Saccharomyces cerevisiae engineering bacteria with high yield of T4N5, construction method and application thereof

Abstract

The application discloses a high-yield T4N5 Saccharomyces cerevisiae engineering bacterium and a construction method and application thereof. The application takes Saccharomyces cerevisiae as a bottom cell, carries out site excavation, integrates different reporter genes (GUS or YPet) on a site XIV-68 and carries out characterization, determines that the XIV-68 site is a high-expression site in Saccharomyces cerevisiae. After knocking in a T4N5 expression box to the XIV-68 site, efficient expression of recombinant T4N5 is realized; further knocking out a SED1 gene, a mutant strain can efficiently lyse a cell wall, release intracellular substances to the outside of the cell, and effective purification of the recombinant T4N5 is completed by affinity chromatography and desalination. The T4N5 produced in the application has a good repairing effect on DNA damage formed by ultraviolet irradiation. Production of the T4N5 by using the recombinant Saccharomyces cerevisiae strain can effectively solve the problem of drug source, has the advantages of saving material resources and protecting the environment.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering and relates to a high-yield T4 endonuclease V (T4N5) engineered Saccharomyces cerevisiae strain, its construction method, and its application. Background Technology

[0002] T4 endonuclease V (T4N5) is an endonuclease derived from T4 bacteriophage, with a molecular weight of approximately 16.1 kDa. It was initially isolated by Tanaka et al. in 1975 from *E. coli* infected with T4 bacteriophage. T4 endonuclease V is involved in the repair of DNA damage caused by ultraviolet radiation; it is a bifunctional enzyme containing both pyrimidine dimer-DNA glycosidase and depurine-depyrimidine endonuclease activities. T4 endonuclease V can specifically recognize cyclobutane pyrimidine dimers (CPDs) formed in DNA due to ultraviolet irradiation. When it recognizes a CPD, it will cleave it. In this process, pyrimidine dimer-DNA glycosylase first cleaves the glycosidic bond between the 5' pyrimidine and deoxyribose in the CPD to form a depyrimidine site. Then, depurine-depyrimidine endonuclease cleaves the phosphodiester bond between two adjacent deoxyribose in the depyrimidine site to form nicked DNA.

[0003] Ultraviolet (UV) radiation is a significant factor in the development of skin cancer. Prolonged sun exposure can induce the formation of pyrimidine dimers in skin cell DNA, causing DNA damage. Some experiments have demonstrated that T4 endonuclease V can effectively reduce the incidence of skin cancer. For example, a mouse study by Wolf et al. showed that T4N5 liposomes can serve as an effective adjuvant in sunscreens, reducing the formation of sunburned cells.

[0004] Production cases of recombinant T4 endonuclease V have been reported both domestically and internationally. Currently, the mainstream production method uses E. coli as the expression host. However, using E. coli as the host for T4 endonuclease V production often leads to the formation of inclusion bodies, resulting in complex subsequent purification processes and limiting its large-scale production.

[0005] Saccharomyces cerevisiae is a widely studied single-celled eukaryotic microorganism that has been extensively used in the biosynthesis of various natural compounds. It possesses a complex cell wall structure. The cell wall of Saccharomyces cerevisiae is approximately 100–300 nm thick, resembling a "sandwich" structure, and is mainly composed of β-D-glucan, α-D-mannose, and a small amount of chitin. The SED1 gene is present in the Saccharomyces cerevisiae genome. Its translated protein, Sed1p, is glycosylated to form mannoprotein. Mannoprotein and glucan are covalently bonded and ultimately anchored to the outer side of the cell wall (Shimoi H, et al. Sed1p is a major cell wall protein of Saccharomyces cerevisiae in the stationary phase and is involved in lytic enzyme resistance. J Bacteriol, 1998, 180:3381-7.). Because mannose proteins are located on the outer side of the cell wall, some researchers have fused exogenous proteins with Sed1p proteins for expression, allowing the exogenous proteins to be displayed on the cell surface (Kuroda K, et al. Enhancement of display efficiency in yeast display system-temby vector engineering and gene disruption. Appl Microbiol Biotechnol, 2009, 82: 713–9.).Sed1p protein can maintain the stability of cell wall and mitochondrial genome. At the same time, knocking out SED1 gene will not affect normal cell growth, but will increase the tolerance of yeast cells to lactic acid (Phadnis Net al. Role of the putative structural protein Sed1p in mitochondrial genome maintenance. J Moliol, 2004, 342(4):1115-29; Toshihiro S, et al. Disruption of multiple genes whose deletion causes lactic-acid resistance improves lactic-acid resistance and productivity in Saccharomyces cerevisiae. J BIOSCI BIOENG, 2013, 115(5):467-474).

[0006] Therefore, obtaining a strain capable of producing high levels of T4N5 and rapidly releasing intracellular proteins is of great significance for industrial production. Summary of the Invention

[0007] In order to overcome the shortcomings and deficiencies of the existing technology, the purpose of this invention is to provide a high-yield T4N5 brewing yeast engineered strain.

[0008] Another objective of this invention is to provide a method for constructing a high-yield T4N5 engineered Saccharomyces cerevisiae strain.

[0009] Another object of the present invention is to provide the application of the above-mentioned high-yield T4N5 brewing yeast engineered strain.

[0010] This invention uses *Saccharomyces cerevisiae* as the chassis cell and performs site mining. By integrating different reporter genes (GUS or YPet) at site XIV-68 and characterizing them, XIV-68 was identified as a high-expression site in *Saccharomyces cerevisiae*. After knocking in the T4 endonuclease V (T4N5) expression cassette to site XIV-68, efficient expression of recombinant T4N5 was achieved. Further knocking out the SED1 gene in the *Saccharomyces cerevisiae* genome resulted in a mutant strain that could efficiently lyse the cell wall, releasing intracellular substances into the extracellular space. The recombinant T4N5 was effectively purified using affinity chromatography and desalting. The T4N5 produced in this invention exhibits excellent repair properties for DNA damage (i.e., pyrimidine dimer DNA) caused by ultraviolet irradiation.

[0011] The objective of this invention is achieved through the following technical solution:

[0012] Application of the XIV-68 locus on the chromosome of Saccharomyces cerevisiae in the high expression of exogenous metabolites in Saccharomyces cerevisiae chassis cells.

[0013] Preferably, the nucleotide sequence of the Saccharomyces cerevisiae chromosome XIV-68 site includes the gRNA target sequence of the XIV-68 site and sequences within 500 bp upstream and downstream of it.

[0014] Further preferred, the nucleotide sequence of the Saccharomyces cerevisiae chromosome XIV-68 site includes the gRNA target sequence of the XIV-68 site and sequences within 100 bp upstream and downstream of it.

[0015] The gRNA target sequence at the XIV-68 site is 5′-AAAGAATCATAGATCGTCAA-3′.

