A method for preparing a stable O antigen chicken white dysentery agglutination antigen

Abstract

This invention discloses a method for preparing a stable O antigen-containing agglutinating antigen for pullorum disease. The agglutinating antigen is prepared from a SPUL_2404 gene knockout strain of Salmonella pullorum JD 02 that stably expresses the standard O antigen, and a SPUL_2404 gene overexpressing strain of Salmonella pullorum JD 02 that stably expresses the variant O antigen. The optimal detection effect is achieved when the ratio of standard to variant strains is 1:2. This invention overcomes the problem of unstable O antigens in the standard and variant strains used in the production of pullorum agglutinating antigens, and the resulting agglutinating antigen product has advantages such as antigen stability, high sensitivity, and strong specificity.

Description

Technical Field

[0001] This invention belongs to the field of avian salmonellosis prevention and control technology, specifically relating to the construction of O antigen-stable standard and variant strains of Salmonella pullorum and the method of using them to prepare pullorum agglutination antigen. Background Technology

[0002] Pullorum disease (ASD) is a serious threat to the healthy development of poultry farming. Infected chicks may experience diarrhea, pasty vent, and other symptoms, leading to death in severe cases. While the damage to adult chickens is less severe, the pathogen can persist in the farm for a long time, posing a risk of widespread outbreaks. Infected breeder chickens not only affect production performance but also remain latent carriers for extended periods, vertically transmitting the bacteria to offspring and causing chick mortality. Therefore, eradicating the disease in breeder chickens is crucial for its eradication. Consequently, developing highly sensitive and stable diagnostic reagents is essential for the eradication of pullorum disease.

[0003] Plate agglutination testing using whole blood or serum from the chickens being tested is currently the most convenient and efficient detection method. The O antigen of Salmonella pullorum plays a crucial role in agglutination with antibodies in the test sample. The O antigen is composed of O1, O9, and O12. Due to the presence of subtypes O121, O122, and O123 within the O12 antigen, pullorum disease has resulted in the production of standard strains containing subtypes O121 and O123, as well as variant strains containing subtypes O121 and O122. Infection with different subtypes stimulates the production of different specific antibodies. Therefore, current diagnostic antigens for pullorum disease are typically prepared by mixing standard and variant strains in a specific ratio.

[0004] The O antigen plays a crucial role in the agglutination process of bacterial strains. However, studies have shown that the O antigen of Salmonella Pullorum is unstable, exhibiting conversion between standard and variant phenotypes during passage and under varying conditions. This phenomenon makes it difficult to control the phenotype of the strains producing the agglutinated antigen at the source, affecting the accuracy of detection. Therefore, this invention obtains candidate strains with high immunogenicity for antigen preparation through strain screening. Furthermore, based on the identification of key enzymes affecting the phenotypic transformation of the O antigen in the strains, molecular biology techniques are used to knock out or overexpress these enzymes, stabilizing the strain phenotype. Additionally, the strain ratio is optimized to prepare novel agglutination antigens with high sensitivity and strong stability. Summary of the Invention

[0005] This invention discloses a method for preparing a stable O antigen-based agglutinating antigen for chicken pullorum disease. The agglutinating antigen prepared by this method has the characteristics of high sensitivity and stability of the O antigen.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] A stable O antigen agglutinating antigen for pullorum disease, said agglutinating antigen being prepared from a SPUL_2404 gene knockout strain of Salmonella pullorum JD02 strain that stably expresses the standard O antigen, and a SPUL_2404 gene overexpressing strain of Salmonella pullorum JD02 strain that stably expresses the variant O antigen.

[0008] Preferably, the ratio of the number of bacteria in the SPUL_2404 gene knockout strain of Salmonella pullorum JD02 to the SPUL_2404 gene overexpression strain of Salmonella pullorum JD02 is 1:2.

