A microfluidic chip-based spatial three-dimensional genomics sequencing method and application thereof

Abstract

The application discloses a spatial three-dimensional genomics sequencing method based on a microfluidic chip and application thereof. The method of the application segments the molecular labeling process of a tissue slice, that is, through a "overall labeling-partial lysis-partial labeling-overall lysis" process, the tissue slice is first labeled at a micron level in a spatial position, then the tissue slice is broken into a nanometer level protein-nucleic acid complex through ultrasonic crushing, and the macromolecular complex is individually labeled at a nanometer level, finally, the macromolecular complex is lysed to obtain DNA molecules containing spatial position information and chromatin conformation information, and then the library is sequenced. The method of the application can effectively combine the resolution from the micron level which can be visualized and the base length level which cannot be visualized for analysis, and can be applied to the development or preparation of disease detection products or observation of organ development products.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a method for spatial three-dimensional genomic sequencing based on microfluidic chips and its applications. Background Technology

[0002] In life processes, the three-dimensional genome is a crucial component besides the transcriptome, playing a key role in organ development, lymphoma formation, and leukemia development. Therefore, in-depth exploration of the three-dimensional conformation of chromatin is of great biological significance for a systematic understanding of key biological issues such as disease development and organ evolution. Currently, although some commercial sequencing methods can perform high-throughput sequencing of the spatial transcriptome, these methods are concentrated on this single omics, lacking a mature system for other omics research. Furthermore, scientific research in spatial omics is still in its early stages, with some progress achieved only in areas such as genomics, proteomics, and epigenomics. High-throughput sequencing solutions for three-dimensional genomics are still lacking.

[0003] Currently, the basic procedure for adding molecular markers in all existing space omics protocols involves first regionalizing the entire tissue slice with spatial barcode information, and then lysing the tissue to obtain protein or nucleic acid molecules with spatial barcode information. However, this procedure can only distinguish all target molecules at the sub-micron level at best, and cannot further improve the resolution. Summary of the Invention

[0004] The technical problem to be solved by this invention is how to detect the three-dimensional conformation of chromatin in different spatial locations of tissue sections and / or how to perform high-throughput spatial three-dimensional genomics sequencing.

[0005] In all existing space omics protocols, the basic procedure for adding molecular markers involves first regionalizing the entire tissue slice with spatial barcode information, and then lysing the tissue to obtain protein or nucleic acid molecules with spatial barcode information. However, this procedure can only distinguish all target molecules at the sub-micron level at best, and cannot further improve the resolution.

[0006] To address the aforementioned technical problems, the present invention first provides a method for detecting the three-dimensional spatial genome conformation of chromatin, the method comprising the following steps:

[0007] A1) Crosslinking and fixation: After the tissue section to be tested is attached and assembled with the reaction cell of the PDMS (polydimethylsiloxane) chip, a crosslinking agent is added to the reaction cell to crosslink the tissue section to obtain a tissue section with fixed nucleic acid and protein conformations; the structure of the chip includes the reaction cell.

[0008] A2) Cell permeabilization: Permeabilize the tissue section to be tested in the reaction chamber to obtain a permeabilized tissue section to be tested;

[0009] A3) Nucleic acid adapter ligation: In the reaction chamber, the nucleic acid in the permeabilized tissue section to be tested is double-digested with enzymes and nucleic acid adapters are added to obtain a tissue section with added nucleic acid adapters; the tissue section with added nucleic acid adapters is separated from the PDMS chip to obtain a separated tissue section with added nucleic acid adapters;

[0010] A5) Spatial Position Overall Marking: The separated tissue slices with added nucleic acid adapters are assembled with a microfluidic chip to obtain an assembled microfluidic chip. The microfluidic chip includes a sample loading port, a central area, and a sample outlet. The central area of ​​the assembled microfluidic chip is attached to the separated tissue slices with added nucleic acid adapters. A mixture of i X-labeled solutions (X1-Xi) is added to the sample inlet channel and the mixture is drawn into the central area using a vacuum pump to add i barcode labels to the nucleic acids of the tissue slices with added nucleic acid adapters in the X-axis direction within the microfluidic chip. A tissue slice labeled in the X-axis direction is obtained. Then, a mixture of i Y-labeled solutions (Y1-Yj) is added to the sample inlet channel and a vacuum pump is used to draw the mixture to the central region. This adds j barcode labels to the nucleic acids in the X-axis-labeled tissue slice in the Y-axis direction within the microfluidic chip, resulting in a spatially labeled tissue slice. The X-axis direction is perpendicular to the Y-axis direction. The spatially labeled tissue slice is marked with i×j pixels, and the nucleic acid in each pixel contains different combinations of barcodes X and Y. i Y j The X label and the Y label have different fluorescent groups, and the different fluorescent groups produce different colors of fluorescence under the action of excitation light; i is a natural number greater than 1 and less than or equal to the number of injection port channels, and j is a natural number greater than 1 and less than or equal to the number of injection port channels.

[0011] A6) Ultrasonic disruption of spatially marked tissue sections: The spatially marked tissue sections are ultrasonically disrupted to obtain lysis products containing protein-nucleic acid complexes;

[0012] A7) NHS activated magnetic bead coupling: The protein-nucleic acid complex in the lysis product is coupled with NHS activated magnetic beads to obtain a complex coupled with NHS activated magnetic beads.

[0013] A8) Partial Labeling: The nucleic acids in the complex coupled with NHS activated magnetic beads were added with k different barcode labels in each round of n rounds of "dispersion-mixing" steps using the SPLiT-seq method, resulting in k labeled samples. nA complex of tandemly combined barcodes, wherein different nucleic acids of the complex may contain k n Different types of serially combined barcodes; where n can be a natural number greater than 1 and less than or equal to 5. Where k can be a natural number greater than 1 and less than or equal to 100;

[0014] A9) Reverse crosslinking for overall lysis: The added k n A complex of tandemly combined barcodes is reverse-crosslinked to obtain a decrosslinked nucleic acid fragment. The decrosslinked nucleic acid fragment is then purified to obtain a nucleic acid fragment to be sequenced. The nucleic acid fragment to be sequenced contains the nucleic acid adapter sequence and an X-ray of the spatial location of the nucleic acid fragment on the tissue section to be sequenced. i Y j Barcode sequence and the k n A series of combined barcode sequences;

[0015] A10) Library construction and sequencing: The nucleic acid fragment to be sequenced is amplified using single-stranded random primers to construct a sequencing library. The sequencing library is then sequenced to obtain sequencing data. The sequencing data is analyzed based on the tandemly combined barcode sequence and the X... i Y j Barcode sequences are used to obtain the three-dimensional genomic conformation of chromatin in the tissue section to be tested.

[0016] In the above method, the method of adding n rounds of different barcode markings through n rounds of "dispersion-mixing" steps may include the following steps:

[0017] (A8-1) In the first round of reaction, all the complexes coupled with NHS activated magnetic beads are dispersed into reaction system 1 containing k different barcode tags. The barcode tags of the first round are added to obtain a complex with k different barcode tags. Then, all the complexes with k different barcode tags are mixed to obtain mixture n1. The nucleic acid fragments in the n1 mixture are labeled with k different barcode tags.