[0016] By integrating the β-glucuronidase gene (GUS), the YPet fluorescent reporter gene, or the T4N5 gene into the XIV-68 site of the Saccharomyces cerevisiae chromosome, we verified that the XIV-68 site has a high expression intensity, indicating that the XIV-68 site is a high expression site in Saccharomyces cerevisiae.

[0017] A high-yielding T4N5-producing engineered Saccharomyces cerevisiae strain was obtained by integrating the T4N5 gene into the XIV-68 site of the Saccharomyces cerevisiae chromosome using Saccharomyces cerevisiae as the starting strain.

[0018] To further improve the harvesting efficiency of T4N5, it is necessary to improve the lysis efficiency of Saccharomyces cerevisiae. Based on the above-mentioned engineered Saccharomyces cerevisiae, the SED1 gene is knocked out.

[0019] Furthermore, it also includes: knocking out the SED1 gene in the Saccharomyces cerevisiae genome to obtain an engineered Saccharomyces cerevisiae strain that integrates the T4N5 gene and knocks out the SED1 gene to produce high-yield T4N5.

[0020] The amino acid sequence encoded by the T4N5 gene is shown in NP_049733.1.

[0021] Preferably, the nucleotide sequence of the T4N5 gene is shown in SEQ ID No. 1, from 37 to 450 bp.

[0022] Furthermore, for ease of purification, a histidine tag and / or the corresponding nucleic acid sequence encoding the protease cleavage site are added to the 5′ end of the T4N5 gene;

[0023] Preferably, the histidine tag is a histidine tag composed of 4-10 histidines in series; more preferably, it is a histidine tag composed of 6 histidines in series (6×His tag), and its nucleotide sequence is shown as 4 to 21 bp of SEQ ID No. 1.

[0024] Preferably, the protease cleavage site is the enterokinase cleavage site DDDDK, and its nucleotide sequence is shown in SEQ ID No. 1, 22-36 bp.

[0025] A further preferred embodiment is the T4N5 gene with a histidine tag and a protease cleavage site sequentially added to the 5′ end, corresponding to the nucleic acid sequence, as shown in SEQ ID No. 1.

[0026] Furthermore, the expression cassette of the T4N5 gene was integrated into the XIV-68 site of the Saccharomyces cerevisiae chromosome.

[0027] Preferably, the expression cassette of the T4N5 gene includes a promoter, the T4N5 gene, and a terminator; specifically selected from constitutive strong promoters (P... CCW12 P TDH3 P PDC1 and P TEF1 (at least one of them) and terminator (T) RPL3 T PGK1 T BNA4 and T FBA1 (at least one of the following) can be combined with the target gene for expression.

[0028] More preferably, the expression cassette of the T4N5 gene is P TDH3-524 -T4N5-T FBA1 Its nucleotide sequence is shown as SEQ ID No. 2, 41-1428bp.

[0029] A method for constructing a high-yield T4N5 engineered Saccharomyces cerevisiae strain includes the following steps:

[0030] 1) Design gRNA target sequences based on the XIV-68 site on the Saccharomyces cerevisiae chromosome;

[0031] 2) Construct a recombinant vector based on the gRNA target sequence from step 1);

[0032] 3) Prepare donor DNA containing the T4N5 gene;

[0033] 4) Simultaneously transform the recombinant vector from step 2) and the donor DNA containing the T4N5 gene from step 3) into the Saccharomyces cerevisiae that has been transformed with the Cas9 gene to achieve the integration of the T4N5 gene and obtain an engineered Saccharomyces cerevisiae strain that integrates the T4N5 gene and produces high-yield T4N5.

[0034] To further improve the harvesting efficiency of T4N5, it is necessary to improve the lysis efficiency of Saccharomyces cerevisiae. Based on the above-mentioned engineered Saccharomyces cerevisiae, the SED1 gene is knocked out.

[0035] Furthermore, it also includes:

[0036] 5) Knock out the SED1 gene in the genome of the engineered Saccharomyces cerevisiae from step 4) to achieve the integration of the T4N5 gene and the knockout of the SED1 gene, thereby obtaining a high-yielding engineered Saccharomyces cerevisiae that integrates the T4N5 gene and knocks out the SED1 gene.

[0037] Preferably, the gRNA target sequence in step 1) is 5′-AAAGAATCATAGATCGTCAA-3′.

[0038] Preferably, the recombinant vector in step 2) includes a gXIV-68 expression cassette, and the nucleotide sequence of the gXIV-68 expression cassette can be any sequence of the gXIV-68 expression cassette, and is further preferably as shown in SEQ ID No. 3.

[0039] The starting vector used to construct the recombinant vector can be any type of Saccharomyces cerevisiae vector, preferably p426 (the commercial plasmid p426-SNR52p-gRNA.CAN1.Y-SUP4t from Addgene) as the starting vector, and the constructed recombinant vector is p426-gXIV-68.

[0040] Preferably, the donor DNA containing the T4N5 gene in step 3) includes a homologous sequence of 40-100 bp (preferably 40 bp) upstream of the gRNA target sequence, the T4N5 gene or the T4N5 gene expression cassette, and a homologous sequence of 40-100 bp (preferably 40 bp) downstream of the gRNA target sequence; more preferably as shown in SEQ ID No. 2.

[0041] Preferably, the Saccharomyces cerevisiae that has been transformed with the Cas9 gene in step 4) is obtained by transforming with a plasmid carrying the Cas9 gene; specifically, it is obtained by transforming with the p414 plasmid (the commercial plasmid p414-TEF1p-Cas9-CYC1t from Addgene).

[0042] Preferably, the brewing yeast in step 4) is brewing yeast BJ5464, brewing yeast BY4741 or brewing yeast CEN.PK2-1Ca, but is not limited to these.

[0043] Preferably, the engineered Saccharomyces cerevisiae in step 4) is Saccharomyces cerevisiae BJ5464 / XIV-68::P TDH3-524 -T4N5-T FBA1 Saccharomyces cerevisiae BY4741 / XIV-68::PTDH3-524 -T4N5-T FBA1 Or brewer's yeast CEN.PK2-1Ca / XIV-68::P TDH3-524 -T4N5-T FBA1 .

[0044] Preferably, in step 5), knocking out the SED1 gene in the genome of the engineered Saccharomyces cerevisiae from step 4) includes the following steps:

[0045] a) Design gRNA target sequences based on the SED1 gene in the genome;

[0046] b) Construct a recombinant vector based on the gRNA target sequence from step a);

[0047] c) Simultaneously transform the recombinant vector and donor DNA from step b) into the Saccharomyces cerevisiae engineered strain from step 4) which has been transformed with the Cas9 gene, to achieve the integration of the T4N5 gene and the knockout of the SED1 gene.

[0048] Preferably, the gRNA target sequence in step a) is 5′-AGAGGAGGAAGTGACATCGG-3′.

[0049] Preferably, the recombinant vector in step b) includes the gSED1 expression cassette, and the nucleotide sequence of the gSED1 expression cassette can be any sequence of the gXIV-68 expression cassette, and is further preferably as shown in SEQ ID No. 4.

