Chicken salmonella pullorum oxyr deletion strain stably expressing variant o antigen and construction method and application thereof

Abstract

This invention discloses a strain of Salmonella pullorum stably expressing variant O antigen, its construction method, and its application. oxyR Gene knockout, obtained oxyR The gene-deleted strain stably expressed the variant O antigen. Agglutination assays showed that this strain exhibited typical agglutination reactions with the variant O122 serum of Salmonella pullorum disease, but not with the standard O123 serum. Furthermore, the strain showed good stability of the variant O antigen after multiple passages. Therefore, Salmonella pullorum disease... oxyR Gene-deleted strains can be used to prepare variant agglutination antigen components for the diagnostic agglutination antigen of chicken pullorum disease.

Description

Technical Field

[0001] This invention belongs to the field of avian salmonellosis prevention and control technology, specifically relating to a strain of Salmonella pullorum that stably expresses the variant O antigen, its construction method, and its application. Background Technology

[0002] Pullorum disease, caused by Salmonella pullorum, is a serious threat to the global poultry industry. It can spread both horizontally and vertically, with vertical transmission being the primary route. Cure breeding stock of pullorum and cull positive cases to interrupt the vertical transmission route are crucial for controlling the disease. Cure relies on efficient detection technologies and reagents; therefore, developing efficient, stable, and highly specific detection reagents is essential for pullorum eradication.

[0003] The primary method for detecting pullorum disease in chickens is through whole blood or serum agglutination tests using pullorum antigens. Due to differences in the O12 antigen of Salmonella pullorum, two serotypes exist: a standard type and a variant. The standard type of Salmonella pullorum contains O121 and O123 O12 antigens, while the variant type contains O121 and O122 O12 antigens. These different O antigens result in differences in the serum's recognition ability. Therefore, pullorum antigens are typically prepared by combining the standard type and variant strains of Salmonella pullorum.

[0004] However, studies have found that variant strains of Salmonella pullorum are unstable, differentiating into a certain number of standard strain subgroups after culture. Furthermore, the conversion between the standard and variant O antigens is easily affected by culture conditions, leading to insufficient stability of the agglutination antigens prepared from this strain and impacting detection accuracy. Based on the discovery that the oxyR gene regulates the formation of O122 or O123 antigens in Salmonella pullorum, this invention utilizes genetic engineering technology to construct a variant strain of Salmonella pullorum with stable O antigens, which is then used to prepare the variant O antigen component in Salmonella pullorum agglutination antigens. Summary of the Invention

[0005] The purpose of this invention is to provide a strain of Salmonella pullorum stably expressing variant O antigen and its construction method, for the preparation of Salmonella pullorum variant agglutination antigen. The principle is to use gene knockout technology to knock out the regulatory gene oxyR, which negatively regulates the key enzyme in the synthesis of variant O123 antigen in Salmonella pullorum, thus obtaining a Salmonella strain that stably expresses variant O antigen. Therefore, the agglutination antigen prepared from this strain also maintains the stability of the variant O antigen.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] A strain that stably expresses the variant O antigen of Salmonella pullorum, wherein the strain is formed by knocking out the oxyR gene in Salmonella pullorum, and the nucleotide sequence of the oxyR gene is shown in SEQ ID NO.1.

[0008] Preferably, the oxyR gene is knocked out by homologous recombination, and the method includes the following steps:

[0009] (1) Prepare the oxyR gene targeting fragment, the sequence of which is shown in SEQ ID NO.2;

[0010] (2) Plasmid pKD46 was transferred into Salmonella pullorum, and recombinant recipient bacteria were obtained by ampicillin resistance screening;

[0011] (3) The oxyR gene targeting fragment was transferred into the recombinant recipient bacteria, and positive homologous recombinant bacteria were obtained by chloramphenicol resistance screening. Then, the pCP20 plasmid was transferred to remove the chloramphenicol resistance gene to obtain the oxyR gene knockout strain.

[0012] Stability analysis of O antigen of Salmonella pullorum knockout strain oxyR: The oxyR gene knockout strain △oxyR reacted with O122 serum but not with O123 serum, indicating that △oxyR was transformed into a variant strain. After 40 generations of continuous passage of the △oxyR strain, single colonies were selected and reacted with standard serum O123 and variant serum O122, respectively. The results showed that all 100 single colony subclones of the △oxyR strain reacted only with variant serum O122, exhibiting good stability of the variant O antigen.