[0018] (A8-2) In the second round of reaction, all complexes with k different barcode tags added to mixture n1 are dispersed again into reaction system 2 containing k different barcode tags, and the k different barcode tags from the second round are added to obtain complexes with k different barcode tags added again. Then, the complexes with k different barcode tags added again are mixed to obtain mixture n2; the nucleic acid fragments in mixture n2 carry k... 2 Different types of barcode labels;

[0019] A8-3) In the nth round of reaction, the n (n-1)All complexes containing (n-1) rounds of k different barcode labels are dispersed in the mixture and added to reaction system n containing k different barcode labels. Then, the nth round of k different barcode labels is added to obtain the nth round of complexes containing k different barcode labels. Finally, the nth round of complexes containing k different barcode labels is mixed to obtain n... (n) Mixture; n (n) The nucleic acid fragments in the mixture carry k n Different types of barcode labels.

[0020] The n can be a natural number greater than 1 and less than or equal to 5, and the k can be a natural number greater than 1 and less than or equal to 100.

[0021] In the above method, the reaction cell can be a PDMS (polydimethylsiloxane) single-well chip, and the central hole size can be 0.7cm × 0.7cm or 0.7cm × 1.2cm. In the above method, the microfluidic chip can be a PDMS (polydimethylsiloxane) microfluidic chip.

[0022] In the above method, the double digestion mentioned in A3) can be performed using restriction endonucleases Mse I and HinP1I; the nucleic acid adapter mentioned in A3) can include adapters for Mse I cleavage of sticky ends and adapters for HinP1I cleavage of sticky ends.

[0023] In the above method, the Y label mentioned in A5) may be modified with a biotin group. The purification mentioned in A9) may be performed by adsorption purification using magnetic beads with streptavidin to form a complex with the biotin group to obtain the nucleic acid fragment to be sequenced.

[0024] In the above method, the ultrasonic disruption described in A6) is non-contact ultrasonic disruption, and the time for non-contact ultrasonic disruption can be greater than or equal to 4 minutes and less than or equal to 10 minutes.

[0025] In the above method, the single-end random primer binding amplification may include the following steps: using single-stranded random primers containing 6 random N bases at the 3' end and sequencing adapter sequences at the 5' end, randomly binding to the nucleic acid fragment to be sequenced via annealing to obtain an annealed product; then using DNA polymerase to fully amplify the annealed product to obtain the sequencing library containing two sequencing adapter sequences. The sequence length of the sequencing library can be 350–750 bp. The DNA polymerase can be a Klenow fragment of DNA polymerase with strand displacement activity.

[0026] N can be any one of A, T, C or G.

[0027] To address the aforementioned technical problems, the present invention also provides a method for spatial three-dimensional genomics sequencing, characterized in that: the method may include the steps of obtaining a spatial three-dimensional genomics sequencing library of a tissue slice to be tested using the sequencing library construction method described above, and sequencing the sequencing library.

[0028] The method for constructing sequencing libraries described above also falls within the scope of protection of this invention.

[0029] To address the aforementioned technical problems, the present invention also provides the application of the methods described above in the development or preparation of disease detection products.

[0030] The application of the method described above in the development or preparation of products for observing organ development also falls within the scope of protection of this invention.

[0031] This invention innovatively segments the molecular labeling process of tissue sections. First, the tissue sections are spatially labeled at the micrometer level. Then, the tissue sections are lysed into nanoscale protein-nucleic acid complexes using ultrasonication, and these macromolecular complexes are individually labeled at the nanometer level. Finally, the macromolecular complexes are lysed to obtain DNA molecules containing both spatial location and chromatin conformation information. Through this "overall labeling-partial lysis-partial labeling-overall lysis" process, this invention can effectively combine analysis at both the visible micrometer level and the non-visible base length level, achieving a technological breakthrough currently impossible.

[0032] This invention develops a three-dimensional genome sequencing scheme capable of spatial sequencing of tissue sections. This technical solution has the following advantages:

[0033] ① The method of this invention is the first to realize the detection of three-dimensional genome at the spatial level. Compared with the three-dimensional genome at the tissue level and single cell level, it can provide spatial location information within the tissue, providing a brand-new technical platform for chromatin biology.

[0034] ② Both spatial resolution and coverage area have been improved, covering an area of ​​5mm×5mm to 10mm×5mm. It can be used to detect complete mouse brain tissue slices and embryonic tissue slices within 16 days of development. The area of ​​each detection point is 50μm×50μm to 25μm×25μm.

[0035] ③ The method of the present invention adopts a multi-terminal interaction detection method (SPLIT tag combination), which can detect more intermolecular interactions compared with the Hi-C test scheme of dual-terminal detection.

[0036] ④ Compared with previous tissue-level and single-cell-level methods, the method of the present invention can detect more interchromosomal interactions, providing technical support for analyzing the contribution of chromosome territory to tissue and organogenesis and cell fate determination.

[0037] ⑤ The method of the present invention does not require sophisticated instruments and equipment, the overall process cost is low, and the instruments and molds can be reused repeatedly. Attached Figure Description

[0038] Figure 1 The diagrams show the assembly structures of tissue sections with PDMS chips and tissue sections with PDMS microfluidic chips. A shows the assembly structure of a tissue section with a PDMS reaction cell chip. B shows the assembly structure of a tissue section with a PDMS microfluidic chip (96 wells, 25 μm resolution), including the central region, sample loading port, and sample dispensing port. C shows the assembly structure of a tissue section with a PDMS microfluidic chip (96 wells, 50 μm resolution), including the central region, sample loading port, and sample dispensing port.

[0039] Figure 2 The images show fluorescence detection images after X-axis and Y-axis fluorescent barcode primers were labeled. The top image shows a 100-well, 25 μm resolution reaction apparatus, with the left image showing fluorescence detection after X-axis fluorescent barcode primer labeling and the right image showing fluorescence detection after Y-axis fluorescent barcode labeling. The bottom image shows a 50-well, 50 μm resolution reaction apparatus, with the left image showing fluorescence detection after X-axis fluorescent barcode primer labeling and the right image showing fluorescence detection after Y-axis fluorescent barcode labeling.

[0040] Figure 3 This is a schematic diagram of the overall process of the method of the present invention.

[0041] Figure 4 This represents the library quality control results obtained after gel extraction and fragment sorting. The horizontal and vertical axes represent the proportion of DNA fragments of different lengths, respectively.

[0042] Figure 5 This figure shows the library balance results obtained using pair-end sequencing and the number of tags linked to all sequencing reads. The top graph shows the library balance results, with the horizontal and vertical axes representing the distribution ratio of the four bases at different positions within the 300bp pair-end. Higher dispersion in base distribution indicates poorer balance at that site. Since each round of added barcode primers consists of an identical 7bp linker sequence and a specific 14bp barcode sequence, and the linker sequence has a high proportion of single bases, its base balance is poor. Therefore, the base balance of the linker region can determine the proportion of sequences that have correctly linked the linker sequence. The bottom graph shows the evaluation of the number of tags linked to all reads, with the vertical axis representing the proportion of reads.

[0043] Figure 6 The left and right graphs show heatmaps of interactions between all chromosomes and within a single chromosome at all points in space. The left graph shows the interactions between all chromosomes at all points in space, with the x and y axes representing different chromosome segments, indicating the strength of interactions between segments. The right graph shows the interactions within a single chromosome at all points in space, with the x and y axes representing different chromosome segments, indicating the strength of interactions between segments.

[0044] Figure 7 The figures represent the number of reads, clusters, and interactions for all sites in space. The left figure shows the number of reads for all sites in space, the middle figure shows the number of clusters for all sites in space, and the right figure shows the number of interactions for all sites in space. The horizontal and vertical axes correspond to the horizontal and vertical axes of the spatial sites, respectively.

