Cloning and application of cauliflower stem height regulation gene caush6.1

Abstract

This invention relates to the field of plant molecular breeding technology, specifically providing the cloning and application of the cauliflower main stem height regulating gene CauSH6.1. Specifically, through genome-wide association analysis and QTL mapping, this invention located a QTL controlling main stem height on cauliflower chromosome 6. By functionally annotating the genes within the mapped region, the gene regulating cauliflower main stem height was screened and named CauSH6.1. This invention further verified that knocking out the candidate gene CauSH6.1 significantly reduces cauliflower main stem height, while overexpression of the CauSH6.1 gene significantly increases cauliflower main stem height, confirming that the CauSH6.1 gene can regulate cauliflower main stem height. This invention provides molecular tools and gene resources for studying the regulatory mechanism of cauliflower main stem height and for cultivating cauliflower varieties with superior plant architecture.

Description

Technical Field

[0001] This invention relates to the field of plant molecular breeding technology, specifically providing the cloning and application of the cauliflower main stem height regulating gene CauSH6.1. Background Technology

[0002] Cauliflower (Brassica oleracea L. var. botrytis), also known as broccoli, is a variety of cauliflower belonging to the Brassicaceae family. Cauliflower is delicious, nutritious, and possesses anti-cancer and cancer-preventive health benefits, making it popular among consumers. my country is the world's largest producer and consumer of cauliflower. In recent years, the planting area and yield of cauliflower have increased year by year, giving it a unique and important position in my country's vegetable industry.

[0003] The stem height (SH) of cauliflower is often referred to as the "tall" or "short" trait in production, and it is a very important biological and agronomic trait of cauliflower. Obtaining cauliflower suitable for mechanized harvesting is an inevitable trend in modern agriculture. However, excessively tall stems increase the likelihood of lodging and affect the uniformity of the cauliflower in the field, while excessively short stems increase the difficulty of mechanized harvesting. Therefore, appropriate stem height and plant structure are prerequisites for mechanized harvesting of cauliflower.

[0004] Meanwhile, the height of the main stem of cauliflower is significantly positively correlated with traits such as head size, head weight, and total plant weight. Appropriately increasing the height of the main stem of cauliflower will increase the overall biomass and head yield. In addition, appropriately increasing the height of the main stem also helps keep the head away from pathogenic microorganisms in the soil, which plays a positive role in the healthy development and quality assurance of the head.

[0005] Currently, there are few research reports and invention patents related to genes regulating the main stem height of cauliflower, and no reports of related gene cloning have been found. Only some markers linked to cauliflower have been developed (Molecular markers linked to the dwarf stem gene in loose-leaved cauliflower and their application: CN202310444233.X). Therefore, identifying and cloning genes regulating the main stem height of cauliflower is of great significance for the genetic improvement of key traits such as mechanized harvesting, yield, and quality in cauliflower. Summary of the Invention

[0006] To address the shortcomings of existing technologies, this invention provides a gene, CauSH6.1, that regulates the height of the main stem of cauliflower. Through gene knockout and overexpression experiments, this invention has demonstrated that the CauSH6.1 gene can positively or negatively regulate the height of the main stem, providing an important gene resource for improving the plant type of cauliflower.

[0007] Based on this, in a first aspect, the present invention provides a cauliflower main stem height regulating gene CauSH6.1, the nucleotide sequence of which is shown in SEQ ID No. 1.

[0008] The amino acid sequence of CauSH6.1, the gene for regulating the main stem height of cauliflower provided by this invention, is shown in SEQ ID No. 2.

[0009] The present invention provides that increasing the expression level of the cauliflower main stem height gene CauSH6.1 increases the cauliflower main stem height, while decreasing the expression level of the gene CauSH6.1 decreases the cauliflower main stem height.

[0010] Specifically, the present invention provides the application of a gene with a nucleotide sequence as shown in SEQ ID No. 1 in regulating the height of the main stem of cauliflower. When the expression level of the gene increases, the height of the main stem of cauliflower increases; when the expression level of the gene decreases, the height of the main stem of cauliflower decreases; the amino acid sequence of the gene is shown in SEQ ID No. 2.

[0011] Secondly, this invention provides the application of the above-mentioned cauliflower main stem height regulating gene CauSH6.1 in the cultivation of cauliflower germplasm with superior plant type.

[0012] Furthermore, the application of the aforementioned cauliflower stem height regulating gene CauSH6.1 in mechanized cauliflower harvesting.

[0013] In the application provided by this invention, increasing the expression level of the CauSH6.1 gene in cauliflower increases the height of the main stem; or inhibiting the expression level of the CauSH6.1 gene in cauliflower decreases the height of the main stem.

