A sulfonylurea herbicide hydrolyzing enzyme tsmE mutant, its coding gene and use

Abstract

The present application relates to a sulfonylurea herbicide hydrolytic enzyme TsmE mutant, which is mutant M8 or mutant M9, the mutant M8 is that the 80th and 182nd of the amino acid sequence of wild type sulfonylurea herbicide hydrolytic enzyme TsmE are respectively mutated to arginine, the 81st and 176th are respectively mutated to alanine, the 178th is mutated to valine and the 328th is mutated to phenylalanine; the mutant M9 is that the 80th and 182nd of the amino acid sequence of wild type TsmE are respectively mutated to arginine, the 81st and 176th are mutated to alanine, the 178th is mutated to valine and the 328th to tyrosine. The TsmE mutant has the activity of catalyzing the degradation of mesosulfuron-methyl and methyl iodosulfuron sodium salt, solves the problem that wild type TsmE cannot catalyze mesosulfuron-methyl and methyl iodosulfuron sodium salt to be deesterified and detoxified, and can be used for constructing sulfonylurea herbicide-resistant transgenic crops.

Description

Technical Field

[0001] This invention belongs to the field of enzyme protein engineering technology, specifically relating to a sulfonylurea herbicide hydrolase TsmE mutant, its encoding gene, and its uses. Background Technology

[0002] While herbicides reduce agricultural labor intensity and ensure normal agricultural production, their residues also cause serious crop damage. Statistics show that herbicide damage causes billions of yuan in losses annually. Herbicide-resistant genetically modified organisms (GMOs) are the best way to solve this problem. Sulfonylurea herbicides are widely used and their research and application are developing rapidly. They have become the third largest herbicide category after organophosphates and acetamides, with global annual sales exceeding $2 billion, accounting for approximately 10% of the entire herbicide market.

[0003] Some important sulfonylurea herbicides, such as mesosulfuron-methyl (also known as sulfanilamide) and sodium mesosulfuron-methyl, have other substituent groups on their aromatic rings in addition to the ester structure, resulting in much larger molecular weights than other varieties. In recent years, macromolecular sulfonylurea herbicides have developed rapidly and have become an important category of sulfonylurea herbicides, currently achieving global annual sales of approximately $500 million, accounting for 20% of the total sales of sulfonylurea herbicides. Among them, mesosulfuron-methyl, as a wheat-specific herbicide, has excellent control effects on most grass weeds, especially the noxious weed *Hemiberlesia lataniae*, which is closely related to wheat, while other herbicides on the market have poor efficacy. Therefore, it occupies a pivotal position in the wheat herbicide market and has broad future development prospects.

[0004] Although sulfonylurea herbicides are of low toxicity to mammals, some sulfonylurea herbicides have long soil residual periods, which increase with soil pH, reaching up to 2-3 years in alkaline soils. This can cause severe phytotoxicity to subsequent crops. Therefore, sulfonylurea herbicide-degrading detoxifying enzymes have significant application value in the fields of bioremediation of sulfonylurea herbicide residues and the development of sulfonylurea-resistant transgenic crops.

[0005] TsmE, a sulfonylurea herbicide hydrolase, is an esterase identified from the bacterium *Hansschlegelia zhihuaiae* S113. It catalyzes the cleavage of the COOR bond in the ester structure of sulfonylurea herbicides, generating the corresponding non-herbicidal sulfonylurea acid. TsmE can catalyze the deesterification and detoxification degradation of various low-molecular-weight sulfonylurea herbicides, including thiamethoxam, metsulfuron-methyl, bensulfuron-methyl, thiamethoxam, and bensulfuron-methyl. However, wild-type TsmE has limitations; it cannot catalyze the deesterification and detoxification of mesosulfuron-methyl and sodium mesosulfuron-methyl, thus limiting its application value. Summary of the Invention

[0006] (a) Technical problems to be solved

[0007] Given the limitations of the catalytic function of wild-type TsmE, this invention provides a TsmE mutant sulfonylurea herbicide hydrolase that catalyzes the degradation of mesosulfuron-methyl and sodium mesosulfuron-methyl, thus solving the technical problem that wild-type TsmE cannot catalyze the hydrolysis, deesterification, and detoxification of mesosulfuron-methyl and sodium mesosulfuron-methyl (or other salts). This invention also relates to the coding gene of the TsmE mutant, a recombinant expression vector containing the coding gene, and genetically engineered bacteria.