[0009] Preferably, the method for constructing the SPUL_2404 gene knockout strain of Salmonella pullorum JD 02 includes the following steps:

[0010] (1) Prepare the SPUL_2404 gene targeting fragment, the sequence of which is shown in SEQ ID NO.2;

[0011] (2) Plasmid pKD46 was transformed into Salmonella pullorum strain JD 02, and recombinant strain JD02 / pKD46 was obtained by ampicillin resistance screening;

[0012] (3) The SPUL_2404 gene targeting fragment was transferred into the recombinant strain JD 02 / pKD46. Positive homologous recombinant strains were obtained by chloramphenicol resistance screening. Then, the pCP20 plasmid was transferred to remove the chloramphenicol resistance gene to obtain the SPUL_2404 gene knockout strain.

[0013] Preferably, the method for constructing the Salmonella pullorum JD 02 strain overexpressing the SPUL_2404 gene includes: constructing an expression plasmid containing the J23119 promoter (SEQ ID NO.3) and the SPUL_2404 gene, and transforming the expression plasmid into the Salmonella pullorum JD 02 strain.

[0014] Compared with existing technologies, this invention has the following advantages: Current chicken pullorum agglutination antigens are prepared by combining standard and variant strains of *Salmonella pullorum* in a fixed ratio. However, with changes in passage and culture conditions, the strains used to prepare *Salmonella pullorum* agglutination antigens are unstable, exhibiting interconversion between the standard and variant forms. This leads to variations in the components of the chicken pullorum agglutination antigen prepared from this bacterium, resulting in insufficient stability and affecting detection accuracy. This invention, based on the initial identification of the key enzymes involved in the interconversion between the standard and variant forms of *Salmonella pullorum*, utilizes a combination of genetic engineering and immunological techniques to screen for strains with high immunogenicity. Furthermore, based on these strains, stable standard and variant strains with O antigen are constructed, allowing control over the antigen components from the strain itself, effectively improving the stability of the agglutination antigen detection reagent. Attached Figure Description

[0015] Figure 1 Electrophoresis images of amplified products of the target fragment from the upstream and downstream homologous arms of the SPUL_2404 gene in the chloramphenicol resistance band. M: DL2000 Marker; 1: Amplified product of the target fragment.

[0016] Figure 2 Electrophoresis diagram of the resistance gene replacing the SPUL_2404 gene. M: DL5000 Marker; 1: JD 02 wild-type strain; 2: negative control; 3: recombinant JD 02 / △SPUL_2404-Cm.

[0017] Figure 3 : Identification diagram of the outer primers for the SPUL_2404 gene deletion strain. M: DL5000 Marker; 1: JD 02 wild-type strain; 2: JD 02 / △SPUL_2404.

[0018] Figure 4 Electrophoresis images of pCDF-J23 and SPUL_2404 amplified fragments.

[0019] Figure 5 Identification of overexpression plasmid pCDF-J23-SPUL_2404. M: DL5000 Marker; 1: pCDF-J23 control; 2: negative control; 3-6: overexpression plasmid pCDF-J23-SPUL_2404.

[0020] Figure 6 Sensitivity detection of Salmonella pullorum agglutination antigen. The self-made antigen was prepared by mixing JD 02 / △SPUL_2404 and JD02 / SPUL_2404-O at a bacterial count ratio of 1:2; the commercial antigen was purchased from the China Institute of Veterinary Drug Control. Positive serum was serially diluted 2-fold horizontally and then tested using the self-made antigen and the commercial antigen respectively.

[0021] Figure 7 : Specific detection of Salmonella pullorum agglutination antigen prepared in fowl. All serum used was prepared from blood collected from SPF chickens. Detailed Implementation

[0022] Example 1: Screening of Antigen-Preparing Strains

[0023] MLST typing was performed on Salmonella pullorum isolated from various parts of the country in the laboratory. Based on the typing results and the source of the strains, six strains were initially screened as candidate strains. Subsequently, two-month-old SPF chickens were immunized with the same dose of the initially screened strains. After collecting blood from the vein and separating the serum, the antibody titer was measured using a Group D Salmonella antibody ELISA kit. The results showed that strain JD 02 had the highest antibody level after immunization, indicating that strain JD 02 had better immunogenicity. Therefore, strain JD 02 was selected as the parent strain for constructing a stable expression of the O antigen for subsequent construction of genetically engineered bacteria.