[0014] Thirdly, this invention provides a CRISPR / Cas9 gene editing vector for reducing the height of the main stem of cauliflower. The CRISPR / Cas9 gene editing vector is constructed targeting the aforementioned cauliflower main stem height regulating gene CauSH6.1. The target sites of the CRISPR / Cas9 gene editing vector include: CATCTTGATCTATTGAGGCTAGG; AACTATGCTGTTGAGTACCGTGG; GAAGAATCCTAACTCAGCT and GAATGCCCCATTTGC TTCC.

[0015] Fourthly, the present invention provides a method for reducing the height of the main stem of cauliflower by transforming cauliflower lines with the aforementioned CRISPR / Cas9 gene editing vector, thereby weakening or eliminating the function of the CauSH6.1 gene in the recipient cauliflower lines.

[0016] Fifthly, the present invention provides a method for increasing the height of the main stem of cauliflower by transforming cauliflower lines with a CauSH6.1 gene overexpression recombinant vector, thereby increasing the expression level of the CauSH6.1 gene in the recipient cauliflower lines.

[0017] The beneficial effects of this invention are as follows:

[0018] (1) This invention uses genome-wide association analysis and QTL mapping to screen a gene CauSH6.1 that controls the height of the main stem of cauliflower. By amplifying the "tall" parent, the full-length CDS sequence of the CauSH6.1 gene was obtained. This gene can regulate the height of the main stem of cauliflower and provide an important gene resource for the improvement of cauliflower plant type.

[0019] (2) This invention constructed gene knockout and overexpression vectors for the functional gene CauSH6.1, and successfully obtained gene knockout and overexpression lines. Phenotypic analysis revealed that the main stem height of the gene knockout lines was significantly lower than that of the control, while the main stem height of the overexpression lines was significantly higher than that of the control. Therefore, the CauSH6.1 gene can be used for plant type improvement breeding of cauliflower. Attached Figure Description

[0020] To more clearly illustrate the technical solutions in this invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0021] Figure 1 This is the GWAS and QTL mapping diagram of cauliflower according to the present invention.

[0022] Figure 2 This is a variation diagram of the CauSH6.1 gene between the genes within the localization interval of this invention and the parents.

[0023] Figure 3 This is a structural diagram of the CauSH6.1 gene editing vector of the present invention.

[0024] Figure 4 This is a structural diagram of the overexpression vector of CauSH6.1 of the present invention.

[0025] Figure 5 The image shows the phenotype of the gene-edited strains of this invention.

[0026] Figure 6 Electrophoresis diagram for identifying the overexpression lines of this invention.

[0027] Figure 7 The images show the phenotypic characteristics of the overexpression strains of this invention. Detailed Implementation

[0028] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.

[0029] Example 1: Localization of genes regulating the main stem height of cauliflower

[0030] 1) Investigation on the height trait of cauliflower main stem

[0031] This invention collected 820 cauliflower germplasm resources and planted them in an experimental field in Wuqing District, Tianjin, with a row spacing of 0.8 meters and a plant spacing of 0.6 meters. The main stem height of the cauliflower was investigated for two consecutive years, 2019 and 2020, at the head maturity stage. Five plants from each variety were measured from the above-ground part to the base of the head, and the average value was taken.

[0032] 2) Location of sites regulating the height of the main stem of cauliflower

[0033] Resequencing was performed on 820 cauliflower lines. Through data alignment and variant detection, 17,917,317 SNPs were obtained for subsequent genome-wide association studies (GWAS). GWAS analysis was conducted based on phenotypic data from 2019 and 2020. The results showed a high degree of consistency between the 2019 and 2020 results, locating the stem height regulating gene to the end of chromosome 6. Figure 1 A, Figure 1 (B).

[0034] Based on phenotypic data, the extremely tall parent "PN-341" and the dwarf parent "PN-501" were selected to construct an F2 genetic segregating population. 305 F2 plants were randomly planted, and the main stem height trait was investigated. Thirty plants from each parent (tall and dwarf) were selected for BSA-seq pooled sequencing. Analysis of SNP-index and G′ in the parents and the extreme pooled sequencing revealed a significant signal in the region overlapping with the GWAS results. Figure 1 (C).

[0035] Furthermore, analysis using the deep learning software Deep-BSA also located the terminal region of chromosome 6. Figure 1 (D). By combining different mapping methods, the main stem height regulatory site was located in a region of approximately 72 kb (chr6: 47.88–47.95 Mb), which contains 12 coding genes.

[0036] Example 2: Screening and Cloning of Candidate Genes

[0037] 1) Annotation of candidate genes and screening of genes regulating main stem height

[0038] Based on the localization results of GWAS and QTL-seq, this invention analyzed and annotated SNP and InDel variants in the target region. This region contains 12 protein-coding genes, of which 10 have variants in their exons. Figure 2 ).