[0008] (II) Technical Solution

[0009] In a first aspect, the present invention provides a mutant of sulfonylurea herbicide hydrolase TsmE, which is mutant M8 or mutant M9. Mutant M8 is formed by mutating arginine at position 80, alanine at positions 81 and 176, valine at position 178, arginine at position 182, and phenylalanine at position 328 of the amino acid sequence of wild-type sulfonylurea herbicide hydrolase TsmE. Mutant M9 is formed by mutating arginine at position 80, alanine at positions 81 and 176, valine at position 178, arginine at position 182, and tyrosine at position 328 of the amino acid sequence of wild-type sulfonylurea herbicide hydrolase TsmE.

[0010] According to a preferred embodiment of the present invention, the amino acid sequence of mutant M8 is shown in SEQ ID NO.4, and the amino acid sequence of mutant M9 is shown in SEQ ID NO.6.

[0011] Secondly, the present invention provides a gene encoding a sulfonylurea herbicide hydrolase TsmE mutant, the nucleotide sequence of which is shown in SEQ ID NO.3, for encoding mutant M8; or the nucleotide sequence of the encoding gene is shown in SEQ ID NO.5, for encoding mutant M9.

[0012] Thirdly, the present invention also relates to a recombinant expression vector containing the gene encoding the TsmE mutant of the sulfonylurea herbicide hydrolase.

[0013] Preferably, the recombinant expression vector is obtained by inserting the gene encoding the sulfonylurea herbicide hydrolase TsmE mutant into the Nde I and HindIII restriction sites of pET-29a(+).

[0014] Fourthly, the present invention also relates to genetically engineered bacteria containing the gene encoding the TsmE mutant of the sulfonylurea herbicide hydrolase.

[0015] Preferably, the expression host bacterium of the genetically engineered bacteria is Escherichia coli BL21(DE3).

[0016] Fifthly, the present invention provides the application of the above-mentioned TsmE mutant in the preparation of products that degrade sulfonylurea herbicides.

[0017] In a sixth aspect, the present invention provides the application of the above-mentioned TsmE mutant, TsmE mutant encoding gene, recombinant expression vector, and genetically engineered bacteria in the biological degradation of sulfonylurea herbicide residues in soil or water.

[0018] In a seventh aspect, the present invention provides the application of the above-mentioned TsmE mutant encoding gene in the construction of transgenic crops resistant to sulfonylurea herbicides.

[0019] (III) Technical Effects: This invention uses the sulfonylurea herbicide hydrolase TsmE as a starting template and obtains mutants M8 (P80R / Y81A / G176A / S178V / G182R / W328F) and M9 (P80R / Y81A / G176A / S178V / G182R / W328Y) with deesterification activity for mesosulfuron-methyl and sodium iodosulfuron-methyl through directed evolution technology.

[0020] The specific enzyme activities of mutant M8 against mesosulfuron-methyl and sodium mesosulfuron-methyl were 0.43 U / mg and 0.92 U / mg, respectively, while those of mutant M9 against mesosulfuron-methyl and sodium mesosulfuron-methyl (or other salts such as potassium / ammonium salts) were 0.45 U / mg and 0.95 U / mg, respectively. The TsmE mutants M8 and M9 and their encoding genes can be used to construct transgenic crops resistant to sulfonylurea herbicides, and also for the degradation and removal of residual sulfonylurea herbicides in soil or water, possessing significant theoretical and practical value. Attached Figure Description

[0021] Figure 1 This is a diagram showing the construction of a recombinant expression vector containing the encoding genes of the TsmE mutants M8 and M9.

[0022] Figure 2 SDS-PAGE profiles of TsmE mutants M8 and M9 are shown. Lane 1 is the protein marker, and the remaining lanes are wild-type TsmE, mutant M8, and mutant M9, respectively.

[0023] Figure 3 The degradation of mesosulfuron-methyl and sodium iodosulfuron-methyl by purified mutant M8 and M9 proteins was detected by HPLC. Detailed Implementation

[0024] To better explain and facilitate understanding of the present invention, a detailed description of the invention is provided below with reference to the accompanying drawings and specific embodiments. The microorganisms used in the following examples were sourced as follows: *Escherichia coli* DH5α was purchased from Takara Bio Engineering (Dalian) Co., Ltd., the *Escherichia coli* high expression vector pET-29a(+) was purchased from Novogen, and the expression host bacterium *Escherichia coli* BL21(DE3) was purchased from Shanghai Yingjun Biotechnology Co., Ltd.