[0024] Example 2: Construction of a strain stably expressing the O antigen

[0025] 1. Construction of strains stably expressing standard O antigen

[0026] 1.1 Preparation of SPUL_2404 gene targeting fragment

[0027] Using the λ-Red homologous recombination method, based on the gene sequence (SEQ ID NO: 1) of SPUL_2404 in Salmonella pullorum (accession number: CP003047.1) published in GenBank, homologous arm targeting primers were designed: SPUL_2404-F: 5′-AATATATTGGTAGAATTTACATAGAAACCAAAAAAA GACCTAAGTACATAATTAAGAATGAGAAGAAAAATGGTTAATGTGTAGGCT GGAGCTGCTTCG-3′, SPUL_2404-R: 5′-CATTTGTGACATACGATATGTAGGA ATCCCCGCCGCCCGTTACCCATTGGTGGCGGGGAACATTAATTATACATGAA TGCATATGAATATCCTCCTTAG-3′. Using plasmid pKD3 as a template, PCR amplification was performed using Primer STAR high-fidelity polymerase. The specific amplification system was 50 μL, consisting of 25 μL Primer STAR Mix, 2 μL upstream primer, 2 μL downstream primer, 19 μL ddH2O, and 2 μL template. The PCR products were identified by 1% agarose gel electrophoresis, and the results are as follows. Figure 1 As shown, a specific DNA band of approximately 1171 bp (SEQ ID NO.2) was obtained, and the PCR product was recovered by gel extraction using a DNA gel extraction kit.

[0028] 1.2 Preparation of competent cells

[0029] Single colonies of the parental strain of Salmonella pullorum (JD 02 strain, standard type) were inoculated into 3 mL of LB liquid medium and incubated overnight at 37°C and 220 rpm. The next day, the culture was transferred to 30 mL of fresh LB liquid medium at a volume ratio of 1:100 and incubated at 37°C and 220 rpm until OD200 was reached. 600 At approximately 0.5 logarithmic growth phase, the cells were cooled on ice for 30 min, centrifuged at 5000×g for 10 min, the supernatant was discarded, and the cells were resuspended and washed with pre-chilled 10% sterile glycerol to prepare electroporation competent cells. 10 ng of plasmid pKD46 was added to the prepared competent cells, and after incubation on ice for 20 min, the cells were transferred to a pre-chilled 0.1 mm electroporation cuvette and electroporated at 1800 V, 200 Ω. The cells were then plated on ampicillin-resistant LB agar plates and incubated overnight. Positive colonies were identified using universal pKD46 primers. Single colonies that were correctly identified were picked and shaken at 30℃, 200 rpm, until OD500 was reached. 600 At approximately 0.4 hours, 20 mM L-arabinose was added to induce expression for 1 hour, allowing the recombinase in plasmid pKD46 to be fully expressed. Then, competent cells were prepared again using the above method and named JD 02 / pKD46.