[0050] Preferably, the donor DNA nucleotide sequence in step c) can be any sequence of donor DNA, and more preferably as shown in SEQ ID No. 5.

[0051] The starting vector used to construct the recombinant vector can be any type of Saccharomyces cerevisiae vector, preferably p426 (the commercial plasmid p426-SNR52p-gRNA.CAN1.Y-SUP4t from Addgene) as the starting vector, and the constructed recombinant vector is p426-gSED1.

[0052] Preferably, the Saccharomyces cerevisiae engineered strain in step 4) that has been transformed with the Cas9 gene in step c) is obtained by transforming with a plasmid carrying the Cas9 gene; specifically, it is obtained by transforming with the p414 plasmid (the commercial plasmid p414-TEF1p-Cas9-CYC1t from Addgene).

[0053] Preferably, the engineered Saccharomyces cerevisiae in step 5) is Saccharomyces cerevisiae BJ5464 / XIV-68::P TDH3-524 -T4N5-T FBA1 / Δsed1、Saccharomyces cerevisiae BY4741 / XIV-68::PTDH3-524 -T4N5-T FBA1 / Δsed1 or brewer's yeast CEN.PK2-1Ca / XIV-68::P TDH3-524 -T4N5-T FBA1 / Δsed1.

[0054] Application of the above-mentioned engineered Saccharomyces cerevisiae in high-yield T4N5.

[0055] Furthermore, a method for producing T4N5 involves activating the engineered Saccharomyces cerevisiae; inoculating the activated strain into a fermentation medium for fermentation culture; and collecting the cell bodies to extract T4N5 after fermentation culture.

[0056] Preferably, the method for producing T4N5 involves inoculating the engineered Saccharomyces cerevisiae into a seed culture medium and activating it at 30±2℃ and 220±20rpm for 12±2h, then transferring it to a fresh seed culture medium and fermenting it at 30±2℃ and 220±20rpm for 30±2h. After collecting the cells, the cells are subjected to steps such as disruption and lysis, Ni affinity chromatography, and desalting to obtain recombinant T4N5 protein with high purity; wherein the seed culture medium is YPD.

[0057] The present invention has the following advantages and effects compared with the prior art:

[0058] This invention enables the biosynthesis of T4N5 in *Saccharomyces cerevisiae* strains using glucose as a carbon source. In recombinant *Saccharomyces cerevisiae* strains, the optimized T4N5 gene expression cassette is integrated into the XIV-68 locus of the genome to achieve T4N5 production. Further knocking out the SED1 gene in the *Saccharomyces cerevisiae* genome yields a mutant strain that can efficiently lyse the cell wall, releasing intracellular substances into the extracellular space. Using the recombinant *Saccharomyces cerevisiae* strain described in this invention to produce T4N5 effectively solves the problem of drug source, and has the advantages of saving material resources and protecting the environment. Attached Figure Description

[0059] Figure 1 The results are fluorescence detection results of strains in Example 4 in which the YPet expression cassette was integrated into the XIV-68 site and the LEU site, respectively.

[0060] Figure 2 The results are the enzyme activity detection results of the strains in Example 4 in which the GUS expression cassette was integrated into the XIV-68 site and the LEU site, respectively.

[0061] Figure 3 These are the SDS-PAGE results of strains in Example 5 in which the T4N5 expression cassette was integrated into the XIV-68 site and the LEU site, respectively; where LEU::T4N5 refers to BJ5464 / LEU::P TDH3-524 -T4N5-T FBA1XIV-68::T4N5 refers to BJ5464 / XIV-68::P TDH3-524 -T4N5-T FBA1 .

[0062] Figure 4 This refers to the effect of SED1 gene knockout on T4N5 protein gain in Example 6; where XIV-68::T4N5 refers to BJ5464 / XIV-68::P TDH3-524 -T4N5-T FBA1 XIV-68::T4N5ΔSED1 refers to BJ5464 / XIV-68::P TDH3-524 -T4N5-T FBA1 / Δsed1.

[0063] Figure 5 This is the result of purification and desalting of recombinant T4 endonuclease V (T4N5) in Example 7.

[0064] Figure 6 This is the activity verification result of recombinant T4 endonuclease V (T4N5) in Example 8. Detailed Implementation

[0065] The present invention will be further described in detail below with reference to embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto. The following embodiments are for illustrative purposes only and are not intended to limit the scope of the present invention. It should be noted that those skilled in the art can make several changes and improvements on this basis without departing from the concept of the present invention, such as changing the type of expression vector, changing the method of constructing the expression vector, changing the type of host cell, etc. These all fall within the protection scope of the present invention.

[0066] In the embodiments, YEp181 plasmid refers to YEplac181 plasmid, plasmid p426 refers to plasmid p426-SNR52p-gRNA.CAN1.Y-SUP4t, and plasmid p414 refers to plasmid p414-TEF1p-Cas9-CYC1t.

[0067] Example 1: Construction of a gene integration expression cassette

[0068] In this embodiment, the codon-optimized nucleotide sequence of T4N5 (NP_049733.1) with an amino terminus fused to a 6×His tag and an enterokinase site (HHHHHHDDDDK) is shown in SEQ ID NO.1. This sequence was artificially synthesized using the whole genome and embedded in the Puc57 plasmid. DNA detection analysis showed that the synthesized sequence was consistent with the designed sequence and was used for the construction of the following recombinant plasmid, named Puc57-T4N5.

[0069] The carrier YEp181-P used in the embodiments TDH3-524 -T4N5-T FBA1 Its construction process is as follows:

[0070] To amplify the T4N5 gene, a primer pair, P1 and P2, was designed and synthesized. The primer sequences are as follows:

[0071] P1: 5′- AACAAACAAActcgagATG CATCATCATCATCATCATGAC-3′;

[0072] P2: 5′- AATTTGAATTAACTCTGCAG TTAAGCGTAGATAGCTTTAC-3′;

[0073] Note: Underlined sequences indicate bases homologous to the sequence of the fragment to be ligated, and lowercase letters indicate XhoI restriction sites.

[0074] Using plasmid Puc57-T4N5 as a template, PCR was performed using primers P1 / P2 to obtain the T4N5 gene fragment.

[0075] Using the YEp181 plasmid purchased from Invitrogen as a template, PCR was performed using primers YEp181-F1 / YEp181-R1 to obtain the linearized fragment of the YEp181 plasmid. The primer sequences are as follows:

[0076] YEp181-F1: 5′-AAGCTTGGCGTAATCATGGT-3′;

[0077] YEp181-R1: 5′-GGATCCCCGGGTACCGAGCT-3′;

[0078] The PCR reaction system and conditions described above are shown in Table 1.

[0079] Table 1. Prime STAR PCR System and Conditions

[0080]

[0081] After the PCR reaction, the size of the amplified gene fragment was checked by agarose gel electrophoresis. If the band size was correct, the amplified fragment was purified using an oligonucleotide purification kit (purchased from Sangon Biotech (Shanghai) Co., Ltd.). The concentration of the gene fragment was detected and recorded by a micro spectrophotometer.

