A fluorescent quantitative PCR detection kit for rapidly distinguishing Salmonella pullorum standard type / variant type strains

The expression level of the key enzyme SPUL_2404 gene in standard and variant strains of Salmonella pullorum was detected by real-time quantitative PCR, which solved the problems of low sensitivity and high subjectivity in the identification of Salmonella pullorum subtypes in the existing technology and achieved rapid and accurate identification results.

CN117821624BActive Publication Date: 2026-07-21INST OF ANIMAL SCI & VETERINARY HUBEI ACADEMY OF AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
INST OF ANIMAL SCI & VETERINARY HUBEI ACADEMY OF AGRI SCI
Filing Date
2023-12-29
Publication Date
2026-07-21

AI Technical Summary

Technical Problem

Existing technologies for identifying different subtypes of Salmonella pullorum in chickens suffer from low sensitivity, high subjectivity, and a tendency to make errors in result determination.

Method used

The expression levels of the key enzyme SPUL_2404 gene between the standard and variant strains of Salmonella pullorum were detected by quantitative real-time PCR using a quantitative real-time PCR detection kit.

Benefits of technology

It enables rapid, sensitive, and accurate identification of Salmonella pullorum subtypes, overcoming the shortcomings of traditional methods and improving detection efficiency and accuracy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0004646133590000051
    Figure BDA0004646133590000051
  • Figure BDA0004646133590000061
    Figure BDA0004646133590000061
  • Figure BDA0004646133590000081
    Figure BDA0004646133590000081
Patent Text Reader

Abstract

The application discloses a fluorescent quantitative PCR detection kit for rapidly distinguishing standard type / variant type strains of chicken white dysentery salmonella, and the kit is designed and screened according to the difference in the expression amount of a key enzyme SPUL_2404 gene of the standard type and the variant type strains of chicken white dysentery salmonella, and the specific fluorescent quantitative PCR primer of the gene is screened out; and the ratio of the expression amount of the SPUL_2404 gene of the detected strain to the expression amount of the SPUL_2404 gene of the standard type strain standard is used to determine whether the detected strain is the standard type or the variant type. The kit has high detection reaction sensitivity and strong accuracy, and can get rid of the problems of low sensitivity and strong subjectivity of a traditional serological identification method.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of veterinary microbiology technology, specifically relating to a rapid fluorescence quantitative PCR detection kit for distinguishing between standard and variant strains of Salmonella pullorum. Background Technology

[0002] Pullorum disease (CPD) is an acute infectious disease caused by Salmonella pullorum, characterized by septicemia and chronic latent infection. It is classified as a Class II animal disease. It primarily affects chicks aged 2-3 weeks, severely impacting their survival rate and posing a significant risk of reduced egg production in adult chickens. Both vertical and horizontal transmission play crucial roles in CPD outbreaks. Eggs from infected breeder hens have a carrier rate as high as 33%. Therefore, planned testing and culling of breeder hens and their eggs to interrupt vertical transmission routes are key to controlling the disease.

[0003] Salmonella pullorum mainly comprises two serotypes: the standard type and the variant type. When developing diagnostic reagents or vaccines for pullorum disease, it is necessary to identify these different subtypes. Currently, methods for identifying different subtypes of Salmonella pullorum include serological typing, ammonium sulfate precipitation typing, and colony morphology typing. Serological typing is relatively simple to perform, but it is highly subjective and requires large amounts of O122 and O123 single-factor sera, which are cumbersome to prepare, have unstable quality, and are expensive. Ammonium sulfate precipitation typing relies on visual observation of turbidity, which is prone to error. Colony morphology typing determines the subtype by observing the morphology of colonies on a specific culture medium; however, different subtypes have atypical colony morphologies, making them easily confused. Therefore, this invention, based on the identification of the key enzyme in the transition from the standard to the variant type of Salmonella pullorum, has developed a real-time quantitative PCR kit for detecting the expression level of this enzyme, used for the identification of the standard and variant types of Salmonella pullorum. Summary of the Invention

[0004] To overcome the problems of low sensitivity and high subjectivity in traditional serological identification of different subtypes of Salmonella pullorum, this invention provides a real-time PCR detection kit that identifies the standard or variant strain based on the difference in expression levels of the SPUL_2404 gene, a key enzyme in the transformation of standard and variant Salmonella pullorum strains.