[0045] Figure 8 The k-means algorithm was used to map the results to UMAP two-dimensional space (left) and embryonic space (right). Different colors in the figure represent different categories of organs or tissues in the space.

[0046] Figure 9 To determine the size of protein-DNA complexes after contact sonication using time gradients of 15s, 40s, and 1min.

[0047] Figure 10 This is a comparative experiment to test DNA restriction enzyme digestion methods. The left image shows the results of fluorescence microscopy after digestion with restriction endonucleases and ligation with fluorescent primers; the fluorescent area is the cell nucleus. The right image shows the results of digestion with DNase I and ligation with fluorescent primers, photographed using the same parameters; no obvious signal is observed in any tissue area.

[0048] Figure 11 The results are a random sample of sequences from this sequencing study. The area within the red box represents the region where the empty adapter is connected.

[0049] Figure 12 The figures show the statistical data obtained from experiments using different ultrasound methods, intensities, and durations. A represents the intrachromosomal left-right ratio and interchromosomal ratio obtained from ultrasound experiments using contact ultrasound at 30W and 40W power for different durations (x-axis) (y-axis). B represents the intrachromosomal left-right ratio and interchromosomal ratio obtained from experiments using non-contact ultrasound at 4 min, 6 min, and 10 min (x-axis) (y-axis).

[0050] Figure 13 The proportion of different sized clusters was obtained by using non-contact ultrasound for 4 min, 6 min, and 10 min (x-axis) (y-axis).

[0051] Figure 14 These are single-stranded primer linker sequences used to generate odd-numbered and even-numbered round primers labeled with NHS magnetic beads. The 5'P modification indicates a primer with phosphorylation at the 5' end.

[0052] Figure 15 These are single-stranded primer adapter sequences used to generate X-direction and Y-direction double-stranded primers for spatial barcode labeling. 5'P modification represents a primer with phosphorylation at the 5' end; TAMRA represents a T base with TAMRA fluorescent modification, TAMRAdT represents a T base with TAMRA fluorescent modification; FAM represents a T base with FAM fluorescent modification, FAMdT represents a T base with FAM fluorescent modification; biotin represents a T base with biotin fluorescent modification, biotindT represents a T base with biotin fluorescent modification. Detailed Implementation

[0053] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0054] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0055] The composition of the experimental reagents used in the embodiments of this invention is as follows:

[0056]

[0057]

[0058]

[0059] The reagents used in the embodiments of this invention are from the following sources:

[0060]

[0061]

[0062] The primer sequences ordered in this embodiment of the invention are shown in Table 1 below:

[0063] Table 1. DNA adapter primer sequences

[0064]

[0065] Note: TAMRAdT represents a T base with TAMRA fluorescent modification group; FAMdT represents a T base with FAM fluorescent modification group; biotindT represents a T base with biotin fluorescent modification group; 5'P modification represents a primer with phosphorylation modification at the 5' end.

[0066] The remaining double-stranded primer sequences are shown below. Figures 14-15 Since there are two types of microfluidic chips, 96-well and 100-well, the table lists the primers used for the 100-well chip. When using the 96-well chip, only the first 96 primers of the corresponding number need to be taken.

[0067] The final primers used in this embodiment of the invention are as follows:

[0068] The following primers were mixed in equimolar amounts and annealed to obtain the primers required for the final experiment:

[0069] The DNA adapter top (Mse I) and the DNA adapter bot in Table 1 were annealed to obtain Mse I-DNA adapter ligation primers with a final concentration of 10 μM. The reaction conditions were as follows: 1× annealing buffer was added to each of the two single-linked primers, and the mixture was mixed in equimolar amounts and heated at 95°C for 3 min, followed by annealing at a rate of 0.1°C / s to finally obtain DNA double-linked primers.

[0070] The DNA adapter top (Hinp1I) and the DNA adapter bot in Table 1 were annealed to obtain Hinp1I-DNA adapter ligation primers with a final concentration of 10 μM. The reaction conditions were as follows: 1× annealing buffer was added to each of the two single-linked primers, and the mixture was mixed in equimolar amounts and heated at 95℃ for 3 min, followed by annealing at a rate of 0.1℃ / s to finally obtain DNA double-linked primers.

[0071] according to Figure 14 and Figure 15 Annealing the single-stranded primer adapter sequences in the given materials yielded the following double-stranded primers:

[0072] Will Figure 14 The single-stranded primers oddTopα (where α = 1.2...100) and oddBoβ (β = 1.2...100) were annealed separately to obtain 100 Odd double-stranded primers (Odd1-Odd100, i.e., Figure 14Annealing oddTop1 and oddBo1 yielded Odd double-stranded primer Odd1, annealing oddTop2 and oddBo2 yielded Odd double-stranded primer Odd2, and so on, annealing oddTop100 and oddBo100 yielded Odd double-stranded primer Odd100, with a final concentration of 5 μM. The primers were aliquoted into multi-well plates, 3 μL per well. These 100 Odd double-stranded primers were odd-numbered roll primers labeled with NHS magnetic beads.

[0073] Will Figure 14 The single-stranded primers evenTopα (α = 1.2...100) and evenBoβ (β = 1.2...100) were annealed to obtain 100 even double-stranded primers (Even1-Even100, i.e., Figure 14 Annealing evenTop1 and evenBo1 yielded Even double-stranded primer Even1; annealing evenTop2 and evenBo2 yielded Even double-stranded primer Even2; and so on, annealing evenTop100 and evenBo100 yielded Even double-stranded primer Even100, with a final concentration of 5 μM. The primers were aliquoted into multi-well plates, 3 μL per well. These 100 Even double-stranded primers were even-numbered rounds of primers labeled with NHS magnetic beads.

[0074] Will Figure 14 The single-stranded primer oddTopα (α=1.2...100) and Figure 15 The single-stranded primers oddtamBoβ (β = 1.2...100) were annealed to obtain 100 odd double-stranded fluorescent primers (oddtam1-oddtam100, i.e., Figure 14 The top 1 in the middle of the odds and Figure 15 Annealing oddtamBo1 yields the oddtam double-stranded primer oddtam1. Figure 14 The top two odds in China Figure 15 Annealing of oddtamBo2 yields the double-stranded primers oddtam2, ... Figure 14 China's Top 100 Odds and Figure 15 Oddtam double-stranded primers (oddtam100) were obtained by annealing with OddtamBo100 to a final concentration of 25 μM. The primers were aliquoted into multi-well plates, with X μL allocated to each well (X being the number of samples). These 100 Odd double-stranded fluorescent primers were X-barcode primers with spatial barcode labeling in the X-direction.

[0075] Will Figure 15The single-stranded primers evenbioTopα (α = 1.2...100) and evenfamBoβ (j = 1.2...100) were annealed to obtain 100 Even double-stranded fluorescent primers (evenFAM1-evenFAM100, i.e.) Figure 15 Annealing evenbioTop1 and evenfamBo1 yielded evenfam1 double-stranded primers; annealing evenbioTop2 and evenfamBo2 yielded evenfam2 double-stranded primers; and so on, annealing evenbioTop100 and evenfamBo100 yielded evenfam100 double-stranded primers. The final concentration was 25 μM. The primers were aliquoted into multi-well plates, with X μl allocated to each well (X being the number of samples). These 100 Even double-stranded fluorescent primers were Y-barcode primers with spatial barcode labeling. Since biotin was added to the evenbioTopα single-stranded primers, biotin was added to the Y-barcode double-stranded primers.