[0082] The genome of *Saccharomyces cerevisiae* BJ5464 was extracted using the Yeast DNA Kit. Using the genome as a template, the PCR enzyme KOD FX (purchased from TOYOBO, Japan) was used to amplify the TDH3 promoter fragment using primers 181-TDH3-F / TDH3-R, and the FBA1 terminator fragment was amplified using primers FBA1t-F / 181-FBA1t-R.

[0083] The specific primer sequences are as follows (underlined sequences indicate bases homologous to the vector sequence):

[0084] 181-TDH3-F:5′- AGCTCGGTACCCGGGGATCC ATAACATCGTAGGTGTCTGG-3′;

[0085] TDH3-R: 5′-CATCTCGAGTTTGTTTGTTTA-3′;

[0086] FBA1t-F: 5′-CTGCAGAGTTAATTCAAATTAAT-3′;

[0087] 181-FBA1t-R:5′- ACCATGATTACGCCAAGCTT AGTAAGCTACTATGAAAGA-3′;

[0088] The PCR reaction system and conditions are shown in Table 2.

[0089] Table 2. KOD-FX PCR system and conditions

[0090]

[0091] After the PCR reaction, the size of the amplified gene fragment was checked by agarose gel electrophoresis. If the band size was correct, the amplified fragment was purified using an oligonucleotide purification kit, and the concentration of the gene fragment was detected and recorded using a micro spectrophotometer.

[0092] Using ClonExpress R The MultiS One Step Cloning Kit (purchased from Nanjing Novizan Biotechnology Co., Ltd.) was used to perform multi-fragment homologous recombination ligation of the obtained TDH3 promoter fragment, FBA1 terminator fragment, YEp181 plasmid vector fragment, and T4N5 fragment to obtain the vector YEp181-P. TDH3-524 -T4N5-T FBA1 .

[0093] The ligation product was then chemically transformed into E. coli DH5α competent cells and plated on LB / Amp (10 g / L Tryptone, 5 g / L Yeast Extract, 5 g / L NaCl, Ampicillin 100 μg / mL) plates. Single colonies were picked and patched on LB / Amp plates and incubated for 5–6 h. Positive selection of single colonies was performed using colony PCR. In a clean bench, 3–5 single colonies were picked and dissolved in 20 μL ddH2O, lysed at 95 °C for 10 min, and centrifuged at 14000 rpm for 5 min. The resulting supernatant was used as the template for colony PCR. The reaction system and conditions for colony PCR are shown in Table 3.

[0094] Table 3. PCR reaction system and conditions for Escherichia coli colonies

[0095]

[0096] The primers for colony PCR are shown below:

[0097] M13fwd: 5′-GTAAAACGACGGCCAGT-3′;

[0098] Check-R: 5′-TTTCACACAGGAAACAGCTA-3′;

[0099] After the colony PCR reaction, the PCR products were subjected to agarose gel electrophoresis to verify whether the fragment size met expectations. Based on the electrophoresis results, strains corresponding to the band sizes were selected and inoculated into LB / Amp+ liquid medium, cultured overnight at 37°C and 220 rpm. Recombinant plasmids were extracted from the bacterial cells using a rapid plasmid mini-prep kit (purchased from Tiangen (Beijing) Co., Ltd.) and sent to Sangon Biotech (Shanghai) Co., Ltd. for gene sequencing. The sequencing results were analyzed using Snapgene software, ultimately yielding the recombinant plasmid YEp181-P containing the T4N5 gene. TDH3-524 -T4N5-T FBA1 .

[0100] Using E. coli DH5α genomic DNA as a template, the β-glucuronidase gene (GUS) fragment was amplified using GUS-F / GUS-R primers.

[0101] The primer sequences are as follows: (Underlined bases indicate bases homologous to the sequence of the fragment to be ligated)

[0102] GUS-F: 5'- AACAAACAAActcgagATG TTACGTCCTGTAGAAAC-3′;

[0103] GUS-R: 5'- AATTTGAATTAACTCTGCAG TCATTGTTTGCCTCCCTGCT-3′;

[0104] With YEp181-P TEF1 -YPET-T FBA1 Using plasmids as templates, the YPet fluorescent reporter gene fragment was amplified using YPet-F / YPet-R primers. Specifically, Yep181-P TEF1 -YPET-T FBA1 The plasmid is disclosed in "CN202110962577.0, A method for fine regulation of gene expression based on genomic loci".

[0105] The primer sequences are as follows: (Underlined bases indicate bases homologous to the sequence of the fragment to be ligated)

[0106] YPet-F:5′- AACAAACAAActcgagATG TCTAAAGGTGAAGAATTAT-3′;

[0107] YPet-R: 5′- AATTTGAATTAACTCTGCAG TTATTTGTACAATTCATCAAT-3′;

[0108] Following the above method, recombinant plasmids as shown in Table 4 were obtained through multi-fragment homologous recombination.

[0109] Table 4. Recombinant plasmids

[0110] <![CDATA[YEp181-P TDH3-524 -YPet-T FBA1 ]]> <![CDATA[YEp181-P TDH3-524 -GUS-T FBA1 ]]>

[0111] Example 2 Construction of Saccharomyces cerevisiae recombinant vector and donor DNA

[0112] The recombinant vectors p426-gXIV-68 and p426-gLEU (using the leucine (LEU) site in the genome as a control site) of *Saccharomyces cerevisiae* and their corresponding donor DNA were constructed as follows:

[0113] 1. Construction of the recombinant vector p426-gXIV-68

[0114] Based on the prediction results from the CRISPR-Direct website, the gRNA target sequence at the XIV-68 site (S.cerevisiae / NC_001146.8) was determined to be: 5′-AAAGAATCATAGATCGTCAA-3′;

[0115] Using the commercially available plasmid p426 as a template, and primer pairs P3 / P5 and P4 / P6 respectively, PCR amplification was performed to obtain the gXIV-68-1 and gXIV-68-2 fragments. ClonExpress was used for the amplification. RII. Recombinant Cloning Kit: Recombinantly recombinantly recombinantly recombinant fragments gXIV-68-1 and gXIV-68-2 to obtain the recombinant vector p426-gXIV-68 carrying the XIV-68 site guide RNA sequence, wherein the nucleotide sequence of the gXIV-68 expression cassette is shown in SEQ ID No. 3.

[0116] The specific primer sequences are as follows (underlined sequences indicate bases homologous to the vector sequence):

[0117] P3: 5′-TTGACGATCTATGATTCTTT GATCATTTATCTTTCACTGC -3′;

[0118] P4: 5′-AAAGAATCATAGATCGTCAA GTTTTAGAGCTAGAAATAGC -3′;

[0119] P5: 5′-TAATAATGGTTTCTCTAGTATGA-3′;

[0120] P6: 5′-ACTAAGAAACATTATTATCAT-3′;

[0121] 2. Construction of the recombinant vector p426-gLEU

[0122] Based on the prediction results from the CRISPR-Direct website, the gRNA target sequence at the LEU site was determined to be: 5′-AATATAATCAGATGGTTGCG-3′;

[0123] Using the commercial plasmid p426 as a template, and primer pairs P5 / P11 and P6 / P12 as primers, the gLEU-1 and gLEU-2 fragments were amplified, respectively. The remaining methods were the same as above to obtain the recombinant vector p426-gLEU carrying the LEU site guide RNA sequence.