[0025] Example 1

[0026] This embodiment screens for TsmE mutants with deesterification activity against mesosulfuron-methyl. The screening process is as follows:

[0027] (1) Synthetic wild-type TsmE gene

[0028] The nucleotide sequence (1197 bp) of the synthesized wild-type TsmE gene is shown in SEQ ID NO.1 of the sequence listing, which encodes the wild-type TsmE protein (398 amino acids), as shown in SEQ ID NO.2 of the sequence listing. The synthesized wild-type TsmE gene was cloned into the pUC57 vector, and the recombinant vector was named pUC-TsmE, which was then transformed into Escherichia coli DH5α.

[0029] (2) Construction of TsmE gene mutation library

[0030] Using plasmid pUC-TsmE as a template, error-prone PCR was performed with primers 1 and 2 to induce mutations in the TsmE gene due to random base mismatches. The error-prone PCR product was cloned into the pMD19-T vector, and the enzyme-ligated product was heat-transformed into mesosulfuron-methyl-sensitive *E. coli* DH10B(ilvG) + Random mutant libraries were plated on LB plates containing 100 mg / L Amp, 200 mg / L IPTG, and 200 mg / L X-Gal and incubated overnight at 37°C.

[0031] The primers and error-prone PCR reaction system are as follows:

[0032] Primer 1: ATGGAAACCGATAAAAAAACCG,

[0033] Primer 2: TCAGCTTTCGTTCTGATCTAAG

[0034] The error-prone PCR amplification system is as follows:

[0035] Primer 1 (10 μM) 1.0μL Primer 2 (10 μM) 1.0μL <![CDATA[template DNA (about 10 ng·μL -1 )]]> 1.0μL StarMut Enhancer 5.0μL <![CDATA[ddH2O]]> 17.0μL Total volume 50μL

[0036] PCR amplification procedure:

[0037] Pre-denaturation at 95℃ for 3 min → denaturation at 94℃ for 0.5 min, annealing at 52℃ for 1.0 min, extension at 72℃ for 1.5 min, repeat 30 cycles → extension at 72℃ for 10 min, then cool to room temperature.

[0038] (3) Screening of TsmE gene mutation libraries

[0039] The transformation products from the above mutant library were inoculated into a basal salt medium containing 10 μM mesosulfuron-methyl (with 5 g / L glucose, 200 mg / L valine, 200 mg / L leucine, and 100 mg / L ampicillin added) and cultured for 3 days. Given that *E. coli* DH10B (ilvG) + It is highly sensitive to high concentrations of mesosulfuron-methyl; the resistance gene can convert mesosulfuron-methyl into an acidic product that is non-toxic to bacteria, thereby relieving the toxicity of mesosulfuron-methyl to Escherichia coli DH10B (ilvG). + The growth-inhibiting effect. This principle was used to perform high-throughput screening of the aforementioned mutant libraries.

[0040] After several rounds of screening, two TsmE mutants, M8 and M9, with deesterification activity against mesosulfuron-methyl were obtained. A recombinant strain, E. coli DH10B(ilvG), carrying the genes of mutants M8 and M9, was then developed. + M8) and E. coli DH10B (ilvG + II) It can grow on selection plates (solid medium) supplemented with 10 μM mesosulfuron-methyl, while the recombinant strain E. coli DH10B(ilvG) carrying the wild-type TsmE gene can grow on the same plate. + The growth of TsmE was significantly inhibited.

[0041] The above-mentioned basic salt culture medium formula is as follows: 1.0g NH4Cl, 0.5g NaCl, 1.5g K2HPO4, 0.5g KH2PO4, 0.2g MgSO4·7H2O, and deionized water is added to a final volume of 1L. 2% agar powder is added to the solid culture medium.