[0076] Annealing Ter-eve-top-iα (α = 1, 2, 3, 4) and Ter-oe-botiβ (β = 1, 2, 3, 4) yielded four end-construction primers (Ter1-Ter4) at a final concentration of 25 μM. Specifically, annealing Ter-eve-top-i1 and Ter-oe-boti1 in Table 1 yielded end-construction primer Ter1; annealing Ter-eve-top-i2 and Ter-oe-boti2 in Table 1 yielded end-construction primer Ter2; annealing Ter-eve-top-i3 and Ter-oe-boti3 in Table 1 yielded end-construction primer Ter3; and annealing Ter-eve-top-i4 and Ter-oe-boti4 in Table 1 yielded end-construction primer Ter4.

[0077] The reaction conditions for generating double-stranded primers from the two single-stranded primer linker sequences above are as follows: 1× annealing buffer is added to each of the two single-stranded primer linker sequences, and the mixture is mixed in equimolar amounts and heated at 95℃ for 3 min, followed by annealing at a rate of 0.1℃ / s to finally obtain DNA double-stranded primers.

[0078] The mouse culture and mating process used in this embodiment of the invention is as follows:

[0079] The breeding process involved placing 3-4 purchased mice (Vitollea, approximately 8 weeks old) in a standard ventilated cage with 12 hours of light followed by 12 hours of darkness. The ambient temperature was 25°C, and the relative humidity was 50%. For mating, male and female mice were placed in a 1:1 ratio at 10 PM, and the vaginal plug of the female was checked at 7 AM the following morning. Pregnant mice were cultured separately and recorded as 0.5 days after conception. Their weight was recorded daily thereafter.

[0080] The mouse embryo isolation process used in this embodiment of the invention is as follows:

[0081] Mice were euthanized by cervical retraction after anesthesia, and their abdomens were disinfected with medical alcohol. The abdomen was cut open along the midline near the diaphragm, and the uterus was removed and placed in DPBS solution. The uterus was carefully torn open to separate the embryos, which were then placed in a new tube and washed several times with DPBS until the washing solution no longer turned red.

[0082] The PDMS chip used in this embodiment of the invention is 0.5cm × 0.5cm with a resolution of 25μm. Figure 1 (as shown in the image above) and 50μm ( Figure 1 (See the image below), with 96 channels in both the horizontal and vertical directions. Figure 1 ).

[0083] Example 1: Establishment of a spatial three-dimensional genomics sequencing method based on microfluidic chips

[0084] 1. Cross-linking to fix the conformation of nucleic acids and proteins

[0085] The chip reaction cell was cast using polydimethylsiloxane (PDMS) material (ordered from Shanghai Pengzan Biotechnology Co., Ltd.). The process following the second crosslinking step involved casting the chip reaction cell within the PDMS chip reaction cell. Figure 1 The reaction is carried out in the reaction zone of sample A.

[0086] (1) Fresh CD-1 mouse embryos (Vitamin B, SPF grade) were placed in an embedding cassette and OCT was added for embedding. The embedded tissue blocks were sectioned using a cryostat with a step size of 10 μm.

[0087] (2) Remove excess OCT embedding agent from frozen tissue sections with ultrapure water and dry them in a clean bench.

[0088] (3) The PDMS reaction chamber is attached to the tissue section and fixed with clamps. The central reaction area (sample area) is the area where the tissue section area is attached to the PDMS reaction chamber. Figure 1 (As shown in the central reaction zone) Figure 1 The PDMS chip includes a sample loading area (to the left of the central reaction well area) with 96 sample inlets and a sample outlet area (to the right of the central reaction area). The reaction takes place in the reaction chamber from the start of cross-linking to the end of DNA adapter ligation.

[0089] (4) Add the DSG crosslinking system (containing DSG crosslinking agent) dropwise to the PDMS reaction tank, crosslink at room temperature for 45 min and shake gently.

[0090]

[0091] (5) Use a pipette to remove and discard the waste liquid from the reaction tank, add the formaldehyde crosslinking system and incubate at room temperature for 10 min.

[0092]

[0093]

[0094] (6) Use a vacuum pump to remove and discard the waste liquid from the reaction tank, add glycine to the PDMS reaction tank to terminate the system, and gently shake for 5 minutes at room temperature to terminate the reaction.

[0095]

[0096] 2. Permeability

[0097] Cells are permeabilized to allow the cell membrane and nuclear membrane to pass through, enabling the reaction reagents to fully enter the cell nucleus for reaction. The specific steps are as follows: aspirate and discard the waste liquid, add permeabilization working solutions 1, 2, and 3 sequentially to the PDMS reaction chamber, and react each solution at 4°C for 10 min.

[0098]

[0099] 3. DNA adapter ligation

[0100] (1) Use a vacuum pump to remove and discard the waste liquid from the reaction tank, add SDS system to the PDMS reaction tank (to bind proteins and deform them to precipitate), and react at 65°C for 10 min.

[0101]

[0102] (2) Remove and discard the waste liquid, add Triton X-100 to the PDMS reaction tank to terminate the system and react at 37°C for 10 min.

[0103] (3) Using a vacuum pump, the waste liquid was aspirated from the reaction chamber and discarded. A double enzyme digestion and ligation system was added to the PDMS reaction chamber for double enzyme digestion and ligation with DNA adapters (Mse I-DNA adapter ligation primer and Hinp1I-DNA adapter ligation primer). The reaction was carried out at 37°C for 3 hours to obtain tissue sections with added nucleic acid adapters. The tissue sections with added nucleic acid adapters were then separated from the PDMS chip to obtain the separated tissue sections with added nucleic acid adapters.

[0104]

[0105]

[0106] 4. Spatial Position Marking – Spatial Barcode Connection to Locate Spatial Position (This process needs to be performed within the PDMS microfluidic chip, taking a chip with a resolution of 25μm and a total of 96 injection wells as an example):

[0107] The PDMS microfluidic chip includes a sample loading area, a central area, and a sample discharging area. Figure 1 B and C represent the microfluidic chips in the X and Y directions, respectively. Tissue slices with added nucleic acid adapters were then placed on PDMS microfluidic chips (…). Figure 1 After the central regions of B and C were assembled, different numbered barcode fluorescent primers (X1-X1) were applied to the nucleic acids on the tissue sections along the X and Y axes, respectively. 96 Mark Y1-Y1 along the Y-axis. 96 This allows for two rounds of barcode marking of tissue sections, each in a vertical spatial direction. The reaction occurs in the central region of the PDMS microfluidic chip. Figure 1 The tissue slices are processed in the central area of ​​B or C. The tissue slices are connected in situ at the intersection using two barcode systems, forming integration points for the tissue pixels. A 96-channel PDMS microfluidic chip can divide the tissue slice plane into 96×96 (i×j) pixels, each pixel containing different combinations of barcodes X and Y (X...). i Y j (where i is any natural number from 1 to 96, and j is any natural number from 1 to 96), forming a two-dimensional image, linking tissue morphology with spatial omics, and achieving micron-level spatial location labeling. The barcode fluorescent primer X-barcod(X1-X) along the X-axis... 96 (containing TAMRA fluorescent group) and Y-barcode (Y1-Y) fluorescent primers along the Y-axis direction. 96 (Containing FAM fluorescent groups) Different fluorescent groups produce different colors of fluorescence under excitation light (X-barcode produces red fluorescence, Y-barcode produces green fluorescence). Simultaneously, the Y-barcode double-stranded primer is modified with biotin.