[0124] The specific amplification primers are as follows (underlined sequences indicate bases homologous to the vector sequence):

[0125] P11: 5′-CGCAACCATCTGATTATATT GATCATTTATCTTTCACTGC -3′;

[0126] P12: 5′-AATATAATCAGATGGTTGCG GTTTTAGAGCTAGAAATAGC -3′;

[0127] 3. Amplifying donor DNA

[0128] 1) Donor-LEU-YPet

[0129] With YEp181-PTDH3-524 -YPet-T FBA1 Using P13 / P14 as primers, the Donor-LEU-YPet fragment was amplified. The specific amplification primers are as follows (underlined sequences indicate bases homologous to the genomic sequence):

[0130] P13: 5′- CAGCCACAGGTTGGTCATCAATACCACTGGGGGAGCATGC ATAACATCGTAGGTGTCTGG-3′;

[0131] P14: 5′- ATCTTAACTAATGTGTTCAGTTTTAGCTCTACTAGCTATT AGTAAGCTACTATGAAAGAC-3′;

[0132] 2) Donor-LEU-GUS

[0133] With YEp181-P TDH3-524 -GUS-T FBA1 Using P13 / P14 as primers, the Donor-LEU-GUS fragment was amplified, as described above.

[0134] 3) Donor-LEU-T4N5

[0135] With YEp181-P TDH3-524 -T4N5-T FBA1 Using P13 / P14 as primers, the Donor-LEU-T4N5 fragment was amplified, as described above.

[0136] 4) Donor-XIV-68-YPet

[0137] With YEp181-P TDH3-524 -YPet-T FBA1 Using P15 / P16 as primers, the Donor-XIV-68-YPet fragment was amplified. The specific amplification primers are as follows (underlined sequences indicate bases homologous to the genomic sequence):

[0138] P15: 5′- TATAAAAGAATAAATAATAGCGGTATTACGTGTGTTGGAA ATAACATCGTAGGTGTCTGG-3′;

[0139] P16: 5′- CGATCCATATTATAATAATACTGGTAATACAAATACTAGT AGTAAGCTACTATGAAAGAC-3′;

[0140] 5) Donor-XIV-68-GUS

[0141] With YEp181-P TDH3-524 -GUS-T FBA1Using P15 / P16 as primers, the Donor-XIV-68-GUS fragment was amplified as described above.

[0142] 6) Donor-XIV-68-T4N5

[0143] With YEp181-P TDH3-524 -T4N5-T FBA1 Using P15 / P16 as primers, the Donor-XIV-68-T4N5 fragment (its nucleotide sequence is shown in SEQ ID No. 2) was amplified, as described above.

[0144] Example 3: Construction of gene-integrating yeast strain using the CRISPR / Cas9 system

[0145] Competent S. cerevisiae BJ5464 cells (MATαura3-52 trp1 leu2Δ1his3Δ200pep4::HIS3prb1Δ1.6R can1 GAL, ATCC 208288) were prepared using the ScEasy Comp Transformation Kit (Invitrogen, USA). p426-gLEU and its corresponding Donor-LEU-YPet were simultaneously transformed into competent S. cerevisiae BJ5464 cells that had been transformed with the commercially available plasmid p414. For every 25 μL of competent cells, 500 ng of plasmid, 1000 ng of Donor, and 200 μL of Solution III (Transformation Kit) were added. The solution was vortexed until homogeneous, then placed in a 30°C incubator for 15 minutes. After removal, it was vortexed again and placed in a 30°C incubator for 15 minutes. This process was repeated twice. Then, all the bacterial culture was aspirated and evenly spread onto auxotrophic plates SD / ΔTrpΔUra (6.7 g / L yeast nitrogen source, 0.62 g / L auxotrophic amino acid mixture, 20 g / L glucose, 60 mg / L leucine). The plates were incubated at 30°C for 2–4 days. With the assistance of Cas9 protein, the gRNA target sequence transcribed from the gene was located, and the donor DNA was integrated into the chromosome editing site through homologous recombination, achieving the knock-in of the fluorescent reporter gene into the genome.

[0146] To verify the integration of the fluorescent reporter gene into the genome, three Saccharomyces cerevisiae transformants were randomly selected from each transformation plate and cultured for 12 h. Single clones were screened for positive results using colony PCR. A portion of the cells was dissolved in 20 μL NaOH (0.025 mol / L) in a clean bench, lysed at 98℃ for 20 min, and centrifuged at 14000 rpm for 5 min. The supernatant obtained was used as a template for colony PCR. Colony PCR amplification was performed using LEU-check-F / LEU-check-R primers, with specific reaction conditions shown in Table 2. The PCR products were then analyzed. Sequencing results showed that all three transformants had mutations at the LEU site, indicating successful integration of YEp181-P. TDH3-524 -YPet-T FBA1 Genes were used to obtain the mutant strain BJ5464 / LEU::P TDH3-524 -YPet-T FBA1 .

[0147] LEU-check-F: 5′-CAACAGGTGTGTATCCAGAA-3′;

[0148] LEU-check-R: 5′-CTCTTCCGTAATCTCGAGCC-3′.

[0149] Following the above method, p426-gLEU / gXIV-68 and the corresponding Donor fragment were simultaneously transformed into competent S. cerevisiae BJ5464 cells that had been transformed into the commercial plasmid p414. Colony PCR amplification of the XIV-68 site was performed using XIV-68-check-F / XIV-68-check-R primers for verification.

[0150] XIV-68-check-F: 5′-AGAACATATTTGCATATGTG-3′;

[0151] XIV-68-check-R: 5′-TGAATGTTAGAATTGTGCAA-3′.

[0152] The mutant strain BJ5464 / LEU::P was finally obtained. TDH3-524 -YPet-T FBA1 BJ5464 / LEU::P TDH3-524 -GUS-T FBA1 BJ5464 / LEU::P TDH3-524 -T4N5-T FBA1 BJ5464 / XIV-68::P TDH3-524 -YPet-T FBA1BJ5464 / XIV-68::P TDH3-524 -GUS-T FBA1 and BJ5464 / XIV-68::P TDH3-524 -T4N5-T FBA1 .

