial agent can synergistically promote biomass degradation and promote the condensation of humic acid to form stable humus. When Bacillus or Aspergillus niger is combined with Penicillium oxalate, it can promote the colonization of Penicillium oxalate in red mud and increase the abundance of fungi with biomass degradation function in red mud, further synergistically enhancing the humification of red mud. At the same time, the compound microbial agent can also regulate the formation of surface adsorbed or free iron and aluminum oxides in red mud, and these substances can act as non-biological catalysts for the humification process. The precursor substances significantly promote the accumulation of humic acid in red mud through non-biological-biological catalysis at the composting temperature.

2. The method for in-situ humification enhancement of red mud dumps through abiotic-biological coupling as described in claim 1, characterized in that, The biomass is agricultural and forestry solid waste, and its addition amount is 4-6% of the mass of red mud. The red mud dump is used for in-situ humification, in which the moisture content of the dealkalized red mud is maintained at 60%-75%, and natural fermentation is carried out for 30-50 days.

3. The method for in-situ humification enhancement of red mud dumps through non-biological-biological coupling as described in any one of claims 1 to 2, characterized in that, The red mud dump undergoes in-situ humification, and sugars and / or nitrogen-containing compounds are added to the dealkalized red mud. The sugars include one or more of monosaccharides, disaccharides, and polysaccharides, and the nitrogen-containing compounds include one or more of ammonium nitrogen, nitrate nitrogen, and amide nitrogen.

4. The method for in-situ humification enhancement of red mud dumps through abiotic-biological coupling as described in claim 3, characterized in that, The amount of sugar added is 0.1-2% of the mass of the dealkalized red mud, and the amount of nitrogen-containing compounds added is 0.01-0.1‰ of the mass of the dealkalized red mud.

Images