[0108] The specific steps are as follows:

[0109] (1) Odd double-stranded fluorescent primers were pre-sorted into 96-well plates, 1 μl per well.

[0110] (2) Clean the glass slide with ultrapure water and place it on a clean bench to dry. Prepare the following connecting solution:

[0111]

[0112] (3) Mix 4 μl of the ligation mixture with the primers in the 96-well plate, with a total volume of 5 μl.

[0113] (4) Clean the surface of the microfluidic chip and glass slide using a wafer film, fix it with a clamp, and install the draining device.

[0114] (5) The sample is sequentially fed into the 96-well sample channel of the microfluidic chip. Figure 1 Samples are loaded into the sample loading area (B) and then discharged through the sample outlet (B) after loading. Figure 1 The sample outlet area (B) is evacuated using a vacuum pump, allowing the liquid to flow slowly through the central area. Figure 1 (Central zone of B), let it stand at room temperature for 10 min.

[0115] (6) After the reaction is complete, add channel cleaning buffer to the 96-well sample loading channel of the PDMS microfluidic chip for cleaning.

[0116] (7) After the liquid is completely drained, a fluorescence microscope is used to detect and photograph the tissue sections to obtain fluorescence detection images after the tissue sections are marked with spatial barcode fluorescent primers in the X-axis direction. Figure 2 (The left image in the upper middle section and the left image in the lower bottom section).

[0117] (8) Repeat steps (1)-(5) to connect the spatial barcode fluorescent barcode primers (Y1-Y) along the Y-axis. 96 ).

[0118] (9) After the ligation reaction is complete, add channel termination buffer to clean the channel and take pictures using a fluorescence microscope to obtain fluorescence detection images of the tissue sections after the spatial barcode fluorescent barcode primers in the Y-axis direction are marked. Figure 2 (The right image in the upper middle section and the right image in the lower middle section). The results show that the fluorescence detection images after labeling the spatial barcode fluorescent barcode primers in the X-axis direction show fluorescence, and the fluorescence detection images after labeling the spatial barcode fluorescent barcode primers in the Y-axis direction also show fluorescence. Therefore, the spatial barcodes in both the X-axis and Y-axis directions were successfully labeled.

[0119] 5. Ultrasonic disruption of tissue sections – partial lysis:

[0120] Tissue sections were ultrasonically disrupted to partially lyse (only lysed to the nanoscale level of macromolecular complexes) to obtain lysis products containing different protein-nucleic acid complexes. The nucleic acids on the different protein-nucleic acid complexes each carried a spatial location barcode on the tissue section.

[0121] Using a double-edged blade, scrape the tissue section from the glass slide and dissolve it in 100-150 μl of permeabilization buffer 3, then perform non-contact ultrasound (instrument model: [instrument name missing]). PLUS, select high power, total duration is 10 minutes, alternating between 10 minutes and 10 seconds off).

[0122] 6. NHS Connection

[0123] NHS coupling was performed using NHS-activated beads in a magnetic bead coupling buffer, whereby the macromolecular complexes in the lysis products obtained in step 5 were coupled to the NHS-activated beads. The steps are as follows:

[0124] (1) Take 1 mL of NHS magnetic beads for each sample, place them on a magnetic rack to remove the storage solution, and wash them sequentially with 600 μL of pre-cooled 1 mM hydrochloric acid and 600 μL of pre-cooled PBS buffer. Then, resuspend them with 1 mL of coupling buffer and add them to the lysed product obtained in step 5. Then, place them on a rotating shaker and incubate overnight at 4 °C for coupling reaction.

[0125] (2) After the NHS coupling reaction was carried out overnight, the NHS magnetic beads were stopped by using 600 μl of magnetic bead blocking buffer and blocked on a shaker at 4°C. The liquid was changed every 0.5 h.

[0126] (3) The beads were rotated and cleaned with pre-cooled magnetic bead cleaning buffer for 5 minutes each time, for a total of four times, to obtain NHS magnetic bead coupled samples.

[0127] 7. Four-wheel barcode connection of NHS magnetic beads – partial marking:

[0128] Using the SPLiT-seq (split-pool ligation-based transcriptome sequencing) method, DNA in NHS magnetic bead-coupled samples (large molecular complexes coupled with NHS magnetic beads) was ligated by four rounds of barcoding (50 μm) or three rounds of barcoding (25 μm) through either four sets (for PDMS microfluidic chip devices with a resolution of 50 μm) or three sets (for PDMS microfluidic chip devices with a resolution of 25 μm). Different protein-nucleic acid complexes were labeled with different combinations of barcodes (each combination containing four different tandem barcodes with a resolution of 50 μm). Figure 3 The split1, split2, split3, and split4 in the code represent three different barcodes (with a resolution of 25 μm) used to distinguish different protein-nucleic acid complexes. Nucleic acids on the same protein-nucleic acid complex are marked with the same combination of barcodes.

[0129] The principle behind the four-round "split-pool" steps in SPLiT-seq technology is as follows:

[0130] 1) In the first round of reaction, all the complexes coupled with NHS activated magnetic beads were dispersed into reaction system 1 containing k different barcode tags. The barcode tags of the first round were added to obtain complexes with k different barcode tags. Then, all the complexes with k different barcode tags were mixed to obtain mixture n1. The nucleic acid fragments in mixture n1 are labeled with k different barcode tags.

[0131] 2) In the second round of reaction, all complexes with k different barcode tags added to mixture n1 are dispersed again into reaction system 2 containing k different barcode tags, and the k different barcode tags from the second round are added to obtain complexes with k different barcode tags added again. Then, the complexes with k different barcode tags added again are mixed to obtain mixture n2; the nucleic acid fragments in mixture n2 carry k... 2 Different types of barcode labels;

[0132] 3) In the nth round of reaction, the n (n-1) All complexes containing (n-1) rounds of k different barcode labels are dispersed in the mixture and added to reaction system n containing k different barcode labels. Then, the nth round of k different barcode labels is added to obtain the nth round of complexes containing k different barcode labels. Finally, the nth round of complexes containing k different barcode labels is mixed to obtain n... (n) Mixture; n (n) The nucleic acid fragments in the mixture carry k n Different types of barcode labels;

[0133] n is a natural number greater than 1 and less than or equal to 5, and k is a natural number greater than 1 and less than or equal to 100.

[0134] The specific steps are as follows:

[0135] (1) Pre-plan Figure 14 The 96 Odd double-stranded primers (Odd1-Odd96) obtained by annealing the single-stranded primers were aliquoted into 96-well plates and the following NHS magnetic bead ligation system was prepared according to the proportions.

[0136]

[0137] (2) Each NHS magnetic bead-coupled sample was resuspended using a 1 mL ligation system and aliquoted into a 96-well plate containing Odd double-stranded primers using a reagent bath.

[0138] (3) Seal the 96-well plate and mix it at 30°C for 1 hour on an Eppendorf ThermoMixer.

[0139] (4) Then add 60 μl of magnetic bead stop buffer to each well and let stand for 15 min to stop the reaction. Collect the samples from all wells and put them into the same pool.

[0140] (5) Transfer the solution to a 15 mL conical tube and place it on a magnetic rack to remove most of the solution. After leaving 0.5 mL, transfer it to a 1.5 mL EP tube to remove the solution again. Wash the tube three times with 600 μl of magnetic bead washing buffer, each time for at least 5 min.

[0141] (6) Repeat steps (1)-(5) once to add the barcode in the second round. Figure 14 The annealing of single-stranded primers yielded 96 even double-stranded primers (Even1-Even96).