[0153] Similarly, following the method described above, S. cerevisiae BJ5464 was replaced with S. cerevisiae CEN.PK2-1Ca or S. cerevisiae BY4741. The following mutant strains were ultimately obtained:

[0154] CEN.PK2-1Ca / LEU::P TDH3-524 -YPet-T FBA1 CEN.PK2-1Ca / LEU::P TDH3-524 -GUS-T FBA1 CEN.PK2-1Ca / LEU::P TDH3-524 -T4N5-T FBA1 CEN.PK2-1Ca / XIV-68::P TDH3-524 -YPet-T FBA1 CEN.PK2-1Ca / XIV-68::P TDH3-524 -GUS-T FBA1 and CEN.PK2-1Ca / XIV-68::P TDH3-524 -T4N5-T FBA1 .

[0155] BY4741 / LEU::P TDH3-524 -YPet-T FBA1 BY4741 / LEU::P TDH3-524 -GUS-T FBA1 BY4741 / LEU::P TDH3-524 -T4N5-T FBA1 BY4741 / XIV-68::P TDH3-524 -YPet-T FBA1 BY4741 / XIV-68::P TDH3-524 -GUS-T FBA1 and BY4741 / XIV-68::P TDH3-524 -T4N5-T FBA1 .

[0156] Example 4: Validation of reporter gene integration in yeast strains

[0157] (1) Detection of YPet fluorescence

[0158] This will verify that BJ5464 / LEU::P is correct.TDH3-524 -YPet-T FBA1 and BJ5464 / XIV-68::P TDH3-524 -YPet-T FBA1 The mutant strains were streaked onto YPD agar plates (20 g / L glucose, 10 g / L yeast extract, 20 g / L peptone, 20 g / L agar powder) and incubated at 30°C for 72 h. Single colonies were picked and inoculated into YPD liquid medium (20 g / L glucose, 10 g / L yeast extract, 20 g / L peptone) and incubated at 30°C until the stationary phase. Then, 10 mL of YPD liquid medium was added to a 50 mL Erlenmeyer flask, and bacterial culture was added to the flask. The initial OD of the bacterial culture in the flask was controlled. 600 The concentration was 0.05, and the culture was carried out at 30℃ and 220 rpm for 12 h. 200 μL of the bacterial culture was centrifuged at 4000 g for 2 min, resuspended in PBS (phosphate-buffered saline), and placed in a 96-well plate. OD200 was then analyzed. 600 In addition, fluorescence measurements were performed; the excitation wavelength of yellow fluorescent protein (YPet) was 528 nm, and the emission wavelength was 485 nm. The fluorescence intensity was calculated as the ratio of the sample's measured fluorescence intensity to its OD value. 600 The relative fluorescence intensity of the sample was used to characterize the expression intensity of this site, and the results are as follows: Figure 1 As shown, BJ5464 / XIV-68::P TDH3-524 -YPet-T FBA1 The mutant strain was used as the experimental group, BJ5464 / LEU::P TDH3-524 -YPet-T FBA1 The mutant strain served as the control group. Both the control and experimental groups had three replicates. Using a fluorescence microplate reader, the fold change of XIV-68 relative to the LEU site in the mutant strain was 52.42-fold, indicating that the XIV-68 site had a high expression intensity.

[0159] Similarly, through verification, CEN.PK2-1Ca / XIV-68::P TDH3-524 -YPet-T FBA1 The mutant strain was used as the experimental group, CEN.PK2-1Ca / LEU::P TDH3-524 -YPet-T FBA1 The mutant strain served as the control group. Both the control and experimental groups had three replicates. Using a fluorescence microplate reader, the fluorescence intensity of the XIV-68 mutant strain was higher than that of the LEU mutant strain at different sites, indicating that the XIV-68 site had a higher expression intensity.

[0160] BY4741 / XIV-68::P TDH3-524 -YPet-TFBA1 The mutant strain was used as the experimental group, BY4741 / LEU::P TDH3-524 -YPet-T FBA1 The mutant strain served as the control group. Both the control and experimental groups had three replicates. Using a fluorescence microplate reader, the fluorescence intensity of the XIV-68 mutant strain was higher than that of the LEU mutant strain at different sites, indicating that the XIV-68 site had a higher expression intensity.

[0161] (2) Detection of Gus enzyme activity

[0162] The relative expression levels of LEU and XIV-68 sites were further verified by replacing the YPet reporter protein with the β-glucuronidase gene (GUS). BJ5464 / LEU::P was activated and cultured according to the method described in step (1) above. TDH3-524 -GUS-T FBA1 and BJ5464 / XIV-68::P TDH3-524 -GUS-T FBA1 The mutant strain was kept for 24 hours.

[0163] Cell lysis:

[0164] 1) Centrifuge the cultured bacterial solution at 3000×g for 5 minutes.

[0165] 2) The obtained bacterial cells were washed twice with Tris-HCl buffer (pH 7.5).

[0166] 3) Resuspend in Tris-HCl buffer (pH 7.5) to adjust OD. 600 The concentration was increased to 0.6–0.7, resulting in a suspension of brewer's yeast.

[0167] 4) Take 200 μL of Saccharomyces cerevisiae suspension and add it to a 96-well plate. Add 10 U / mL Zymolyase and incubate at 30℃ and 250 rpm for 6 h with shaking. This is the yeast lysate.

[0168] Enzyme activity detection:

[0169] 1) Add 90 μL of PBS (pH 7.0) buffer to another 96-well plate, and then add 80 μL of substrate 1 g / L pnitrophenyl-β,D-galactopyranoside (pNPG).

[0170] 2) Add 10 μL of yeast lysis broth to the above identification system and react at 37 °C for 10 min.

[0171] 3) Add 20 μL of 1M NaOH to terminate the reaction.

[0172] 4) Measure OD using an enzyme-linked immunosorbent assay (ELISA) reader. 405 value.

[0173] 5) Determine the OD of p-nitrophenol (pNP) at different concentrations (0, 25, 50, 75, 100, 150, 200, 250, 300, 400, 500 μM). 405 Values ​​are used to plot a standard curve.

[0174] 6) Calculate Gus enzyme activity based on the standard curve. That is, under the conditions of pH 7.0 and 37℃, the amount of enzyme required to release 1 μmol of p-nitrophenol from the substrate per hour is 1 activity unit, denoted as U.

[0175] After incubation with 10 U / mL Zymolyase for 6 hours, BJ5464 / LEU::P TDH3-524 -GUS-T FBA1 and BJ5464 / XIV-68::P TDH3-524 -GUS-T FBA1 mutant enzyme activity Figure 2 As shown, the fold change at the site was 16.03-fold, indicating that the expression difference between the two sites was still significant under the same promoter and terminator. Therefore, the XIV-68 site has high expression specificity.

[0176] Example 5: Expression and preparation method of T4N5

[0177] BJ5464 / LEU::P was activated and cultured according to the method described in Example 4. TDH3-524 -T4N5-T FBA1 and BJ5464 / XIV-68::P TDH3-524 -T4N5-T FBA1 The mutant strain was kept for 16 hours, and then at the initial OD. 600 0.05 μL was transferred to a 100 mL Erlenmeyer flask containing 20 mL of YPD culture medium and incubated at 30 °C for 30 h. The bacterial culture was collected, centrifuged at 8000 rpm for 1 min, the supernatant was discarded, and the bacterial cells were collected and stored at -20 °C for later use.