[0013] Application of Salmonella pullorum lacking the oxyR gene in the preparation of variant agglutination antigens for pullorum: Cultured Salmonella pullorum ΔoxyR was inactivated with formalin and stained with crystal violet to obtain stable variant agglutination antigens. Plate agglutination tests showed that the variant agglutination antigens prepared with ΔoxyR had good agglutination effects on chicken serum infected with variant strains of Salmonella pullorum.

[0014] Compared with the prior art, the present invention has the following beneficial effects:

[0015] Current methods for preparing pullorum antigens for chickens involve combining standard and variant strains of *Salmonella pullorum* in a fixed ratio. However, the strains used to prepare these antigens are unstable. Due to variations in passage and culture conditions, variant strains can express the standard O antigen, leading to changes in the antigenic components of the prepared pullorum antigen and insufficient stability, thus affecting detection accuracy. This invention, based on the initial identification of the glycosyltransferase expression that regulates O antigen expression (oxyR), utilizes genetic engineering to knock out the oxyR gene. This prevents the conversion of the variant O antigen to the standard O antigen during culture due to changes in O antigen synthase expression levels, resulting in a stable *Salmonella pullorum* strain that produces the variant O antigen. Therefore, the pullorum antigen prepared from this strain has a stable variant O antigen component, effectively improving the stability of the agglutination antigen detection reagent. Attached Figure Description

[0016] Figure 1 Electrophoresis diagram of the amplification products of the upstream and downstream homologous arms of the oxyR gene in the chloramphenicol resistance band, where M is the DL 2000 DNA Marker.

[0017] Figure 2 Electrophoresis diagram of the chloramphenicol resistance gene replacing the oxyR gene, where M is the DL 5000 DNA Marker, and the other lanes represent the amplification of the chloramphenicol resistance gene.

[0018] Figure 3 : Identification diagram of the outer primers for the C79-3 / ΔoxyR strain with the oxyR gene deletion. M: DL5000 Marker; 1: C79-3 wild-type strain; 2: negative control; 3: C79-3 / ΔoxyR.

[0019] Figure 4 Reaction diagrams of the oxyR gene deletion strain C79-3 / ΔoxyR with serums O123 and O122. O123 is the standard single-factor serum, and O122 is the variant single-factor serum; 1 represents strain C79-3 (standard strain), and 2 represents strain C79-3 / ΔoxyR (variant strain). Detailed Implementation

[0020] Example 1: Construction of a Salmonella pullorum strain with the oxyR gene deleted.

[0021] 1. Preparation of oxyR target fragment

[0022] Using the λ-Red homologous recombination method, primers oxyR-F (5′- ) were designed based on the gene sequence of the oxyR gene in Salmonella pullorum (accession number: CP003047.1) published in GenBank, targeting the homologous arm fragment. AGAAAGGTTGAT AGGGATAATCGTTCGTTGCTATGCTACCTATCGCCATGAACTATCGTGGCGACGGAGGATGAATA TGTGTAGGCTGGAGCTGCTTCG-3′,oxyR-R:5′- ACCATCGAATACTTCGTTAACACCACCTTTAACTACCCACCATGCGGGAA GCTTATCGGGTTGCGGCGTTGAACGGC The primers for the target fragment amplification consist of two parts: the 5′ streaked sequence is homologous to the flanking sequences of the oxyR gene, and the 3′ sequence is complementary to the sequences flanking the chloramphenicol resistance gene cat on plasmid pKD3. Using plasmid pKD3 as a template, the target fragment was obtained by PCR amplification. The specific amplification system was 50 μL, including 25 μL Primers TAR Mix, 2 μL upstream primer, 2 μL downstream primer, 19 μL ddH2O, and 2 μL template. The PCR products were identified by 1% agarose gel electrophoresis, and the results are as follows. Figure 1 As shown, a specific DNA band of approximately 1170 bp was obtained, with the sequence shown in SEQ ID NO.2. The PCR product was recovered by gel extraction using a DNA gel extraction kit. The recovered product was then digested with Dpn I enzyme and recovered again to remove the plasmid template.