[0142] (7) Repeat steps (1)-(5) again to add the barcode for the third time. This will add the barcode again. Figure 14 Ninety-six Odd double-stranded primers (Odd1-Odd96) were obtained by annealing single-stranded primers.

[0143] (8) Repeat steps (1)-(5) once more to add the barcode for the fourth time. This will add the barcode again. Figure 14 The single-stranded primers were annealed to obtain 96 even double-stranded primers (Even1-Even96).

[0144] (9) Connect the end library preparation primers (Ter1-Ter4, any one) to the read2 sequencing adapter, as follows:

[0145]

[0146] 8. Overall pyrolysis – reverse cross-linking process:

[0147] The protein-nucleic acid complexes obtained in step 7 with different combinations of barcode markers (X-barcode-Y-barcode-Odd-Even-Odd-Even) are reverse-crosslinked to obtain uncrosslinked, non-visible nucleic acid fragments. The uncrosslinked nucleic acid fragments carry chromatin conformational information consisting of two spatial location information (XiYj) markers (X-barcode-Y-barcode) and four barcodes (split1-split4: i.e., Odd-Even-Odd-Even) in tandem combinations.

[0148] The specific steps are as follows:

[0149] (1) NLS beads were reverse cross-linked in proteinase K buffer, and the system was as follows:

[0150]

[0151] (2) Place the anti-crosslinking tube at 55°C and shake it overnight for 12 hours.

[0152] (3) After overnight anti-crosslinking, 1% of 100mM PMSF was added to the solution and the proteinase K was inactivated by rotating at room temperature for 20 minutes to obtain the anti-crosslinking mixture.

[0153] 9. Biotin purification

[0154] Since Even double-stranded fluorescence in step 4 is modified with biotin, magnetic beads coated with streptavidin C1 are used to purify the DNA fragments obtained in step 8 by purifying the anti-crosslinking mixture.

[0155] ① For each sample, take 40 μl of streptavidin-modified magnetic beads, wash with 800 μl of 1×B&W buffer for 5 min, and repeat three times; finally, resuspend with 100 μl of 2×B&W buffer to obtain streptavidin magnetic bead suspension.

[0156] ② Add the anti-crosslinking mixture sample obtained in step 8 to the streptavidin magnetic bead suspension and incubate at 30 rpm for 1 h at room temperature;

[0157] ③ Wash twice with 400 μl of 1×B&W buffer, 5 min each time.

[0158] ④ Resuspend the sample in 400 μl of 10 mM Tris (0.1% Tween-20) to obtain a mixture of the target nucleic acid fragments.

[0159] 10. Library construction and sequencing

[0160] (1) Library construction was carried out using a single-end random amplification system with 6 random bases at the 3' end, and read1 sequencing adapters were introduced: single-stranded random primers with 6 random bases N (N can be any of A, T, C or G) at the 3' end and sequencing adapter sequences at the 5' end were randomly bound to the target nucleic acid fragment by annealing to obtain annealed products. Then, DNA polymerase was used to fully amplify the annealed products, and sequencing libraries containing two sequencing adapter sequences with fragment lengths suitable for machine testing (350-750 bp) were obtained by fragment sorting.

[0161] The specific steps are as follows: Magnetic beads containing the target DNA fragment in the target nucleic acid fragment mixture are resuspended using a single-end random amplification system and placed at 95°C for 45 seconds, then rapidly cooled on ice. Next, 1 μl of Klenow enzyme (a DNA polymerase fragment with strand displacement activity, Klenow fragment) is added, and the temperature is increased at a rate of 0.1°C / s until the final temperature reaches 37°C, which is then maintained for 30 minutes to obtain the incubation product.

[0162]

[0163]

[0164] After using a magnetic rack to adsorb magnetic beads from the incubation product, the supernatant was added to the following library amplification system for amplification (15 cycles in total) to obtain the amplified product library:

[0165]

[0166] The amplified product library was subjected to gel recovery fragment screening, and bands between 350-750bp were selected.

[0167] Quality control was performed using Qubit and a fragment analyzer. The final total library size should be at least 50 ng, with fragment lengths ranging from 350 to 750 ng, to obtain the sequencing library. Figure 4 This refers to the distribution range of DNA fragments in qualified samples.

[0168] Sequencing data was obtained by sequencing the sequencing library using the BGI DNBSEQ-T7 sequencer. The sequencing data was then analyzed. Based on the spatial location information of the DNA fragments obtained in step 8, the spatial location of the DNA fragments on the tissue section was determined. Based on the tandem combination of the four barcodes (SPLIT1-SPLIT4) on the DNA fragments obtained in step 8, it was determined which DNA fragments had the same barcode combination. DNA fragments with the same barcode combination were spatially close, ultimately allowing the acquisition of the three-dimensional genome conformation of the chromatin in the tissue section.

[0169] 11. Data Analysis

[0170] 11.1 Analysis of base balance in sequencing libraries and linking efficiency in each round of barcodes

[0171] The sequencing library balance results are included in the sequencing data file. Since each round contains a 7-base fixed sequence, there will be 7-base imbalance sites between rounds. Ligation efficiency analysis is performed by statistically analyzing the proportion of read lengths containing different numbers of barcode sequences. A higher proportion of read lengths containing six rounds of barcode sequences (two types of spatial location information (XiYj) markers and four types of barcode (split1-split4) markers) indicates higher ligation efficiency. Figure 5 The top and bottom figures show the library balance results obtained using pair-end sequencing and the number of tags linked to all reads, respectively. The results indicate that the ligation efficiency is over 90% per round, and after 6 rounds of ligation, the ligation efficiency exceeds 50%, which is in line with expectations.

[0172] 11.2 Analyze the number of reads, clusters, and DNA interactions at all spatial sites.

[0173] By collecting all sequences containing six rounds of barcode information and locating their spatial positions according to the first two rounds of spatial barcodes, the number of valid reads at each spatial location can be obtained. Figure 6 (Middle left image) By counting the types of each site containing the last four rounds of barcodes (split1-split4), the number of clusters can be obtained. Figure 6 (The middle diagram in the image) The number of interactions within a single cluster is counted based on the pairwise interactions between sequences within each cluster. The set of interactions within all clusters at a single spatial site represents the total number of interactions between all DNA fragments at that spatial site. Figure 6 (The right image in the image).

[0174] 11.3 Draw a map of interchromosomal and intrachromosomal interactions within the whole tissue.

[0175] Using open-source code (https: / / github.com / GuttmanLab / sprite-pipeline / wiki), we can construct a three-dimensional genome interaction map of chromosomes. Figure 7 The left image is a heatmap of interactions between all chromosomes, and the right image is a heatmap of interactions within a single chromosome. The horizontal and vertical axes represent the relative positions of chromosomes, and the color intensity represents the interaction strength.

[0176] 11.4 Sequencing Data Filtering

[0177] Because ultrasound generates a large number of small clusters, these clusters can randomly bind to NHS magnetic beads, leading to false positives caused by clusters originating from different chromosomes combining. To eliminate this influence, this invention first filters the data, removing clusters whose sequences originating from the same chromosome constitute less than 85% of all chromosomal sequences. The filtered data is then subjected to K-means clustering, with K set to 30 and seed set to 15. The classification results are then mapped to UMAP two-dimensional space and embryonic space, and named using the corresponding organs or tissues in spatial location. The results show that the 30 clustering results obtained by the method of this invention are spatially consistent with 16 organs or tissues, indicating that the method established in this invention is feasible for reproducing the chromatin conformation of animal tissues.