[0042] (4) Acquire the mutated resistance gene

[0043] Sequencing of the mutant M8 gene, as shown in SEQ ID NO.3, revealed that its nucleotide sequence at positions 239-242 changed from CATA to GAGC, at position 527 from G to C, at positions 532-533 from TC to GT, at position 544 from G to A, and at positions 983-984 from GG to TC. This resulted in the following mutations in its amino acid sequence (as shown in SEQ ID NO.4): at positions 80-81, proline and tyrosine changed to arginine and alanine; at positions 176, 178, and 182, glycine, serine, and glycine changed to alanine, valine, and arginine; and at position 328, tryptophan changed to phenylalanine.

[0044] Sequencing of the mutant M9 gene, as shown in SEQ ID NO.5, revealed that its nucleotide sequence at positions 239-242 changed from CATA to GAGC, at position 527 from G to C, at positions 532-533 from TC to GT, at position 544 from G to A, and at positions 983-984 from GG to AC. This resulted in the following mutations in its amino acid sequence (as shown in SEQ ID NO.6): at positions 80-81, proline and tyrosine changed to arginine and alanine; at positions 176, 178, and 182, glycine, serine, and glycine changed to alanine, valine, and arginine; and at position 328, tryptophan changed to tyrosine.

[0045] Example 2

[0046] High-efficiency expression of the coding genes (SEQ ID NO.3 and SEQ ID NO.5) of mutants M8 and M9 in BL21(pET-29a(+)) was achieved. The experimental method is as follows:

[0047] (1) Construction of bacterial expression vectors and acquisition of recombinant microorganisms

[0048] The nucleotide sequences (1215 bp) of the M8 gene (SEQ ID NO.3) and the M9 gene (SEQ ID NO.5) with Nde I / Hind III restriction sites were synthesized, as shown in SEQ ID NO.7 (containing the M8 gene) and SEQ ID NO.8 (containing the M9 gene) in the sequence listing.

[0049] The synthesized nucleotide sequences of SEQ ID NO.7 and SEQ ID NO.8 were cloned into the pUC57 vector to obtain recombinant vectors pUC-M8 and pUC-M9. Recombinant vectors pUC-M8 and pUC-M9, along with the pET-29a(+) plasmid, were digested with restriction endonucleases Nde I and Hind III, respectively. The digestion systems are as follows:

[0050] 10×M Buffer 5μL Nde I (10 U / μL) 2.0μL HindⅢ (10 U / μL) 2.0μL DNA (pUC-M8, pUC-M9, or pET-29a(+) plasmid) 30μL <![CDATA[ddH2O]]> 11μL

[0051] The enzymes were digested at 37°C for 12 hours using the above-described enzyme digestion system. The excised M8 and M9 gene fragments were then ligated into the digested bacterial expression vector pET-29a(+). The constructed recombinant expression vectors were named pET29a-M8 and pET29a-M9, respectively. Figure 1 As shown. The recombinant expression vector was transformed into the expression host bacterium BL21(DE3) to obtain recombinant microorganisms BL21(M8) and BL21(M9).

[0052] (3) Expression and purification of TsmE mutant

[0053] BL21(M8) and BL21(M9) were inoculated into LB medium and cultured at 37°C and 200 rpm on a shaker until the OD600 nm reached 0.6. IPTG was then added to a concentration of 0.4 mM, and the culture was induced at 16°C for 12 h. The bacterial cells were collected by centrifugation of 100 ml of bacterial culture, washed twice with PBS (50 mM, pH 7.4), resuspended in 10 ml of PBS buffer, sonicated (Auto Science, UH-650 Ultrasonic processor, 30% intensity) for 7 min, centrifuged at 12000 rpm for 30 min, and the supernatant was collected. The TsmE mutant was purified using a nickel affinity chromatography column. The purified enzyme was then subjected to protein electrophoresis. (See attached image). Figure 2 .

[0054] Example 3

[0055] This embodiment describes the determination of the activities of TsmE mutant M8 and M9 proteases using the following method: An enzyme activity reaction system (1 mL) was set up by adding purified TsmE mutant M8 and M9 proteases and 100 μM sulfonylurea herbicide substrate to 50 mM PBS buffer (pH 7.4). Timing for each reaction began with the addition of the enzyme, and the reaction was terminated by rapidly adding an equal volume of acetonitrile after reacting at 30°C for 10 min. A control without enzyme addition was used, and the activity of the mutants was determined by detecting the reduction in the amount of each sulfonylurea substrate using high-performance liquid chromatography (HPLC).