[0178] After thawing, the bacterial cells were incubated on ice for 10 min. The cells were then resuspended in cell lysis buffer (50 mM HEPES pH 7.3, 1% Triton X-100, 10 mM imidazole). A 1.5 mL cell disruption tube was taken, and 1 g of 0.5 mm glass beads were added, followed by 1.5 mL of bacterial suspension. The cells were then lysed using a cell disruptor at a lysis rate of 6 m / s, with a single lysis time of 20 s and a total lysis time of 3 min. An ice incubation period of 2 min was allowed between lysis cycles. After complete lysis was confirmed under a microscope, the cells were centrifuged at 12000 rpm for 5 min to separate the precipitate and supernatant. The supernatant was used for SDS-PAGE analysis.

[0179] like Figure 3 As shown, BJ5464 / XIV-68::P TDH3-524 -T4N5-T FBA1 The mutant strain showed a brighter target band at around 15-20 kDa, indicating that the target protein T4N5 was highly expressed at the XIV-68 site.

[0180] Example 6: Method for improving the lysis efficiency of mutant strain T4N5 and its construction

[0181] The recombinant vector p426-gSED1 from Saccharomyces cerevisiae and donor DNA were constructed using the following method:

[0182] 1. Construction of the recombinant vector p426-gSED1

[0183] Based on the prediction results from the CRISPR-Direct website, the gRNA target sequence of the SED1 gene was determined to be: 5′-AGAGGAGGAAGTGACATCGG-3′;

[0184] Using the p426 vector as a template, and with primer pairs P5 / P17 and P6 / P18 respectively, the SED1-1 and SED1-2 fragments were amplified. The fragments were then analyzed using ClonExpress. R II. Recombinant Cloning Kit: Recombinantly recombinant fragments SED1-1 and SED1-2 to obtain the recombinant vector p426-gSED1 carrying the SED1 guide RNA sequence, wherein the nucleotide sequence of the gSED1 expression cassette is shown in SEQ ID No. 4.

[0185] The specific primer sequences are as follows (underlined sequences indicate bases homologous to the vector sequence):

[0186] P17: 5′-CCGATGTCACTTCCTCCTCT GATCATTTATCTTTCACTGC -3′;

[0187] P18: 5′-AGAGGAGGAAGTGACATCGG GTTTTAGAGCTAGAAATA -3′;

[0188] 2. Synthesize donor DNA that can block SED1 expression.

[0189] The primers are as follows:

[0190] P25: 5′-TACTTTGGCCCAATTTTCCAACAGTACATCTGCTTCTTAAACCGATGTCACTTCCTCCT-3′;

[0191] P26: 5′-TGTGATAGTTACTGAGCCAGAGGAAGTGGAGATGGAAGAGGAGGAAGTGACATCGGTTT-3′; P25 and P26 were used as templates for amplification to obtain donor DNA, the sequence of which is shown in SEQ ID No. 5.

[0192] 3. Validation of SED1 site editing in yeast genome

[0193] The activated BJ5464 / XIV-68::P TDH3-524 -T4N5-T FBA1 Single colonies of the mutant strain were plated on SD / ΔTrp+5-FOA (5-fluoroorotic acid, 1 g / L) plates. Single colonies that grew on the plates were picked and inoculated into SD / ΔTrp liquid medium to prepare competent cells. For specific procedures, please refer to Example 4.

[0194] p426-gSED1 and donor DNA were simultaneously transformed into BJ5464 / XIV-68::P, which had already been transformed into the commercially available plasmid p414. TDH3-524 -T4N5-T FBA1 In competent cells, with the assistance of the Cas9 protein, the gRNA sequence transcribed from the SED1 gene is localized, while donor DNA is recombinated into the editing site to block the normal expression of the SED1 gene, thereby achieving SED1 gene knockout in the genome and obtaining the mutant strain BJ5464 / XIV-68::P TDH3-524 -T4N5-T FBA1 / Δsed1.

[0195] Three Saccharomyces cerevisiae transformants were randomly selected, and colony PCR amplification was performed using SED1-check-F / SED1-check-R primers. The PCR products were then analyzed. Sequencing results showed that the target gene SED1 was mutated in all three transformants, indicating that the SED1 gene was successfully knocked out.

[0196] SED1-check-F: 5′-CCCTCTTTTGAACTGTCATA-3′;

[0197] SED1-check-R: 5′-GTAGTTGGTGGGAAAGCTGA-3′.

[0198] The obtained mutant strains were subjected to protein expression, as detailed in Example 5, and the results are as follows. Figure 4 As shown, the target band is brighter after the SED1 gene is knocked out, indicating that the deletion of the SED1 gene is more conducive to cell lysis, thereby releasing more of the target protein.

[0199] Similarly, following the above method, the mutant strain CEN.PK2-1Ca / XIV-68::P was obtained. TDH3-524 -T4N5-T FBA1 / Δsed1、BY4741 / XIV-68::P TDH3-524 -T4N5-T FBA1 / Δsed1.

[0200] Example 7 Affinity chromatography and desalting of recombinant T4N5

[0201] Following the steps in Example 5, the mutant strain BJ5464 / XIV-68::P was subjected to treatment. TDH3-524 -T4N5-T FBA1 / Δsed1 was cultured and lysed, and 50 mL of the lysate was collected as a sample for subsequent protein purification. T4N5 was purified using a Bio-rad chromatography system; all reagents were degassed before purification.

[0202] The system was flushed with ultrapure water at the maximum flow rate (6.5 mL / min) for 5 min to remove 20% ethanol from the system tubing; the flow rate was reduced to 1 mL / min, and a Hi-Trap™ chelating HP column was connected. The flow rate was then adjusted stepwise to 3 mL / min, and flushing was continued until the conductivity indicator and UV detection baseline stabilized at around 0; 0.5 M sodium hydroxide solution was added to remove residual impurities from the column, and flushing was continued until the baseline stabilized; ultrapure water was added to remove sodium hydroxide solution from the purification system flow path, and the baseline value stabilized; nickel sulfate solution was added until the baseline stabilized, ensuring that nickel ions were fully bound to the chelating column; Buffer A (17 mM disodium hydrogen phosphate dodecahydrate, 3 mM sodium dihydrogen phosphate dihydrate, 500 mM sodium chloride, 20 mM imidazole) was added to remove unchelated nickel ions from the column, and flushing was continued until the baseline stabilized; protein sample was added, and the flow rate was adjusted to 1.5 mL / min. After all the protein sample had entered the purification system, Buffer A was switched to 3 mL / min, and flushing was continued until the UV detection baseline stabilized. The flow-through was collected; the buffer was adjusted... A gradient elution was performed using a mixture of B (17 mM disodium hydrogen phosphate dodecahydrate, 3 mM sodium dihydrogen phosphate dihydrate, 500 mM sodium chloride, 500 mM imidazole) and the elution was collected. The column was then rinsed with ultrapure water, stripping buffer (17 mM disodium hydrogen phosphate dodecahydrate, 3 mM sodium dihydrogen phosphate dihydrate, 500 mM sodium chloride, 55 mM disodium ethylenediaminetetraacetate), and 0.5 M sodium hydroxide solution to remove nickel ions and impurities. After rinsing with 20% ethanol for 10 column volumes, the column was discharged and the chromatography system was shut off. A portion of the collected protein sample was used to prepare SDS-PAGE samples using the aforementioned method, and SDS-PAGE verification was performed. The collected protein sample was placed in a 3 kDa ultrafiltration centrifuge tube and centrifuged at 4°C, 8000 rpm, and 30 min for desalting and concentration, with 10 mL of PBS solution added three times during centrifugation. The desalted T4N5 solution in the ultrafiltration tube was collected, flash-frozen in liquid nitrogen, and stored at -80°C. The purification results are as follows. Figure 5 As shown, the results indicate that T4N5 protein with high purity was successfully obtained through nickel column affinity chromatography and desalting.