[0005] To achieve the above objectives, the present invention adopts the following technical measures:

[0006] A rapid real-time PCR detection kit for distinguishing between standard and variant strains of Salmonella pullorum, containing the following components:

[0007] The nucleotide sequences of the real-time PCR primers for the SPUL_2404 gene are shown in SEQ ID NO.1 and 2.

[0008] The nucleotide sequences of the fluorescent quantitative PCR primers for the internal reference gene gapA are shown in SEQ ID NO.3 and 4.

[0009] Standard strain of Salmonella pullorum: Standard strain CVCC519;

[0010] Standard strain of Salmonella pullorum variant: Standard strain CVCC529;

[0011] Negative control: sterile water;

[0012] SYBR Green real-time PCR amplification buffer.

[0013] The above-mentioned quantitative real-time PCR detection kit distinguishes between standard and variant strains of Salmonella pullorum as follows:

[0014] 1. Determine the expression level of the SPUL_2404 gene in the tested Salmonella pullorum, the standard strain of Salmonella pullorum, and the standard strain of Salmonella pullorum variant.

[0015] Preferably, the reaction parameters are: 95℃ for 5 min, then 95℃ for 10 sec, 60℃ for 30 sec, for 45 cycles, wherein fluorescence detection is performed at 60℃; the threshold is set so that the threshold line just exceeds the highest point of the amplification curve of the normal negative sample.

[0016] 2. Calculate the Ct value (threshold cycle, the number of cycles required for the fluorescence signal in each reaction tube to reach the set threshold) of each group of fluorescence quantitative quantification. -ΔΔCt Value, 2 -ΔΔCt This indicates the fold change in the expression level of the SPUL_2404 gene in the tested strain (or variant strain standard) relative to the standard strain standard, based on 2 -ΔΔCt Value judgment result:

[0017] -ΔΔCt=(Ct1-Ct2)-(Ct3-Ct4)

[0018] Ct1: Critical cycle number of the SPUL_2404 gene in the standard strain;

[0019] Ct2: Critical cycle number of the gapA gene in the standard strain;

[0020] Ct3: Critical cycle number of the SPUL_2404 gene of the tested strain or the standard of the variant strain;

[0021] Ct4: Critical cycle number of the gapA gene in the tested strain or the standard of the variant strain;

[0022] (1) Quality control standards:

[0023] Negative control: No Ct value, no amplification curve;

[0024] Standard strain of Salmonella pullorum: SPUL_2404 gene and gapA gene Ct value ≤30, amplification curve shows obvious logarithmic growth;

[0025] Standard for Salmonella pullorum variant strains in chickens: Ct values ​​of SPUL_2404 gene and gapA gene ≤30, and the amplification curve shows obvious logarithmic growth;

[0026] The fold increase in gene expression level of the variant strain standard SPUL_2404 relative to the standard strain standard SPUL_2404 (2) -ΔΔCt The value is greater than 7.73;

[0027] If any result of the negative control or standard does not meet the standard, the test is invalid.

[0028] (2) Judgment result:

[0029] Provided the test results are valid, when the Ct values ​​of the SPUL_2404 gene and gapA gene of the tested strain are ≤35.0, and a specific amplification curve appears, its 2 -ΔΔCt A value greater than 7.73 is considered a variant; when the Ct values ​​of the SPUL_2404 gene and gapA gene of the tested strain are ≤35.0, and a specific amplification curve appears, its 2 -ΔΔCt A value less than 2.04 indicates a standard type; when the Ct values ​​of the SPUL_2404 gene and gapA gene of the tested strain are ≤35.0, and a specific amplification curve appears, its 2 -ΔΔCt When the value is greater than or equal to 2.04 and less than or equal to 7.73, further determination by serological method is required.