[0023] 2. Preparation of recombinase acceptor strains

[0024] Single colonies of the parental strain of Salmonella pullorum (C79-3, standard type) were inoculated into 4 mL of LB broth and incubated overnight at 37°C and 220 rpm. The next day, the colonies were transferred to 40 mL of fresh LB broth at a 1:100 volume ratio and incubated at 37°C and 220 rpm until OD500 was reached. 600 At approximately 0.5 logarithmic growth phase, the cells were cooled on ice for 30 min, centrifuged at 5000×g for 10 min, the supernatant was discarded, and the cells were resuspended and washed with pre-chilled 10% sterile glycerol, repeated three times. The cells were then resuspended in 500 μL of pre-chilled 10% glycerol and aliquoted into 100 μL tubes. 10 ng of extracted plasmid pKD46 was added to the prepared competent cells, and after incubation on ice for 20 min, the cells were transferred to a pre-chilled 0.1 mm electroporation cuvette and electroporated at 1800 V, 200 Ω. Immediately after electroporation, 800 μL of pre-chilled LB globulin was added, and the cells were shaken at 30℃, 200 rpm for 1 h to rejuvenate. The cells were then plated on ampicillin-resistant (50 μg / ml) LA plates and incubated overnight. Positive colonies were identified using pKD46 universal primers. Single colonies that were correctly identified were picked and shaken at 30℃, 200 rpm, until OD500 was reached. 600 At approximately 0.4 hours, 20 mM L-arabinose was added to induce 1 h of expression, allowing the recombinase in plasmid pKD46 to be fully expressed. Then, competent cells were prepared again using the method described above.

[0025] 3. Screening and identification of oxyR gene deletion strains

[0026] 200 ng of the amplified oxyR targeting fragment was added to freshly prepared competent Salmonella pullorum strain C79-3 containing plasmid pKD46. After incubation on ice for 20 min, electroporation transformation was performed under the above conditions. The cells were then plated on chloramphenicol-resistant (40 μg / ml) LB agar plates and incubated at 37°C. After colonies emerged, they were identified using the outer primers of the oxyR gene: O-oxyR-F: 5′-GCGGTGTCTTCAAGGGTT-3′ and O-oxyR-R: 5′-ATGGAGCAGAAAGGTGGC-3′. The results are as follows: Figure 2 As shown, the recombinant (ΔoxyR / cm) amplified a band of approximately 1251 bp. Correctly identified recombinants were used to prepare electrocompetent cells using the method described above. The specific recombinase plasmid pCP20 encoding the FLP site was introduced and plated on double-antibiotic LB agar plates containing ampicillin (50 μg / ml) and chloramphenicol (40 μg / ml). Positive transformants were screened at 30°C. The obtained positive transformants were then transferred to LB liquid medium without any antibiotics and cultured at 30°C for 6 h, followed by incubation at 42°C for 8 h, and then streaked onto LB plates and incubated at 37°C. The resulting single colonies were tested for ampicillin resistance. Single colonies sensitive to ampicillin were selected and identified using the outer primers O-oxyR-F / O-oxyR-R. The results are shown below. Figure 3 As shown, the oxyR gene deletion strain amplified a band of approximately 321 bp, successfully constructing the Salmonella pullorum oxyR gene deletion strain C79-3 / △oxyR.

[0027] 4. Serological analysis

[0028] Parental strains C79-3 and C79-3 / △oxyR were streaked onto Martin agar plates and incubated overnight. Single colonies were then picked and added to an appropriate amount of physiological saline, and the bacterial concentration was adjusted to 1.0 × 10⁻⁶. 10 CFU / ml. Take a clean glass slide, and use a pipette to drop 25 μl of Salmonella O122 serum and O123 serum (purchased from the China Institute of Veterinary Drug Control) onto the slide. Then, pipette 25 μl of bacterial suspension into each of the O122 and O123 serums, and gently shake the slide to mix thoroughly. Determine the results after 2 minutes. Figure 4 As shown, C79-3 reacted with O123 serum but not with O122 serum, indicating it is the standard strain. C79-3 / △oxyR reacted with O122 serum but not with O123 serum, suggesting that C79-3 / △oxyR has transformed into a variant strain.