[0039] This invention performed functional annotation and variant analysis on these genes, and found that one gene encoding zinc finger ring protein (BOB06G135460) has a missense mutation and a 3bp deletion at exon 6, which cause an amino acid change and deletion, respectively. Figure 2 Based on this, the present invention initially hypothesizes that BOB06G135460 may be a candidate gene, named CauSH6.1 gene.

[0040] 2) Cloning of the CauSH6.1 gene CDS

[0041] Fresh, young leaves of the tall parent 'PN-341' were collected, frozen in liquid nitrogen in a mortar, and ground into powder. RNA was extracted using the standard operating procedure of the Tiangen reagent kit and stored at -80°C for later use. The RNA sample was used to synthesize the first strand of cDNA using the TaKaRa reverse transcription kit, employing a pair of primers with adapters. The primer sequences are as follows:

[0042] D3946_0S1(+): AACACGGGGGACTTTGCAACatgggtaataagctggtggggagg (SEQ ID No. 3); D3946_0S1(-): TGAGACAGAGCTAGTTACAttattgccaagtaacttcagttggtgcgc (SEQ ID No. 4). The target CDS was amplified using the following amplification system: Nuclease-free Water 20 μL, Biorun Pfu PCRMix 25 μL, Primer(+) 2 μL, Primer(-) 2 μL, and template DNA 1 μL. The PCR products were analyzed by Sanger sequencing, yielding the CDS nucleotide sequence of the CauSH6.1 gene as shown in SEQ ID No. 1, and the amino acid sequence of the encoded protein as shown in SEQ ID No. 2.

[0043] Example 3: Construction of CauSH6.1 gene editing vector

[0044] This embodiment provides the construction process of the CauSH6.1 gene editing vector. The structure of the gene editing vector is as follows: Figure 3 As shown, the specific construction process is as follows: Four target sites are selected in the gene CDS region using the online software CRISPR-P 2.0 (http: / / crispr.hzau.edu.cn / CRISPR2 / ).

[0045] The information for the four targets is as follows: CATCTTGATCTATTGAGGCTAGG (SEQ ID No. 5); AACTATGCTGTTGAGTACCGTGG (SEQ ID No. 6); GAAGAATCCTAACTCAGCT (SEQ ID No. 7); GAATGCCCCATTTGCTTCC (SEQ ID No. 8).

[0046] The t1-t4 sequence backbone units, comprising gRNA1-gRNA backbone-tRNA-gRNA2-gRNA backbone-tRNA-gRNA3-gRNA backbone-tRNA-gRNA4, were synthesized using a total synthesis method. After sequence verification, they were ligated into a CRISPR / Cas9 vector via a double enzyme digestion system. The enzyme digestion and ligation system and reaction conditions were as follows: 8 μL Nuclease-free Water, 2 μL 10× Buffer, 1 μL BsaI / Eco31I, 1 μL T4_ligase, 4 μL pBSbdcas9i-tRNA(k6), and 4 μL rDNAt1. The enzyme digestion and ligation system and reaction conditions were as follows: 37℃, 20 min, 1 cycle; 37℃, 10 min, 5 cycles; 20℃, 10 min, 5 cycles; 37℃, 20 min, 1 cycle; 80℃, 5 min, 1 cycle.

[0047] Transform 5-10 μL of the ligation product into GV3101 Agrobacterium competent cells. Transform into kanamycin-resistant agar plates and incubate at 37°C for 12 hours for plaque PCR identification. Pick 10 plaques and simultaneously inoculate and PCR identify them in 1.5 mL EP tubes. The primers for pBSbdcas9i-tRNA(k6) identification are: Pbw2+:GCAACGCTCTGTCATCGTTACA AT (SEQ ID No. 9); Pbw2-:gcgattaagttgggtaacgccaggg (SEQ ID No. 10).

[0048] Example 4: Construction of CauSH6.1 overexpression vector

[0049] This embodiment provides the construction process of the CauSH6.1 overexpression vector: the overexpression vector uses a 35s strong promoter, the specific structure of which can be found in [link to documentation]. Figure 4First, the vector pBWA(V)HS was digested using BsaI and Eco31I restriction sites. The digestion reaction system consisted of 13 μL of enzyme-free water, 2 μL of 10× buffer, 1 μL of BsaI / Eco31I, and 4 μL of pBWA(V)HS-ccdB. The reaction conditions were 37°C for 1 hour.

[0050] The vector digests were purified using a PCR purification kit (the purified product was labeled pBWA(V)HS-ccdB(D)) for the next in vitro recombination reaction. The recombination system consisted of: 10 μL Biorun 2*EasyClone Mix, 5 μL rDNAG1, and 5 μL pBWA(V)HS-ccdB(D). The reaction conditions were 37°C for 0.5 hours.