[0030] Compared with existing technologies, this invention has the following advantages and effects: Identification of different subtypes of Salmonella Pullorum mainly relies on serum, and result judgment is primarily based on visual observation. This judgment is highly subjective and prone to error, and currently, there is no rapid, sensitive, and accurate detection method or standard. Based on the identification of the key enzymes in the transformation from the standard to variant forms of Salmonella Pullorum, this invention develops a quantitative real-time PCR kit for detecting the expression levels of these key enzymes, and applies it to the identification of both the standard and variant forms of Salmonella Pullorum. This invention offers high sensitivity and accuracy, clear result judgment standards, and a rapid and efficient detection process, overcoming the problems of low sensitivity and high subjectivity inherent in traditional serological identification methods. Attached Figure Description

[0031] Figure 1 Amplification curves of the gapA and SPUL_2404 genes of Salmonella pullorum standard strain CVCC519.

[0032] Figure 2 Amplification curves of the gapA and SPUL_2404 genes of Salmonella pullorum variant standard strain CVCC529 Detailed Implementation

[0033] The present invention will be further described below with reference to the accompanying drawings and specific embodiments. These embodiments are only used to illustrate the present invention and are not intended to limit the scope of the present invention.

[0034] Example 1: Quantitative real-time PCR of standard and variant Salmonella pullorum in chickens. -ΔΔCt Threshold determination

[0035] The threshold for identifying standard and variant strains was determined by measuring the relative expression levels of the SPUL_2404 gene in 15 standard strains and 15 variant strains of Salmonella pullorum.

[0036] I. Bacterial Culture

[0037] The 15 selected standard strains included 3 standard strains (CVCC519, CVCC523, CVCC533) and 12 clinical isolates with identified serotypes: TC07, KQ58, HF60, WX47, XY83, XY84, WH59, WH61, JD04, HA05, YC06 and WH72.

[0038] The 15 variant strains selected included 3 standard strains (CVCC529, CVCC530, CVCC532) and 12 clinical isolates with identified serotypes: JD11, YZ12, QD14, RZ15, WH83, WH85, HS77, HS79, GC92, JS104, JS106 and DY157.

[0039] The purified strain was streaked onto SS agar plates and incubated overnight at 37°C. Single colonies were then picked and inoculated onto SS liquid medium. After incubation at 37°C for 12 hours, the bacterial cells were collected for the next step of the experiment.

[0040] II. Preparation of bacterial RNA templates and reverse transcription

[0041] RNA was extracted from the above-mentioned bacterial strain using an RNA extraction kit, following the instructions in the manufacturer's manual. The extracted bacterial RNA was then reverse transcribed into cDNA using a reverse transcription kit, following the instructions in the manufacturer's manual. Enzyme-free double-distilled water was used as a negative control.

[0042] III. Prepare the fluorescence quantitative PCR detection reaction system according to the following composition:

[0043] 2×SYBR Green qPCR Mix 12.5μl 10mM primers SPUL_2404-F, SPUL_2404-R 1 μl each or gapA-F, gapA-R 1 μl each cDNA template (100 ng / μl) 1μl <![CDATA[Deionized H2O]]> Add to 25μl

[0044] Specific primer sequences include:

[0045] SPUL_2404-F:5'CTGATTGGCGTATTCGGATCT 3'

[0046] SPUL_2404-R:5'GTATTGTAGACGCACGGGATAG 3'

[0047] gapA-F:5'GTTCTGACGGTCCATCTAAAG 3'

[0048] gapA-R:5'GATGTCCTGGCCTTCGTATTT 3'

[0049] Primers were synthesized by Shanghai Sangon Biotech Co., Ltd.

[0050] IV. Real-time PCR Reaction Conditions

[0051] The reaction was performed on a real-time PCR instrument using the SYBR Green fluorescence signal. The reaction parameters were: 95℃ for 5 min, then 95℃ for 10 sec, 60℃ for 30 sec, for 45 cycles, with fluorescence detection performed at 60℃. The threshold was set so that the threshold line just exceeded the highest point of the amplification curve of the normal negative sample (enzyme-free double-distilled water).