[0030] 1.3 Construction and Identification of SPUL_2404 Gene Deletion Strain

[0031] 200 ng of the amplified SPUL_2404 targeting fragment was added to freshly prepared JD 02 / pKD46 competent cells. After incubation on ice for 20 min, electroporation transformation was performed under the conditions described above. The cells were then plated on chloramphenicol-resistant (40 μg / ml) LB agar plates and incubated at 37°C. After colonies emerged, they were identified using the outer primers of the SPUL_2404 gene: O-SPUL_2404-F: 5′-GTTCTGTCATGGGTGGG-3′ and O-SPUL_2404-R: 5′-GCGTATCCTTGCGTGTA-3′. The results are as follows: Figure 2 As shown, the recombinant amplified a band of approximately 1251 bp. The correctly identified recombinant was named JD 02 / ΔSPUL_2404-Cm. Competent cells were prepared again using the above method, and the plasmid pCP20, specifically encoding the FLP site, was electroporated. The cells were plated on double-antibiotic LB agar plates containing ampicillin (50 μg / ml) and chloramphenicol (40 μg / ml), and screened for positive transformants at 30°C. The obtained positive transformants were then transferred to LB liquid medium without any antibiotics, incubated at 30°C for 6 h, then incubated at 42°C for 8 h, and finally streaked onto LB agar plates at 37°C. The resulting single colonies were tested for ampicillin resistance. Single colonies sensitive to ampicillin were selected and identified using the outer primers O-SPUL_2404-F / O-SPUL_2404-R. The results are shown below. Figure 3As shown, the deletion strain amplified a band of approximately 650 bp, successfully constructing the SPUL_2404 gene deletion strain JD 02 / △SPUL_2404.

[0032] 2. Construction of strains stably expressing variant O antigen

[0033] 2.1 Cloning of the SPUL_2404 gene

[0034] The nucleotide sequence of the Salmonella Pullorum sp. 2404 gene is shown in SEQ ID NO: 1 (accession number CP003047.1). Primers were designed based on the SPUL_2404 gene sequence: upstream primer SPUL_2404-F: 5′-AGAAAGAGGAGAAATACTAGATGAGAAGAAAAATGGTTAACAATAGATT-3′; downstream primer SPUL_2404-R: 5′-CTCAGCTAATTAAGCTTTTATTATTTAATTATTTCCGTAATATTCTCAT TTG-3′. Genomic DNA was extracted from Salmonella Pullorum strain C79-3 as a template, and the SPUL_2404 gene was amplified by PCR using the above primers. The PCR reaction system was: PrimerSTAR Mix 25 μL, upstream primer 2 μL, downstream primer 2 μL, ddH2O 19 μL, template 2 μL. The PCR products were identified by 1% agarose gel electrophoresis, and the results are shown below. Figure 4 As shown, a specific DNA band of approximately 1693 bp was obtained, which matches the size of the target DNA fragment. The PCR product was recovered by gel extraction using a DNA gel extraction kit.

[0035] 2.2 Construction of overexpression plasmids

[0036] The pCDF-J23-GFP plasmid was extracted, diluted, and used as a template. Primers were designed based on the location of the GFP fragment to linearize the plasmid for PCR amplification. The upstream primer pCDF-F was 5′-TAAAAGCTTAATTAGCTGAGCTTGGA-3′, and the downstream primer pCDF-R was 5′-CTAGTATTTCTCCTCTTTCTCTAGTGCTAGT-3′. The PCR products were identified and recovered by 1% agarose gel electrophoresis. The results are as follows: Figure 4As shown, a specific DNA band of 2420 bp was obtained, consistent with the size of the target DNA fragment. The recovered product was ligated with the SPUL_2404 gene containing a homologous arm fragment using infusion, transformed into DH5α, plated on antibiotic plates containing 50 μg / ml streptomycin, and positive clones were picked and identified by PCR using universal plasmid primers S-J23-F: 5′-TAGGCGTATCACGAGGCA-3′ and S-J23-R: 5′-TCGGTTCAGGGCAGGGT-3′. The results are shown in the figure. Figure 5 As shown, the recombinant amplified a band of approximately 2057 bp, and sequencing of the PCR product showed that the overexpression plasmid pCDF-J23-SPUL_2404 was successfully constructed.