[0029] Example 2: Antigen stability analysis of C79-3 / △oxyR

[0030] After 40 consecutive passages of the parental strains C79-3 (standard strain), CVCC530 (variant strain), and C79-3 / △oxyR strain, they were streaked onto Martin agar plates and incubated overnight. One hundred single colonies from each strain were then picked and added to an appropriate amount of physiological saline, with the bacterial concentration of each single colony adjusted to 1.0 × 10⁻⁶. 10 CFU / ml. Take a clean glass slide, and use a pipette to drop 25 μl of Salmonella O122 serum and O123 serum (purchased from the China Institute of Veterinary Drug Control) onto the slide. Then, add 25 μl of bacterial suspension to each serum, and gently shake the slide to mix thoroughly. Determine the results after 2 minutes. As shown in Table 1, among 100 single-colony subclones of the parental strain C79-3, 12 clones reacted with the variant serum (O122). Among 100 single-colony subclones of strain CVCC530, 10 clones reacted with the standard serum (O123), indicating serotype variation. All 100 single-colony subclones of strain C79-3 / △oxyR reacted only with the variant serum (O122), demonstrating good O antigen stability.

[0031] Table 1. Antigenic stability analysis of Salmonella pullorum C79-3 / ΔoxyR.

[0032]

[0033] Note: O122+O123 indicates that it can agglutinate with both O122 serum and O123 serum.

[0034] Example 3: Preparation and Application of Stable Variant Agglutination Antigens

[0035] The constructed strain C79-3 / △oxyR, stably expressing the variant O antigen, was densely streaked onto Martin agar plates. After culturing for 24 h, the bacterial cells were washed with Martin broth and transferred to large Martin agar plates. The plates were incubated upright for 24 h, then inverted and incubated for another 24 h. After 48 h, the bacterial cells were washed with PBS containing 1% formalin. The cells were inactivated at 37°C for 24 h, and then 2 volumes of anhydrous ethanol were added and thoroughly mixed. The mixture was allowed to settle naturally at 4°C until complete bacterial precipitation. The precipitate was centrifuged, washed once with PBS containing 10% glycerol, and resuspended. The bacterial concentration was adjusted to approximately 1.5 × 10⁻⁶. 10 Stable variant agglutinating antigen is prepared by adding CFU / ml of ethanol solution of crystal violet to a final concentration of 0.01% and stirring at low speed to ensure thorough staining.

[0036] White pullorum-positive serum prepared by immunizing SFP chickens with different variant strains was serially diluted 2-fold. A self-prepared variant agglutination antigen and a commercial antigen were used to simultaneously detect the diluted serum, comparing their sensitivity. The results are shown in Table 2. The agglutination antigen prepared with C79-3 / ΔoxyR showed better sensitivity than the commercial agglutination antigen, still producing agglutination even after high-fold dilution of the serum.

[0037] Table 2. Application and sensitivity analysis of variant agglutination antigens prepared from strain C79-3 / ΔoxyR.

[0038]

[0039] - The liquid is a uniform blue color with no particulate matter precipitated.

[0040] +: A small amount of fine particulate matter precipitates out, but the solution remains blue;

[0041] ++: Obvious blue particles precipitate out, and the liquid still shows a slight blue color;

[0042] +++: Large blue particles precipitate out, and the liquid becomes transparent.

Claims

1. A strain stably expressing Salmonella gallinarum variant O antigen, characterized in that, The strain is a gene knockout of a gene of a chicken white diarrhea Salmonella C79-3 strain oxyR The nucleotide sequence of the gene is shown as SEQ ID NO.

1. oxyR ​ 2. The strain according to claim 1, characterized in that, Knocking out a gene by homologous recombination oxyR genes.

3. The use of the strain described in claim 1 or 2 in the preparation of Salmonella pullorum variant agglutination antigen.

4. A method for constructing a strain stably expressing variant O antigen of Salmonella pullorum, characterized by, Includes the following steps: (1) Preparation oxyR gene targeting fragment, the sequence of which is shown in SEQ ID NO. 2; (2) Plasmid pKD46 was transformed into Salmonella pullorum strain C79-3, and recombinant recipient bacteria were obtained by ampicillin resistance screening; (3) oxyR The gene targeting fragment was transferred into the recombinant recipient bacteria, and positive homologous recombinant bacteria were obtained through chloramphenicol resistance selection. These bacteria were then transferred into the pCP20 plasmid to excise the chloramphenicol resistance gene, resulting in... oxyR Gene knockout strains.

Images