[0056] HPLC conditions were: UltiMate The system used was a 3000 Titanium System high-performance liquid chromatograph; a Thermo Scientific Syncronis C18 column (5 μm, 250 mm × 4.6 mm); the mobile phase was acetonitrile / water (60 / 40, v / v), with 0.5% acetic acid added to the water; the flow rate was 1 mL / min; the injection volume was 20 μL; the detection wavelengths were 230 nm and 255 nm; and the column temperature was 40 °C. One unit of enzyme activity (U) is defined as the amount of enzyme required to catalyze the hydrolysis of 1.0 μmol of substrate in 1 min at pH 7.4 and 30 °C.

[0057] The liquid chromatograms of purified mutants M8 and M9 enzymes catalyzing the formation of acid products from mesosulfuron-methyl and sodium mesosulfuron-methyl are shown below. Figure 3 As shown in the diagram, the red curve represents the chromatographic peak of mesosulfuron-methyl or sodium mesosulfuron-methyl before the reaction begins, while the black curve represents the chromatographic peak of the mesosulfuron-methyl acid product or sodium mesosulfuron-methyl hydrochloride product after 10 minutes of reaction. It can be seen that after 10 minutes of reaction, mesosulfuron-methyl or sodium mesosulfuron-methyl degrades into the corresponding acid products. Calculations show that the specific enzyme activities of mutant M8 for mesosulfuron-methyl and sodium mesosulfuron-methyl are 0.43 U / mg and 0.92 U / mg, respectively; and the specific enzyme activities of mutant M9 for mesosulfuron-methyl and sodium mesosulfuron-methyl are 0.45 U / mg and 0.95 U / mg, respectively. These specific enzyme activity values ​​are significantly greater than the specific enzyme activity values ​​of the TsmE mutant disclosed in patent application CN115960861A. Specific enzyme activity is defined as the catalytic activity units per milligram of enzyme protein, i.e., enzyme activity divided by mass.

[0058] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A sulfonylurea herbicide hydrolase TsmE mutant, characterized in that, The mutants are either M8 or M9. Mutant M8 has the following amino acid sequences in the wild-type sulfonylurea herbicide hydrolase TsmE: arginine at position 80, alanine at positions 81 and 176, valine at position 178, arginine at position 182, and phenylalanine at position 328. Mutant M9 has the following amino acid sequences in the wild-type sulfonylurea herbicide hydrolase TsmE: arginine at position 80, alanine at positions 81 and 176, valine at position 178, arginine at position 182, and tyrosine at position 328. The amino acid sequence of mutant M8 is shown in SEQ ID NO. 4, and the amino acid sequence of mutant M9 is shown in SEQ ID NO.

6.

2. The gene encoding the sulfonylurea herbicide hydrolase TsmE mutant according to claim 1, characterized in that, The nucleotide sequence of the gene encoding mutant M8 is shown in SEQ ID NO.3; the nucleotide sequence of the gene encoding mutant M9 is shown in SEQ ID NO.

5.

3. A recombinant expression vector containing the gene encoding the sulfonylurea herbicide hydrolase TsmE mutant as described in claim 2.

4. The recombinant expression vector according to claim 3, characterized in that, The recombinant expression vector was obtained by inserting the coding gene of the sulfonylurea herbicide hydrolase TsmE mutant into the Nde I and Hind III restriction sites of the prokaryotic expression vector pET-29a (+).

5. Genetically engineered bacteria containing the gene encoding the TsmE mutant of the sulfonylurea herbicide hydrolase as described in claim 2.

6. The genetically engineered bacterium according to claim 5, characterized in that, The expression host bacterium of the genetically engineered bacteria is Escherichia coli BL21(DE3).

7. The use of the TsmE mutant of sulfonylurea herbicide hydrolase according to claim 1 in the preparation of products that degrade sulfonylurea herbicides.

8. The application of the sulfonylurea herbicide hydrolase TsmE mutant of claim 1, the TsmE mutant encoding gene of claim 2, the recombinant expression vector of claim 3, or the genetically engineered bacteria of claim 5 in the biological degradation of sulfonylurea herbicide residues in soil or water.

9. The application of the TsmE mutant encoding gene of sulfonylurea herbicide hydrolase as described in claim 2 in the construction of transgenic crops resistant to sulfonylurea herbicides.

Images