[0037] 2.3 Construction of overexpression strains

[0038] Pick a single colony of JD 02, incubate overnight at 37°C and 200 rpm, and the next day transfer it to 50 ml of LB liquid medium at a 1:100 volume ratio. Incubate for approximately 4 hours until OD (Organic Degradation) is observed. 600 After reaching a viscosity of 0.5-0.6, electroporation competent cells were prepared according to the above method. 10 ng of the correctly identified plasmid pCDF-J23-SPUL_2404 was added, and after incubation on ice for 20 min, the cells were transferred to a pre-chilled 0.1 mm electroporation cuvette and electroporated at 1800 V and 200 Ω. Immediately after electroporation, 800 μl of pre-chilled LB broth was added, and the cells were shaken at 37℃ and 200 rpm for 1 h to rejuvenate. The cells were then plated on streptomycin-resistant (50 μg / ml) LB plates and incubated overnight. Positive clones were identified, and RNA was extracted and reverse transcribed to determine the expression level of SPUL_2404. The results showed that the chicken pullorum variant strain JD 02 / SPUL_2404-O, stably expressing the SPUL_2404 gene, was successfully constructed. Example 3: Identification and stability analysis of serotypes of JD 02 / △SPUL_2404 and JD 02 / SPUL_2404-O strains.

[0039] JD 02 / △SPUL_2404 and JD 02 / SPUL_2404-O were continuously passaged with the parent strain JD 02. After 40 passages, single colonies were picked and streaked onto Martin agar plates and incubated overnight at 37°C. 100 single colonies from each strain were then transferred to an appropriate amount of physiological saline to adjust the bacterial concentration to approximately 1.0 × 10⁻⁶. 10CFU / ml. Take a clean glass slide, and use a pipette to drop 25 μl of Salmonella O122 serum and O123 serum (purchased from the China Institute of Veterinary Drug Control) onto the slide. Then, add 25 μl of bacterial suspension to each of the O122 and O123 serums, and gently shake the slide to mix thoroughly. Determine the results after 2 minutes. As shown in Table 1, among 100 single colony subclones of the parent strain JD 02, 17 clones reacted with the variant serum (O122), and 87 clones reacted with the standard serum (O123). Among these, 4 clones showed agglutination reactions with both O122 and O123 serums. All 100 single colony subclones of strain JD 02 / △SPUL_2404 reacted only with the standard serum (O123), and all 100 single colony subclones of strain JD 02 / SPUL_2404-O reacted only with the variant serum (O122). Both strains showed good O antigen stability.

[0040] Table 1. Antigen stability analysis of Salmonella pullorum JD 02 / ΔSPUL_2404 and JD 02 / SPUL_2404-O.

[0041]

[0042] Note: O122+O123 indicates that it can agglutinate with both O122 serum and O123 serum.

[0043] Example 4: Preparation and detection of Salmonella pullorum agglutination antigen in chickens

[0044] 4.1 Preparation of Agglutinated Antigen

[0045] The constructed strains JD 02 / △SPUL_2404 and JD 02 / SPUL_2404-O were streaked onto LB and LB+streptomycin plates (50 μg / ml) respectively and incubated at 37℃ for 12 h. Single colonies were picked and streaked onto the corresponding LB plates and incubated at 37℃ for 24 h. After ensuring no contamination, the bacterial cells on the plates were washed off with Martin broth and transferred to Martin agar plates, about 5 ml per plate. The transfer was spread evenly with a spreader and incubated upright at 37℃ for 24 h. After that, the plates were flipped and incubated upside down for another 24 h. After 48 hours, PBS containing 1% formalin was added to each petri dish to wash off the bacterial cells. The dishes were then incubated at 37°C for 24 hours for inactivation, with several agitations during inactivation to ensure complete inactivation. Two times the solution volume of anhydrous ethanol was then added, and the mixture was shaken well and allowed to settle naturally for 3-5 days. The supernatant was carefully removed, and the precipitate was centrifuged, washed once with PBS containing 10% glycerol, and resuspended. The bacterial concentration was adjusted to approximately 1.5 × 10⁻⁶. 10CFU / ml. Add crystal violet to a final concentration of 0.02%, and mix thoroughly by low-speed stirring. Mix the prepared antigens JD 02 / △SPUL_2404 and JD 02 / SPUL_2404-O at a bacterial count ratio of 1:2 to obtain the pullorum antigen.

