A tsme mutant of degradable methyl di sulfuron and methyl iodine sulfuron sodium salt and application thereof

Abstract

The present application relates to a kind of degradable methyl disulfuron and methyl iodosulfuron sodium salt TsmE mutant, which is in the amino acid sequence of wild-type sulfonylurea herbicide hydrolytic enzyme TsmE 79th mutation is aspartame, 80th and 182th are respectively mutated as arginine, 81th and 176th are respectively mutated as alanine, 178th is mutated as valine.TsmE mutant has the activity of catalyzing degradation methyl disulfuron and methyl iodosulfuron sodium salt, solves the problem that wild-type TsmE cannot catalyze methyl disulfuron and methyl iodosulfuron sodium salt (or other methyl iodosulfuron salt) deesterification detoxification, and can be used to construct sulfonylurea herbicide-resistant transgenic crops.

Description

Technical Field

[0001] This invention belongs to the field of enzyme and protein engineering technology, specifically relating to a TsmE mutant that can degrade mesosulfuron-methyl and sodium iodosulfuron-methyl and its applications. Background Technology

[0002] Sulfonylurea herbicides such as mesosulfuron-methyl (also known as sulfanilamide) and sodium mesosulfuron-methyl have other substituent groups on their aromatic rings besides the ester structure, resulting in much larger molecular weights than other varieties. In recent years, macromolecular sulfonylurea herbicides have developed rapidly and have become an important category of sulfonylurea herbicides, currently achieving global annual sales of approximately $500 million, accounting for 20% of the total sales of sulfonylurea herbicides. Among them, mesosulfuron-methyl, as a wheat-specific herbicide, has excellent control effects on most grass weeds, especially the noxious weed *Hemiberlesia lataniae*, which is closely related to wheat, while other herbicides on the market have poor efficacy. Therefore, it occupies a pivotal position in the wheat herbicide market and has broad future development prospects.

[0003] Although sulfonylurea herbicides are of low toxicity to mammals, some sulfonylurea herbicides have long soil residual periods, which increase with soil pH, reaching up to 2-3 years in alkaline soils. This can cause severe phytotoxicity to subsequent crops. Therefore, sulfonylurea herbicide-degrading detoxifying enzymes have significant application value in the fields of bioremediation of sulfonylurea herbicide residues and the development of sulfonylurea-resistant transgenic crops.

[0004] TsmE, a sulfonylurea herbicide hydrolase, is an esterase identified from the bacterium *Hansschlegelia zhihuaiae* S113. It catalyzes the cleavage of the COOR bond in the ester structure of sulfonylurea herbicides, producing non-toxic products. Currently, wild-type TsmE is known to catalyze the degradation of various low-molecular-weight sulfonylurea herbicides, including thiamethoxam, metsulfuron-methyl, bensulfuron-methyl, pyrimisulfuron-methyl, and bensulfuron-methyl. However, wild-type TsmE cannot catalyze the deesterification degradation of mesosulfuron-methyl and sodium mesosulfuron-methyl, thus limiting its application. Summary of the Invention

[0005] (a) Technical problems to be solved

[0006] Given the limitations of wild-type TsmE's catalytic function, this invention provides a TsmE mutant capable of degrading mesosulfuron-methyl and sodium iodosulfuron-methyl, which has the function of catalytically degrading mesosulfuron-methyl and sodium iodosulfuron-methyl, in order to solve the technical problem that wild-type TsmE cannot catalyze the deesterification and detoxification of mesosulfuron-methyl and sodium iodosulfuron-methyl (or other salts).

[0007] (II) Technical Solution

[0008] In a first aspect, the present invention provides a TsmE mutant capable of degrading mesosulfuron-methyl and sodium mesosulfuron-methyl, wherein the amino acid sequence of the wild-type sulfonylurea herbicide hydrolase TsmE is mutated to asparagine at position 79, arginine at positions 80 and 182, alanine at positions 81 and 176, and valine at position 178, respectively; the amino acid sequence of the TsmE mutant is shown in SEQ ID NO.4.

[0009] According to a preferred embodiment of the present invention, the amino acid sequence of the TsmE mutant is shown in SEQ ID NO.4.

[0010] Secondly, the present invention provides a TsmE mutant encoding gene that can degrade mesosulfuron and sodium iodosulfuron, the nucleotide sequence of which is shown in SEQ ID NO.3.

[0011] Thirdly, the present invention also relates to a recombinant expression vector containing the TsmE mutant encoding gene of the aforementioned degradable mesosulfuron-methyl and sodium iodosulfuron-methyl.