[0052] V. Test Results

[0053] Using the standard strain CVCC519 as a control, the Ct value (threshold cycle, the number of cycles required for the fluorescence signal in each reaction tube to reach the set threshold) of each group's quantitative fluorescence was used to calculate 2. -ΔΔCt Value. 2 -ΔΔCt This indicates the fold change in the expression level of the SPUL_2404 gene in the tested strain (or the variant strain standard) relative to the standard strain CVCC519.

[0054] -ΔΔCt=(Ct1-Ct2)-(Ct3-Ct4)

[0055] Ct1: Critical cycle number of the SPUL_2404 gene in the standard strain CVCC519;

[0056] Ct2: Critical cycle number of the gapA gene in the standard strain CVCC519;

[0057] Ct3: Critical cycle number of the SPUL_2404 gene in the tested strain;

[0058] Ct4: Critical cycle number of the gapA gene in the tested strain;

[0059] The results are as follows:

[0060]

[0061]

[0062] The threshold for standard strains is: Standard strain 2 -ΔΔCt Maximum value + 2SD, i.e., 1.56 + 2 × 0.24 = 2.04

[0063] The threshold for variant strains is: Variant strain 2 -ΔΔCt Minimum value - 2SD, i.e., 13.55 - 2 × 2.91 = 7.73

[0064] The threshold is set as follows: Standard strain 2 -ΔΔCt Value < 2.04, variant strain 2 -ΔΔCt Value > 7.73, when the tested strain 2 -ΔΔCt When the value is ≥2.04 and ≤7.73, further determination by serological method is required.

[0065] Example 2: Identification of serotypes of Salmonella pullorum CVCC standard strain using quantitative real-time PCR.

[0066] Five Salmonella pullorum CVCC standard strains were detected using the established real-time PCR method.

[0067] I. Bacterial Culture

[0068] The five Salmonella pullorum CVCC standard strains selected were CVCC523, CVCC530, CVCC532, CVCC533 and CVCC1861.

[0069] The purified strain was streaked onto SS agar plates and incubated overnight at 37°C. Single colonies were then picked and inoculated onto SS liquid medium. After incubation at 37°C for 12 hours, the bacterial cells were collected for the next step of the experiment.

[0070] II. Preparation of bacterial RNA templates and reverse transcription

[0071] RNA was extracted from the above-mentioned strains using an RNA extraction kit, following the instructions in the kit's manual. The extracted strain RNA was then reverse transcribed into cDNA using a reverse transcription kit, following the instructions in the kit's manual. Simultaneously, a standard control of *Salmonella pullorum* strain CVCC519, a standard control of *Salmonella pullorum* variant strain CVCC529, and an enzyme-free double-distilled water (negative) control were established.

[0072] III. Prepare the fluorescence quantitative PCR detection reaction system according to the following composition:

[0073] 2×SYBR Green qPCR Mix 12.5μl 10mM primers SPUL_2404-F, SPUL_2404-R 1 μl each or gapA-F, gapA-R 1 μl each cDNA template (100 ng / μl) 1μl <![CDATA[Deionized H2O]]> Add to 25μl

[0074] Specific primer sequences include:

[0075] SPUL_2404-F:5'CTGATTGGCGTATTCGGATCT 3'

[0076] SPUL_2404-R:5'GTATTGTAGACGCACGGGATAG 3'

[0077] gapA-F:5'GTTCTGACGGTCCATCTAAAG 3'

[0078] gapA-R:5'GATGTCCTGGCCTTCGTATTT 3'

[0079] Primers were synthesized by Shanghai Sangon Biotech Co., Ltd.

[0080] IV. Real-time PCR Reaction Conditions

[0081] The reaction was performed on a real-time PCR instrument using the SYBR Green fluorescence signal. The reaction parameters were: 95℃ for 5 min, then 95℃ for 10 sec, 60℃ for 30 sec, for 45 cycles, with fluorescence detection performed at 60℃. The threshold was set so that the threshold line just exceeded the highest point of the amplification curve of the normal negative sample (enzyme-free double-distilled water).