[0178] Example 2: Optimization and Comparison Experiment of the Spatial Three-Dimensional Genomics Sequencing Method of the Present Invention

[0179] 1. Testing DNA adapter primers

[0180] The reagent formulations used are the same as in Example 1, except for the DNA single-head primer. The overall experimental procedure differs from Example 1 in two aspects:

[0181] (1) The process of single-end random amplification during the purification and library preparation using biotin is missing;

[0182] (2) The process of ligating the end library-building primers during NHS coupling occurs after biotin purification;

[0183] Experimental results show that a large proportion of the sequencing results are empty vectors connected by splint primers and terminal primers, accounting for 92%. The sequences containing TCCAAG within the white box area in the figure are all empty vectors. Figure 11 The results showed that the inability to wash the terminal double-stranded primers before library construction led to the appearance of many empty reads. Adjusting the process of ligating the terminal primers to occur before the biotin purification process effectively avoids this phenomenon.

[0184] The DNA adapter primer (DPM) and end library construction primer sequences are as follows:

[0185] DNA single-head primer (DPM) sequence:

[0186] DPM-botFAM(HinP1I-MseI):

[0187] 5'-TGACT / i6FAMdT / GTCATGTCTTCCGATCT / iBiodT / GGGTGA-3' (iBiodT is biotin-modified);

[0188] DPM-bot(HinP1I-MseI): 5'-TGACTTGTCATGTCTTCCGATCT / iBiodT / GGGTGA-3'

[0189] (iBiodT is biotin-modified);

[0190] DPM-top(HinP1I):

[0191] 5'-GCTCACCCAAGATCGGAAGATCGTAGCCATGTCGT*T*C* / i2OMeG / * / i2OMeG / * / i2OMeG / -3' (The first base is phosphorylated; * indicates thiolation; i2OMeG indicates methoxylation).

[0192] DPM-top(MseI):

[0193] 5'-TATCACCCAAGATCGGAAGATCGTAGCCATGTCGT*T*C* / i2OMeG / * / i2OMeG / * / i2OMeG / -3';

[0194] DPM-bot(HinP1I-MseI) was dissolved in 1×annealing buffer and then mixed and annealed in equal molar amounts with DPM-top(HinP1I) to form double-stranded primers containing MseI restriction sites and HinP1I restriction sites, respectively.

[0195] Terminal primer sequences for library construction:

[0196] Ter-top-odd(u)-i2:

[0197] 5'-AGTTGTCAGTCGGAGGCCAAGCGGTCTTAGGAAGACAAGGACGGAATCCCAACTCCTTGGCTCACA-3' (the first base is phosphorylated);

[0198] Ter-bot-odd / even(u)-i2:

[0199] 5'-TGTGAGCCAAGGAGTGTGGGATTCCGTCCTTGTCTTCCTAAGACCGCTTGGCCTCC GACT-3';

[0200] The two primers were dissolved in 1×annealing buffer and annealed in equal molar amounts to prepare the final library-building primers.

[0201] 2. Testing of DNA enzyme digestion methods

[0202] The experimental material was also mouse brain tissue slices, and the reagent formulations used were the same as in Example 1, except for the DNA adapter ligation primers.

[0203] XSDNasetop: 5'-TCACCCAAGTACGG*A*A*G-3' (This primer undergoes 5' end phosphorylation modification and 3' end spacer modification, where * indicates thiomodification);

[0204] XSDNasebot: 5'-TGACTTGCTTCCGTACTTGGGTGAT-3' (This primer is modified with 5' end phosphorylation);

[0205] The two primers were diluted equimolarly with 1× annealing buffer and annealed together to obtain the DNAse I adapter ligation primers.

[0206] The method used in this embodiment is to fragment DNA using DNase I. The specific process involves four steps: after cross-linking and permeabilization, DNase I is used for enzyme digestion, repair, A-terminal addition, and DNA adapter ligation.

[0207] (1) Add DNase I digestion system (product number AM2238) to the reaction tank and react at 37℃ for 20 min:

[0208]

[0209] (2) Add magnetic bead termination buffer to the reaction tank and wash twice, then add magnetic bead cleaning buffer and wash three more times.

[0210] (3) Add the end-of-life remediation system (NEB, catalog number E6050S) to the reaction tank and react at room temperature for 1 hour:

[0211]

[0212] (4) Add the terminal addition A system (NEB, catalog number E6053S) to the reaction vessel and react at 37°C for 1 hour:

[0213]

[0214] (5) Add the DNA enzyme I adapter ligation system to the reaction tank and react at 30°C for 30 min. Then, the process of ligating the spatial barcode is the same as in Example 1.

[0215]

[0216]

[0217] The final fluorescence results of this comparative experiment were captured using a fluorescence microscope. Figure 10 (middle right figure) and the fluorescence in the method of the present invention in Example 1 ( Figure 10 The comparison (left and middle figures) shows that, under the same exposure time and intensity, the final ligation efficiency of DNA fragmentation using DNase I in this embodiment is much lower than the ligation efficiency of DNA fragmentation using Mse I and HinP1I in the method of the present invention in Example 1.

[0218] 3. Modifying biotin modification sites to improve fragment capture efficiency

[0219] The experimental material was also mouse brain tissue slices. Except for the second-round primer, the reagents and methods used were the same as in Example 1.

[0220] The following is an example of the even primer modification site with barcode number 1 in this step:

[0221] evenTop1: 5'-AGTTGTCACGTCAGCCGCAGTATC-3' (5' phosphorylation modification);

[0222] evenBo1: 5'-TGACTTGGATACTGCGGCTGACGT-3' (5' phosphorylation modification);

[0223] An example of the DPM primer modification site (with biotin label added) with barcode number 1 in this step is shown below:

[0224] XRBS-2nick-Mse-t:5'-TATCACCCAAGTACGGAAG-3';

[0225] XRBS-2nick-Hinp-t:5'-CGTCACCCAAGTACGGAAG-3';

[0226] DPM-bot(hinp1-MseI)5'-TGACTTGTCATGTCTTCCGTACT / iBiodT / GGGTGA-3'.

[0227] Theoretically, this experiment involved one round of DPM ligation, two rounds of spatial barcode primer ligation, and three rounds of macromolecular complex split-and-pool ligation. Since each round of primers contained the same ligation sequence, the sequencing results should have shown six highly imbalanced sequences. However, the final sequencing results showed only three highly imbalanced sequences. This is because placing the biotinylation site on the DPM primer allows for the biotinylation and capture of DNA from the entire tissue slice, thus masking the imbalanced sites at the subsequent three ligation rounds. Conversely, if, as in Example 1, the biotinylation site is transferred to the even primer, the DNA fragment ligated only by the second round of spatial barcode primers can be specifically enriched.

[0228] 4. Optimization analysis of contact ultrasound testing time

[0229] The experimental materials were the same mouse brain tissue slices from Example 1, as well as mouse embryo slices from the E9.5 and E14.5 stages.

[0230] The reagent formulation used is the same as in Example 1.

[0231] The experimental procedures included the crosslinking and permeabilization processes described in Example 1. After permeabilization, the slides were placed in permeabilization buffer 3 using a soft blade and subjected to contact sonication for different durations. The instrument used was a Fisher FB705220 (ultrasound power 45W), with time gradients of 15s, 40s, and 1min. After sonication, the mixture was thoroughly mixed, and 1μl was added to a glass slide. After complete drying, DAPI staining solution was added, and observation was performed using laser confocal microscopy.