[0012] Preferably, the recombinant expression vector is obtained by inserting the TsmE mutant coding gene between the Nde I and HindIII restriction sites of pET-29a(+).

[0013] Fourthly, the present invention also relates to genetically engineered bacteria containing the TsmE mutant encoding gene of the degradable mesosulfuron-methyl and sodium iodosulfuron-methyl.

[0014] Preferably, the expression host bacterium of the genetically engineered bacteria is Escherichia coli BL21(DE3).

[0015] Fifthly, the present invention provides the application of the above-mentioned TsmE mutant in the preparation of products that degrade sulfonylurea herbicides.

[0016] In a sixth aspect, the present invention provides the application of the above-mentioned TsmE mutant, TsmE mutant encoding gene, recombinant expression vector, and genetically engineered bacteria in the biological degradation of sulfonylurea herbicide residues in soil or water.

[0017] In a seventh aspect, the present invention provides the application of the above-mentioned TsmE mutant encoding gene in the construction of transgenic crops resistant to sulfonylurea herbicides.

[0018] (III) Technical effects: This invention uses sulfonylurea herbicide hydrolase TsmE as a starting template and obtains mutants (I79N / P80R / Y81A / G176A / S178V / G182R) with deesterification activity against mesosulfuron and sodium mesosulfuron-methyl through directed evolution technology.

[0019] The mutant exhibits specific enzyme activities of 0.44 U / mg for mesosulfuron-methyl and 0.67 U / mg for sodium mesosulfuron-methyl. The mutant and its encoding gene can be used to construct transgenic crops resistant to sulfonylurea herbicides, and also for the removal of sulfonylurea herbicides from soil and water, possessing significant theoretical and practical value. This invention also relates to the encoding gene of the mutant, recombinant expression vectors, and genetically engineered bacteria. Attached Figure Description

[0020] Figure 1 This is a diagram showing the construction of a recombinant expression vector containing the gene encoding the TsmE mutant M10.

[0021] Figure 2 This is the SDS-PAGE pattern of the TsmE mutant M10. Lane 1 is the protein marker, and the remaining lanes are wild-type TsmE and mutant M10, respectively.

[0022] Figure 3 The degradation of mesosulfuron-methyl and sodium iodosulfuron-methyl by purified mutant M10 protein was detected by HPLC. Detailed Implementation

[0023] To better explain and facilitate understanding of the present invention, a detailed description of the invention is provided below with reference to the accompanying drawings and specific embodiments. The microorganisms used in the following examples were sourced as follows: *Escherichia coli* DH5α was purchased from Takara Bio Engineering (Dalian) Co., Ltd., the *Escherichia coli* high expression vector pET-29a(+) was purchased from Novogen, and the expression host bacterium *Escherichia coli* BL21(DE3) was purchased from Shanghai Yingjun Biotechnology Co., Ltd.

[0024] Example 1

[0025] This embodiment screens for TsmE mutants with deesterification activity against mesosulfuron-methyl. The screening process is as follows:

[0026] (1) Synthetic wild-type TsmE gene

[0027] The nucleotide sequence (1197 bp) of the synthesized wild-type TsmE gene is shown in SEQ ID NO.1 of the sequence listing, which encodes the wild-type TsmE protein (398 amino acids), as shown in SEQ ID NO.2 of the sequence listing. The synthesized wild-type TsmE gene was cloned into the pUC57 vector, and the recombinant vector was named pUC-TsmE, which was then transformed into Escherichia coli DH5α.

[0028] (2) Construction of TsmE gene mutation library

[0029] Using plasmid pUC-TsmE as a template, error-prone PCR was performed with primers 1 and 2 to induce mutations in the TsmE gene due to random base mismatches. The error-prone PCR product was cloned into the pMD19-T vector, and the enzyme-ligated product was heat-transformed into mesosulfuron-methyl-sensitive *E. coli* DH10B(ilvG) + Random mutant libraries were plated on LB plates containing 100 mg / L Amp, 200 mg / L IPTG, and 200 mg / L X-Gal and incubated overnight at 37°C.

[0030] The primers and error-prone PCR reaction system are as follows:

[0031] Primer 1: ATGGAAACCGATAAAAAAACCG,

[0032] Primer 2: TCAGCTTTCGTTCTGATCTAAG

[0033] The error-prone PCR amplification system is as follows:

[0034] Primer 1 (10 μM) 1.0μL Primer 2 (10 μM) 1.0μL <![CDATA[Template DNA (about 10 ng·μL -1 )]]> 1.0μL StarMut Enhancer 5.0μL <![CDATA[ddH2O]]> 17.0μL Total volume 50μL

[0035] PCR amplification procedure:

[0036] Pre-denaturation at 95℃ for 3 min → denaturation at 94℃ for 0.5 min, annealing at 52℃ for 1.0 min, extension at 72℃ for 1.5 min, repeat 30 cycles → extension at 72℃ for 10 min, then cool to room temperature.