[0051] The ligation product was then transformed into GV3101 Agrobacterium competent cells. The cells were transformed into kanamycin-resistant plates and incubated at 37°C for 12 hours. Plaque PCR identification was then performed using the following primers: HS-35seq:TTCATTTGGAGAGAACACGGGGGAC (SEQ ID No. 11), D3946(598C):CTCATCATCCCTGTTTCCTTG (SEQ ID No. 12).

[0052] Example 5 Genetic transformation of cauliflower

[0053] This invention provides a genetic transformation process for cauliflower, with the following specific steps:

[0054] 1) Seed cleaning and germination: Disinfect with 75% ethanol for 30-60 seconds, rinse once with sterile water (1 min / time); disinfect with 0.15% mercuric chloride for 10 min, rinse twice with sterile water (1 min / time); rinse with sterile water for 30 min, inoculate onto sterile filter paper and air dry. Inoculate seeds into germination culture flasks and incubate in the dark at 23℃ for 5-6 days;

[0055] 2) Pre-culture: Cut the hypocotyls of the cauliflower seedlings that germinated in step 1) into 0.4-0.6cm segments, inoculate them into pre-culture medium, and culture at 23℃ under light for 2-3 days;

[0056] 3) Agrobacterium infection and co-culture: Agrobacterium was picked and placed in the infection solution to prepare an Agrobacterium resuspension with OD600 = 0.2. The explants were inoculated into the Agrobacterium suspension for 10 min. The infected explants were then inoculated onto sterile filter paper and air-dried, and then inoculated onto co-culture medium and incubated in the dark at 23℃ for 48-72 h.

[0057] 4) Destermination (delayed screening): The co-cultured explants were inoculated onto a destermination medium and cultured at 23°C under light for 6 days;

[0058] 5) Screening / differentiation: The sterilized explants were inoculated onto the screening / differentiation medium, with 30 explants per plate, and cultured at 23°C under light. The plates were changed every 15 days.

[0059] 6) Rooting culture: Inoculate the buds differentiated in step 5) into rooting medium and culture at 23°C under light until roots are formed;

[0060] 7) Detection: Genomic DNA from cauliflower was extracted using the CTAB method and then detected by PCR.

[0061] Example 6: Identification and phenotypic analysis of CauSH6.1 gene knockout lines and CauSH6.1 gene overexpression lines.

[0062] CauSH6.1 gene knockout line identification and phenotypic analysis. Primers used for knockout line identification: 59647-f:AAGAAAGGTACACAAAGCCA (SEQ ID No. 13); 59647-676r:AGCGTTTCTTGAAACATTGG (SEQ ID No. 14).

[0063] After PCR amplification of the target region, Sanger sequencing was performed to identify mutations at the editing site. Sequence analysis of the CauSH6.1 gene-edited lines identified three gene knockout lines. Their genotypes and phenotypic results are detailed below. Figure 5 Through phenotypic investigation, it was found that the knockout vector line (2.35-2.45cm) was significantly shorter than the wild type (5.52cm).

[0064] Using 35S promoter primers, CauSH6.1 overexpression lines were detected, and two positive seedlings were identified. Figure 6 Phenotypic identification of CauSH6.1 overexpression lines revealed that the main stem height of both overexpression lines was significantly increased compared to the wild type. Figure 7 ).

[0065] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. The application of the CauSH6.1 gene in the breeding of superior cauliflower germplasm, characterized by, The nucleotide sequence of the CauSH6.1 gene is shown in SEQ ID No. 1; The purpose of cultivating superior cauliflower germplasm is to increase or decrease the height of the main stem of cauliflower.

2. The application according to claim 1, characterized in that, Increasing the expression level of the CauSH6.1 gene in cauliflower can increase the height of the main stem; or inhibiting the expression level of the CauSH6.1 gene in cauliflower can decrease the height of the main stem.

3. A CRISPR / Cas9 gene editing vector for reducing the height of the main stem of cauliflower, characterized in that, A CRISPR / Cas9 gene editing vector was constructed targeting the CauSH6.1 gene, and the nucleotide sequence of the CauSH6.1 gene is shown in SEQ ID No. 1; The targets of the CRISPR / Cas9 gene editing vector include: CATCTTGATCTATTGAGGCTAGG, AACTATGCTGTTGAGTACCGTGG, GAAGAATCCTAACTCAGCT, and GAATGCCCCATTTGCTTCC.

4. A method for reducing the height of the main stem of cauliflower, characterized in that, Transforming cauliflower lines with the CRISPR / Cas9 gene editing vector described in claim 3 resulted in a reduction or loss of the CauSH6.1 gene function in the recipient cauliflower lines.

5. A method for increasing the height of the main stem of cauliflower, characterized in that, Cauliflower lines were transformed using a recombinant vector that overexpressed the CauSH6.1 gene, resulting in increased expression of the CauSH6.1 gene in the recipient cauliflower lines; the nucleotide sequence of the CauSH6.1 gene is shown in SEQ ID No. 1.

Images