[0082] V. Test Results:

[0083] The test results showed that among the five Salmonella pullorum CVCC standard strains, two were standard serotypes and three were variant serotypes, consistent with the serological test results. Specific results are as follows:

[0084]

[0085] Example 3: Identification of serotypes of clinically isolated Salmonella pullorum strains using quantitative real-time PCR. The established quantitative real-time PCR method was used to detect eight clinically isolated Salmonella pullorum strains.

[0086] I. Preparation of bacterial DNA templates

[0087] The eight clinical isolates of Salmonella pullorum selected were: TC03, HF60, WX46, YZ01, JD07, GC80, JS92, and DY153.

[0088] DNA was extracted from the above-mentioned strains using a DNA extraction kit, following the instructions. A standard control of Salmonella pullorum strain CVCC519, a standard control of Salmonella pullorum variant strain CVCC529, and an enzyme-free double-distilled water (negative) control were also established.

[0089] II. Prepare the fluorescence quantitative PCR detection reaction system according to the following composition:

[0090] 2×SYBR Green qPCR Mix 12.5μl 10mM primers SPUL_2404-F, SPUL_2404-R 1 μl each or gapA-F, gapA-R 1 μl each cDNA template (100 ng / μl) 1μl <![CDATA[Deionized H2O]]> Add to 25μl

[0091] Specific primer sequences include:

[0092] SPUL_2404-F:5'CTGATTGGCGTATTCGGATCT 3'

[0093] SPUL_2404-R:5'GTATTGTAGACGCACGGGATAG 3'

[0094] gapA-F:5'GTTCTGACGGTCCATCTAAAG 3'

[0095] gapA-R:5'GATGTCCTGGCCTTCGTATTT 3'

[0096] Primers were synthesized by Shanghai Sangon Biotech Co., Ltd.

[0097] III. Real-time PCR reaction conditions:

[0098] The reaction was performed on a real-time PCR instrument using the SYBR Green fluorescence signal. The reaction parameters were: 95℃ for 5 min, then 95℃ for 10 sec, 60℃ for 30 sec, for 45 cycles, with fluorescence detection performed at 60℃. The threshold was set so that the threshold line just exceeded the highest point of the amplification curve of the normal negative sample (enzyme-free double-distilled water).

[0099] IV. Test Results:

[0100] The test results showed that among the eight clinical isolates of Salmonella pullorum, four were standard type and four were variant type. The serological identification results were consistent with the results of quantitative real-time PCR. Specific results are as follows:

[0101]

Claims

1. The application of real-time PCR primers for detecting the expression level of the SPUL_2404 gene in Salmonella pullorum in the preparation of a rapid detection kit for distinguishing between standard / variant strains of Salmonella pullorum, characterized in that, The nucleotide sequences of the fluorescent quantitative PCR primers for the SPUL_2404 gene are shown in SEQ ID NO.1 and 2.

2. The application according to claim 1, characterized in that, The kit also contains a quantitative real-time PCR primer for the internal reference gene gapA, a standard strain of Salmonella pullorum and a standard strain of Salmonella pullorum, and a negative control. The nucleotide sequence of the quantitative real-time PCR primer for the internal reference gene gapA is shown in SEQ ID NO. 3 and 4. The standard strain of Salmonella pullorum is CVCC519, the standard strain of Salmonella pullorum is CVCC529, and the negative control is sterile water.

3. The application according to claim 1, characterized in that, The method for distinguishing between standard and variant strains of Salmonella Pullorum is as follows: The expression levels of the SPUL_2404 gene in the tested Salmonella Pullorum, the standard strain of Salmonella Pullorum, and the variant strain of Salmonella Pullorum are measured. If the fold increase in the expression level of the SPUL_2404 gene in the tested Salmonella Pullorum relative to the standard strain's SPUL_2404 gene is less than 2.04, then the tested Salmonella Pullorum is the standard type; if the fold increase in the expression level of the SPUL_2404 gene in the tested Salmonella Pullorum relative to the standard strain's SPUL_2404 gene is greater than 7.73, then the tested Salmonella Pullorum is the variant type.