[0037] (3) Screening of TsmE gene mutation libraries

[0038] The transformation products from the above mutant library were inoculated into a basal salt medium containing 10 μM mesosulfuron-methyl (with 5 g / L glucose, 200 mg / L valine, 200 mg / L leucine, and 100 mg / L ampicillin added) and cultured for 3 days. Given that *E. coli* DH10B (ilvG) + It is highly sensitive to high concentrations of mesosulfuron-methyl; the resistance gene can convert mesosulfuron-methyl into an acidic product that is non-toxic to bacteria, thereby relieving the toxicity of mesosulfuron-methyl to Escherichia coli DH10B (ilvG). + The growth-inhibiting effect. This principle was used to perform high-throughput screening of the aforementioned mutant libraries.

[0039] After several rounds of screening, two TsmE mutants, M10, with deesterification activity against mesosulfuron-methyl were obtained. A recombinant strain, E. coli DH10B(ilvG), carrying the gene of mutant M10, was then developed. +The recombinant strain E. coli DH10B (ilvG) carrying the wild-type TsmE gene was able to grow on selection plates (solid medium) supplemented with 10 μM mesosulfuron-methyl, while the recombinant strain was able to grow on solid medium. + The growth of TsmE was significantly inhibited.

[0040] The above-mentioned basic salt culture medium formula is as follows: 1.0g NH4Cl, 0.5g NaCl, 1.5g K2HPO4, 0.5g KH2PO4, 0.2g MgSO4·7H2O, and deionized water is added to a final volume of 1L. 2% agar powder is added to the solid culture medium.

[0041] (4) Acquire the mutated resistance gene

[0042] Sequencing of the mutant M10 gene was performed, and the sequencing results are shown in SEQ ID NO.3. Compared with SEQ ID NO.1 (wild-type TsmE gene), it was found that the nucleotide sequence at positions 236-242 changed from TTCCATA to ATCGAGC, and at position 527 changed from G to C, at positions 532-533 changed from TC to GT, and at position 544 changed from G to A. This resulted in the following mutations in the amino acid sequence (as shown in SEQ ID NO.4): at positions 79-81, the original isoleucine, proline, and tyrosine changed to asparagine, arginine, and alanine; and at positions 176, 178, and 182, the original glycine, serine, and glycine changed to alanine, valine, and arginine.

[0043] Example 2

[0044] High-efficiency expression of the gene encoding mutant M10 (SEQ ID NO.3) in BL21(pET-29a(+)) was achieved. The experimental method is as follows:

[0045] (1) Construction of bacterial expression vectors and acquisition of recombinant microorganisms

[0046] Synthesize the nucleotide sequence (1215 bp) of the M10 gene (SEQ ID NO.3) containing the Nde I / Hind III restriction sites, as shown in SEQ ID NO.5 (containing the M10 gene) in the sequence listing.

[0047] The synthesized nucleotide sequence of SEQ ID NO.5 was cloned into the pUC57 vector to obtain the recombinant vector pUC-M10. The recombinant vector pUC-M10 and the pET-29a(+) plasmid were digested with restriction endonucleases Nde I and HindIII, respectively, using the following digestion system:

[0048] 10×M Buffer 5μL Nde I (10 U / μL) 2.0μL HindⅢ (10 U / μL) 2.0μL DNA (pUC-M10 or pET-29a(+) plasmid) 30μL <![CDATA[ddH2O]]> 11μL

[0049] The M10 gene fragment excised from the above enzyme digestion system was digested at 37°C for 12 hours. Then, the fragment was ligated with the digested bacterial expression vector pET-29a(+). The constructed recombinant expression vector was named pET29a-M10 (the structure of the recombinant expression vector is shown below). Figure 1 (As shown). The recombinant expression vector was transformed into the expression host bacterium BL21(DE3) to obtain the recombinant bacterium BL21(M10).

[0050] (3) Expression and purification of TsmE mutant

[0051] Recombinant bacteria BL21(M10) were inoculated into LB medium and cultured at 37°C and 200 rpm on a shaker until the OD600 nm reached 0.6. IPTG was then added to a concentration of 0.4 mM, and the culture was induced at 16°C for 12 h. The bacterial cells were collected by centrifugation of 100 ml of bacterial suspension. The cells were washed twice with PBS (50 mM, pH 7.4), resuspended in 10 ml of PBS buffer, and sonicated (Auto Science, UH-650B ultrasonic processor, 30% intensity) for 7 min. The cells were then centrifuged at 12000 rpm for 30 min, and the supernatant was collected. The TsmE mutant was purified using a nickel affinity chromatography column. The purified enzyme was then subjected to protein electrophoresis. (See attached image). Figure 2 .