[0203] Example 8: Assay of Recombinant T4N5 in Vitro DNA Repair Activity

[0204] The in vitro activity of T4N5 was verified using the DNA nicking method. 20 μL of plasmid YEp181 at a concentration of 500 ng / μL was placed in an atmosphere with an intensity of 21 μW / cm². 2The T4N5 protein sample obtained in Example 7 was irradiated under a 254 nm UV lamp for 30 min to form pyrimidine dimers. The sample was diluted 5-fold, 10-fold, 20-fold, and 100-fold, and 1 μL of each solution was added to 1x T4N5 Reaction Buffer (25 mM sodium phosphate, 100 mM sodium chloride, 1 mM EDTA, 1 mM dithiothreitol, 100 μg / mL bovine serum albumin) to prepare a 20 μL system. The reaction was carried out at 37 °C for 30 min. 1 μL of the solution was subjected to agarose gel electrophoresis, and the grayscale scan was performed using ImageJ to detect the repair effect of recombinant T4 endonuclease V. The repair effect results are as follows: Figure 6 As shown, the purified T4N5 sample exhibits good DNA repair efficiency.

[0205] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. The application of gRNA targeting the XIV-68 site on Saccharomyces cerevisiae chromosome in the high expression of exogenous metabolites in Saccharomyces cerevisiae chassis cells, characterized by: The gRNA target sequence at the XIV-68 site is 5′-AAAGAATCATAGATCGTCAA-3′.

2. A high-yield T4N5 engineered Saccharomyces cerevisiae strain, characterized in that: Using Saccharomyces cerevisiae as the starting strain, the T4N5 gene was integrated into the Saccharomyces cerevisiae chromosome XIV-68 site as described in claim 1, thereby obtaining an engineered Saccharomyces cerevisiae strain that integrates the T4N5 gene and produces high levels of T4N5. or, Using Saccharomyces cerevisiae as the starting strain, the T4N5 gene was integrated into the Saccharomyces cerevisiae chromosome XIV-68 site as described in claim 1, and the SED1 gene in the Saccharomyces cerevisiae genome was knocked out, to obtain an engineered Saccharomyces cerevisiae strain that integrates the T4N5 gene and knocks out the SED1 gene, producing high T4N5. Among them, T4N5 refers to T4 endonuclease V; The gRNA target sequence involved in the integration is 5′-AAAGAATCATAGATCGTCAA-3′.

3. The engineered brewer's yeast according to claim 2, characterized in that: The amino acid sequence encoded by the T4N5 gene is shown in NP_049733.1; Alternatively, a histidine tag and / or a protease cleavage site may be added to the amino terminus of the amino acid sequence encoded by the T4N5 gene.

4. The engineered brewer's yeast strain according to claim 3, characterized in that: The nucleotide sequence of the T4N5 gene is shown in SEQ ID No. 1, from 37 to 450 bp. The nucleotide sequence of the T4N5 gene, with histidine tags and protease cleavage sites sequentially added to the 5′ end, is shown in SEQ ID No.

1.

5. The engineered brewer's yeast strain according to claim 2, characterized in that: The expression cassette of the T4N5 gene was integrated into the XIV-68 site of the Saccharomyces cerevisiae chromosome; The expression cassette of the T4N5 gene comprises a promoter, a T4N5 gene, a terminator; the promoter is selected from one of P CCW12 , P TDH3 , P PDC1 , and P TEF1 ; the terminator is selected from one of T RPL3 , T PGK1 , T BNA4 , and T FBA1 .

6. A method for constructing a high-T4N5-producing engineered Saccharomyces cerevisiae strain according to any one of claims 2 to 5, characterized in that: The steps include the following: 1) Design gRNA target sequences based on the XIV-68 site on the Saccharomyces cerevisiae chromosome; 2) Construct a recombinant vector based on the gRNA target sequence from step 1); 3) Prepare donor DNA containing the T4N5 gene; 4) Simultaneously transform the recombinant vector from step 2) and the donor DNA containing the T4N5 gene from step 3) into the Saccharomyces cerevisiae that has been transformed with the Cas9 gene to achieve the integration of the T4N5 gene and obtain an engineered Saccharomyces cerevisiae strain that integrates the T4N5 gene and produces high-T4N5. Or, it may also include: 5) Knock out the SED1 gene in the genome of the engineered Saccharomyces cerevisiae from step 4) to achieve the integration of the T4N5 gene and the knockout of the SED1 gene, thereby obtaining a high-yielding engineered Saccharomyces cerevisiae that integrates the T4N5 gene and knocks out the SED1 gene.

7. The construction method according to claim 6, characterized in that: The gRNA target sequence in step 1) is 5′-AAAGAATCATAGATCGTCAA-3′; In step 2), the starting vector used to construct the recombinant vector is any kind of Saccharomyces cerevisiae vector; The donor DNA containing the T4N5 gene in step 3) includes a 40-100 bp homologous sequence upstream of the gRNA target sequence, the T4N5 gene or the T4N5 gene expression cassette, and a 40-100 bp homologous sequence downstream of the gRNA target sequence.

8. The construction method according to claim 6 or 7, characterized in that: In step 5), the SED1 gene is knocked out of the Saccharomyces cerevisiae genome from step 4), including the following steps: a) Design gRNA target sequences based on the SED1 gene in the genome; b) Construct a recombinant vector based on the gRNA target sequence from step a); c) Simultaneously transform the recombinant vector and donor DNA from step b) into the Saccharomyces cerevisiae engineered strain from step 4) which has been transformed with the Cas9 gene, to achieve the integration of the T4N5 gene and the knockout of the SED1 gene.

9. The construction method according to claim 8, characterized in that: The gRNA target sequence in step a) is 5′-AGAGGAGGAAGTGACATCGG-3′; In step b), the starting vector used to construct the recombinant vector is any kind of brewer's yeast vector.

10. The application of the engineered Saccharomyces cerevisiae according to any one of claims 2 to 5 in high-yield T4N5.

Images