[0046] 4.2 Sensitivity and Specificity Analysis

[0047] Positive serum from chicken pullorum disease was serially diluted twofold. The diluted serum was then tested using a self-prepared chicken pullorum agglutination antigen and a chicken pullorum-typhoid plate agglutination antigen purchased from the China Institute of Veterinary Drug Control, respectively. The results are as follows: Figure 6 As shown, the agglutination antigen from the China Institute of Veterinary Drug Control produced weak agglutination (+) after a 32-fold dilution of positive serum, while the self-made agglutination antigen still produced strong agglutination (++) even at a 128-fold dilution, indicating that the self-made mixed antigen exhibited stronger sensitivity. Simultaneously, positive sera with clear backgrounds, including Salmonella typhimurium, Salmonella typhimurium, Salmonella auriculata, and Escherichia coli, were used to test the specificity of the self-made pullorum antigen. Figure 7 As shown, the self-made chicken pullorum agglutination antigen only produced weak agglutination with positive serum of Salmonella typhimurium, and did not produce agglutination with serum of Salmonella typhimurium, Salmonella duckii, Escherichia coli, etc., showing good specificity.

[0048] 4.3 Judgment Criteria

[0049] Take 25 μl of the mixed agglutinated antigen and add it to a clean, transparent glass plate. Then add an equal volume of serum and mix thoroughly. Spread the mixture into a circle with a diameter of approximately 1.5 cm. Incubate at room temperature and read the reaction results within 2 minutes for judgment. The judgment criteria are as follows:

[0050] - The liquid is a uniform blue color with no particulate matter precipitated, indicating a negative result for pullorum disease in chickens;

[0051] +: A small amount of fine particulate matter precipitates out, and the solution remains blue, indicating suspected infection with pullorum disease in chickens. ELISA combination is recommended.

[0052] ++: Obvious blue particles are precipitated, and the liquid still shows a slight blue color, indicating a positive result for pullorum disease in chickens;

[0053] +++: Large blue particles precipitate out, the liquid becomes transparent, and the chickens test positive for pullorum disease.

Claims

1. A O antigen stabilized chicken pullorum agglutination antigen, characterized in that, The agglutination antigen was prepared from a SPUL_2404 gene knockout strain of Salmonella pullorum JD02 and a SPUL_2404 gene overexpression strain of Salmonella pullorum JD02. The nucleotide sequence of the SPUL_2404 gene is shown in SEQ ID NO.

1.

2. The chicken pullorum agglutination antigen according to claim 1, characterized in that, The ratio of the number of bacteria in the *Salmonella pullorum* JD 02 strain with the SPUL_2404 gene knockout strain to the number of bacteria in the *Salmonella pullorum* JD 02 strain with the SPUL_2404 gene overexpression strain was 1:

2.

3. The chicken pullorum agglutination antigen according to claim 1, characterized in that, The method for constructing the SPUL_2404 gene knockout strain of Salmonella pullorum JD 02 includes the following steps: (1) Prepare the SPUL_2404 gene targeting fragment, the sequence of which is shown in SEQ ID NO.2; (2) Plasmid pKD46 was transformed into Salmonella pullorum strain JD 02, and recombinant strain JD 02 / pKD46 was obtained by ampicillin resistance screening; (3) The SPUL_2404 gene targeting fragment was transferred into the recombinant strain JD 02 / pKD46. Positive homologous recombinant strains were obtained by chloramphenicol resistance screening. Then, the pCP20 plasmid was transferred to remove the chloramphenicol resistance gene to obtain the SPUL_2404 gene knockout strain.

4. The chicken pullorum agglutination antigen according to claim 1, characterized in that, The method for constructing the SPUL_2404 gene overexpressing strain of Salmonella pullorum JD 02 includes constructing an expression plasmid containing the J23119 promoter and the SPUL_2404 gene, and transforming the expression plasmid into Salmonella pullorum JD 02.

5. The use of the chicken pullorum antigen according to any one of claims 1 to 4 in the preparation of chicken pullorum detection reagent.

Images