[0052] Example 3

[0053] This embodiment describes the determination of the activity of the TsmE mutant M10 protease using the following method: An enzyme activity reaction system (1 mL) was set up: purified TsmE mutant M10 protease and 100 μM sulfonylurea herbicide substrate were added to 50 mM PBS buffer (pH 7.4). Timing for each reaction began with the addition of the enzyme, and the reaction was terminated by rapidly adding an equal volume of acetonitrile after reacting at 30°C for 10 min. A control without enzyme was used, and the activity of the mutant was determined by detecting the reduction in the amount of each sulfonylurea substrate using high-performance liquid chromatography (HPLC).

[0054] HPLC conditions were: UltiMate The system used was a 3000 Titanium System high-performance liquid chromatograph; a Thermo Scientific Syncronis C18 column (5 μm, 250 mm × 4.6 mm); the mobile phase was acetonitrile / water (60 / 40, v / v), with 0.5% acetic acid added to the water; the flow rate was 1 mL / min; the injection volume was 20 μL; the detection wavelengths were 230 nm and 255 nm; and the column temperature was 40 °C. One unit of enzyme activity (U) is defined as the amount of enzyme required to catalyze the hydrolysis of 1.0 μmol of substrate in 1 min at pH 7.4 and 30 °C.

[0055] The liquid chromatogram of the purified mutant M10 enzyme catalyzing the production of acid products from mesosulfuron-methyl and sodium mesosulfuron-methyl is shown below. Figure 3 As shown in the diagram, the red curve represents the chromatographic peak of mesosulfuron-methyl or sodium mesosulfuron-methyl before the reaction begins, while the black curve represents the chromatographic peak of the hydrochloric acid product of mesosulfuron-methyl or sodium mesosulfuron-methyl after 10 minutes of reaction. It can be seen that after 10 minutes of reaction, mesosulfuron-methyl or sodium mesosulfuron-methyl degrades into the corresponding acid products. The calculated specific enzyme activities of mutant M10 for mesosulfuron-methyl and sodium mesosulfuron-methyl are 0.44 U / mg and 0.67 U / mg, respectively. These specific enzyme activity values ​​are significantly greater than the specific enzyme activity values ​​of the TsmE mutant disclosed in patent application CN115960861A. Specific enzyme activity is defined as the catalytic activity units per milligram of enzyme protein, i.e., enzyme activity divided by mass.

[0056] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A TsmE mutant capable of degrading mesosulfuron-methyl and sodium mesosulfuron-methyl, characterized in that, The mutant TsmE is modified by mutating asparagine at position 79, arginine at positions 80 and 182, alanine at positions 81 and 176, and valine at position 178. The amino acid sequence of the mutant TsmE is shown in SEQ ID NO.

4.

2. A TsmE mutant encoding gene of the degradable mesosulfuron-methyl and sodium mesosulfuron-methyl as described in claim 1, characterized in that, Its nucleotide sequence is shown in SEQ ID NO.

3.

3. A recombinant expression vector containing the TsmE mutant encoding gene of the degradable mesosulfuron-methyl and sodium iodosulfuron-methyl as described in claim 2.

4. The recombinant expression vector according to claim 3, characterized in that, The recombinant expression vector was obtained by inserting the TsmE mutant coding gene between the Nde I and Hind III restriction sites of the prokaryotic expression vector pET-29a (+).

5. Genetically engineered bacteria containing the TsmE mutant encoding gene of the degradable sodium disulfuron and mesosulfuron as described in claim 2.

6. The genetically engineered bacterium according to claim 5, characterized in that, The expression host bacterium of the genetically engineered bacteria is Escherichia coli BL21(DE3).

7. The use of the TsmE mutant of the degradable sodium disulfuron and sodium methyl iodosulfuron as described in claim 1 in the preparation of products that degrade sulfonylurea herbicides.

8. The application of the TsmE mutant of claim 1 that can degrade mesosulfuron and sodium iodosulfuron, the TsmE mutant encoding gene of claim 2, the recombinant expression vector of claim 3, or the genetically engineered bacteria of claim 5 in the biological degradation of sulfonylurea herbicide residues in soil or water.

9. The application of the TsmE mutant encoding gene of the degradable disulfuron and sodium methyl iodosulfuron as described in claim 2 in the construction of transgenic crops resistant to sulfonylurea herbicides.

Images