[0232] Figure 9 The results from top to bottom are for E9.5 ultrasound at 15s, 40s, and 1min. Three fields of view were randomly selected from the samples at each ultrasound time.

[0233] This experiment demonstrates that for the three tissue samples, the protein-DNA complex gradually disappears after 1 minute of contact sonication, indicating that the contact sonication time at this point exceeds the optimal time. However, the size of the protein-DNA complex did not show a stable pattern between 15 and 40 seconds for the three tissues. This may be due to two factors: firstly, the significant liquid splashing during contact sonication causes some larger tissue fragments to splash onto the tube wall; secondly, contact sonication may generate a lot of foam, thus affecting the sonication effect. Non-contact sonication, on the other hand, allows for more uniform fragmentation of the sample in the solution, effectively avoiding excessive differences between protein-DNA complexes.

[0234] 5. Comparison of contact and non-contact ultrasound tests at different times.

[0235] The experimental materials were also embryo slices from the E12.5 stage in Example 1, and the reagent formulations were the same as in Example 1. The experimental steps included all the procedures in Example 1. In this example, after permeabilization, the slices were taken into permeabilization buffer 3 using a soft blade and subjected to contact or non-contact ultrasound treatment for different durations (contact ultrasound power was 30W and 40W, with durations of 10s, 20s, and 30s; non-contact ultrasound was performed for 4min, 6min, and 10min). (The experiment was conducted using the PLUS instrument), with time gradients of 15s, 40s, and 1min.

[0236] Experimental results show that the ratio of intrachromosomal interactions to interchromosomal interactions obtained using contact ultrasound of different intensities does not exhibit a significant changing trend with increasing time or power. Figure 12 (A). Using non-contact ultrasound, it was found that the proportion of intrachromosomal interactions gradually increased at time intervals of 4 min, 6 min, and 10 min. Figure 12 (B). Furthermore, by statistically analyzing the number and size of all clusters obtained for each sample, it was found that with increasing ultrasound time, the proportion of clusters with two or more interactions significantly increased. Figure 13 This indicates that the method of tissue disruption using non-contact ultrasound is highly repeatable and controllable.

[0237] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. A method for detecting the three-dimensional spatial genome conformation of chromatin for non-disease diagnosis and treatment purposes, characterized in that: The method steps are as follows: A1) Crosslinking and fixation: After the tissue slice to be tested is attached and assembled with the reaction cell of the PDMS chip, a crosslinking agent is added to the reaction cell to crosslink the tissue slice to be tested with fixed nucleic acid and protein conformations. A2) Cell permeabilization: Permeabilize the tissue section to be tested in the reaction chamber to obtain a permeabilized tissue section to be tested; A3) Nucleic acid adapter ligation: In the reaction chamber, the nucleic acids in the permeabilized tissue section to be tested are double-digested with enzymes and nucleic acid adapters are added to obtain a tissue section with added nucleic acid adapters; the tissue section with added nucleic acid adapters is separated from the PDMS chip to obtain a separated tissue section with added nucleic acid adapters; the double digestion is performed using restriction endonucleases MseI and HinP1I; the nucleic acid adapters include adapters for MseI-digested sticky ends and adapters for HinP1I-digested sticky ends; A4) Spatial Position Overall Marking: The separated tissue slices with added nucleic acid adapters are assembled with a microfluidic chip to obtain an assembled microfluidic chip. The microfluidic chip includes a sample loading port, a central area, and a sample outlet. The central area of ​​the assembled microfluidic chip is attached to the separated tissue slices with added nucleic acid adapters. An i-type X-labeled mixture (X1-Xi) is added to the sample inlet channel of the sample loading port and the mixture is drawn into the central area by a vacuum pump to add i-type barcode markings to the nucleic acids of the tissue slices with added nucleic acid adapters in the X-axis direction in the microfluidic chip, resulting in X-axis labeled tissue slices. Then, a mixture of j Y-labeled solutions (Y1-Yj) is added to the sample inlet channel of the sample loading port and the mixture is drawn into the central area by a vacuum pump. This allows the nucleic acids in the tissue slice labeled in the X-axis direction to be added with j barcodes in the Y-axis direction in the microfluidic chip, resulting in a tissue slice with overall spatial labeling. The X-axis direction is perpendicular to the Y-axis direction; the tissue slice with overall spatial positioning is marked as i×j pixels, and the nucleic acid in each pixel contains different combinations of barcodes X and Y. i Y j The X label and the Y label have different fluorescent groups, and the different fluorescent groups produce different colors of fluorescence under excitation light; the Y label is modified with a biotin group; i is a natural number greater than 1 and less than or equal to the number of injection channels, and j is a natural number greater than 1 and less than or equal to the number of injection channels. A5) Ultrasonic disruption of spatially marked tissue sections: The spatially marked tissue sections are ultrasonically disrupted to obtain lysis products containing protein-nucleic acid complexes; the ultrasonic disruption is non-contact ultrasonic disruption, and the non-contact ultrasonic disruption time is greater than or equal to 4 min and less than or equal to 10 min. A6) NHS activated magnetic bead coupling: The protein-nucleic acid complex in the lysis product is coupled with NHS activated magnetic beads to obtain a complex coupled with NHS activated magnetic beads. A7) Partial Labeling: The nucleic acids in the complex coupled with NHS activated magnetic beads were added with n rounds of k different barcode labels using the SPLiT-seq method through n rounds of "dispersion-mixing" steps, resulting in k added labels. n A complex of tandemly combined barcodes, wherein different nucleic acids of the complex contain k n Different types of serially combined barcodes; where n is a natural number greater than 1 and less than or equal to 5; where k is a natural number greater than 1 and less than or equal to 100; A8) Reverse crosslinking for overall lysis: Adding k n A complex of tandemly combined barcodes is reverse-crosslinked to obtain a decrosslinked nucleic acid fragment. The decrosslinked nucleic acid fragment is then purified to obtain a nucleic acid fragment to be sequenced. The nucleic acid fragment to be sequenced contains the nucleic acid adapter sequence and the k... n X-rays of the spatial location of the tandemly combined barcode sequence and the nucleic acid fragment to be sequenced on the tissue slice to be tested. i Y j Barcode sequence; A9) Library construction and sequencing: The nucleic acid fragment to be sequenced is amplified using single-stranded random primers to construct a sequencing library. The sequencing library is then sequenced to obtain sequencing data. The sequencing data is analyzed based on the tandemly combined barcode sequence and the X... i Y j Barcode sequences are used to obtain the three-dimensional genomic conformation of chromatin in the tissue section to be tested.

2. The method according to claim 1, characterized in that: The purification described in A8) involves adsorption purification using magnetic beads containing streptavidin to form a complex with the biotin group to obtain the nucleic acid fragment to be sequenced.

3. The method according to claim 1 or 2, characterized in that: The single-stranded random primer binding amplification includes the following steps: using single-stranded random primers containing 6 random N bases at the 3' end and sequencing adapter sequences at the 5' end, the primers are randomly bound to the nucleic acid fragment to be sequenced by annealing to obtain an annealed product. Then, the annealed product is fully amplified using DNA polymerase to obtain the sequencing library containing two sequencing adapter sequences.

4. A method for spatial three-dimensional genomic sequencing for non-disease diagnosis and treatment purposes, characterized in that: The method includes the steps of obtaining a spatial three-dimensional genomics sequencing library of a tissue slice to be tested using the method of claim 1, and sequencing the sequencing library.

5. A method for constructing the sequencing library according to any one of claims 1-3.

Images