A protease with improved acid tolerance and mutants and uses thereof

CN117904082BActive Publication Date: 2026-09-15QINGDAO GENYUAN BIOLOGICAL TECH GRP +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202311739645.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-12-18
Publication Date
2026-09-15
Estimated Expiration
2043-12-18

AI Technical Summary

Technical Problem

对蛋白原料降解效果较好的蛋白酶类通常是中性偏碱性蛋白酶,往往耐酸性较差,目前解决方法大多是通过蛋白酶包衣的方式,但工艺复杂且成本较高

Benefits of technology

本发明以Bacillus licheniformisWX-02来源的蛋白酶基因为基础,分别提供了包含F365W的单点突变体BLAPRm1,以及包含F365W/S193A、F365W/F155M、F365W/G125M的双位点突变体BLAPRm2至BLAPRm4,包含F365W/H100R/S193A、F365W/L186I/S193A的三位点突变体BLAPRm5和BLAPRm6。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117904082B_ABST
    Figure CN117904082B_ABST
Patent Text Reader

Abstract

The application provides a proteinase with improved acid resistance and its mutants and application. The proteinase is proteinase BLAPRm1, the amino acid sequence of which is shown as SEQ ID NO: 3, and is obtained by changing the phenylalanine at the 365th amino acid of the proteinase with the amino acid sequence shown as SEQ ID NO: 1 into tryptophan, and the acid resistance of the proteinase is obviously improved. On the basis of the proteinase BLAPRm1, the application obtains the proteinase mutants BLAPRm2, BLAPRm3, BLAPRm4, BLAPRm5 and BLAPRm6 with obviously improved acid resistance through multiple mutations. According to the animal digestion characteristics, the improved acid resistance means that the retention rate of the proteinase in the animal stomach acid environment is improved, the digestion rate of the protein feedstock is effectively improved in the animal intestinal tract, the cost is saved and the environmental pollution is reduced, and the application of the proteinase in the fields of feed, food additive and the like is promoted.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of genetic engineering and enzyme engineering, and specifically relates to a protease with enhanced acid resistance, its mutants, and applications. Background Technology

[0002] Proteases are a class of enzymes that catalyze the hydrolysis of peptide bonds in proteins. They are widely found in animals, plants, and microorganisms and have many different physiological functions. Proteases are widely used in various fields, such as the food industry, brewing, detergent industry, feed industry, leather industry, silk industry, and pharmaceutical industry. Therefore, these environments place higher demands on the yield and properties of proteases.

[0003] Our research group has previously developed several heat-resistant protease products, significantly improving the yield of protease preparations in processes such as spray drying and high-temperature granulation, thus saving costs. However, when used in feed, proteases often need to have a certain degree of resistance to gastric acid to maximize their protein degradation effect in the animal's intestines. Proteases with good protein degradation effects are usually neutral to alkaline proteases, which often have poor acid resistance. Currently, most solutions involve protease coating, but this process is complex and costly.

[0004] With the development of gene editing technology, analyzing and mutating genes themselves, combined with targeted screening, can gradually improve the performance of proteases. This study uses heat-resistant proteases as a basis to screen mutants with significantly improved acid resistance, so as to better adapt to the digestive characteristics of animals, reduce costs and increase efficiency, and promote the application of protease preparations in feed, animal husbandry and other fields. Summary of the Invention

[0005] This invention provides a protease with enhanced acid resistance, its mutants, and its applications. This invention, through... Bacillus licheniformis After analyzing the protease gene and amino acids from WX-02, several key sites were identified. Saturation mutations were performed on these key sites, and combined with error-prone PCR random mutation and high-throughput targeted screening technology, multiple rounds of mutations were conducted to obtain a variety of protease mutants with improved acid resistance, which will help promote their application in feed, food and other fields.

[0006] To achieve the above-mentioned objectives, the present invention employs the following technical solution: This invention provides a protease with improved acid resistance, specifically protease BLAPRm1, whose amino acid sequence is shown in SEQ ID NO: 3.

[0007] Furthermore, the protease BLAPRm1 is obtained by changing phenylalanine at position 365 of the protease, as shown in SEQ ID NO:1, to tryptophan.

[0008] The present invention also provides a coding gene, which is the coding gene for the protease BLAPRm1, and its nucleotide sequence is shown in SEQ ID NO: 4.

[0009] The present invention also provides a protease mutant with enhanced acid resistance, which is obtained by mutation of the protease BLAPRm1 and has one of the following amino acid sequences: (1) The amino acid sequence as shown in SEQ ID NO: 5; (2) The amino acid sequence as shown in SEQ ID NO: 7; (3) The amino acid sequence as shown in SEQ ID NO: 9; (4) The amino acid sequence as shown in SEQ ID NO: 11; (5) The amino acid sequence shown in SEQ ID NO: 13.

[0010] Furthermore, the protease mutant is obtained by changing serine at position 193 to alanine of the protease BLAPRm1 as shown in SEQ ID NO: 3; or changing phenylalanine at position 155 to methionine; or changing glycine at position 125 to methionine; or changing histidine at position 100 to arginine and serine at position 193 to alanine; or changing leucine at position 186 to isoleucine and serine at position 193 to alanine.

[0011] The present invention also provides a coding gene for the protease mutant, having one of the following nucleotide sequences: (1) The nucleotide sequence as shown in SEQ ID NO: 6; (2) The nucleotide sequence as shown in SEQ ID NO: 8; (3) The nucleotide sequence as shown in SEQ ID NO: 10; (4) The nucleotide sequence as shown in SEQ ID NO: 12; (5) The nucleotide sequence shown in SEQ ID NO:14.

[0012] The present invention also provides a recombinant expression vector containing the aforementioned coding gene.

[0013] The present invention also provides a genetically engineered bacterium containing the aforementioned encoding gene.

[0014] The present invention also provides the application of the protease or the protease mutant in the preparation of feed additives or food additives.

[0015] Furthermore, the feed additive or food additive contains at least one of the following: protease BLAPRm1 with the amino acid sequence shown in SEQ ID NO: 3; protease mutant BLAPRm2 with the amino acid sequence shown in SEQ ID NO: 5; protease mutant BLAPRm3 with the amino acid sequence shown in SEQ ID NO: 7; protease mutant BLAPRm4 with the amino acid sequence shown in SEQ ID NO: 9; protease mutant BLAPRm5 with the amino acid sequence shown in SEQ ID NO: 11; and protease mutant BLAPRm6 with the amino acid sequence shown in SEQ ID NO: 13.

[0016] Compared with the prior art, the advantages and beneficial technical effects of the present invention are: This invention is based on Bacillus licheniformis Based on the protease gene derived from WX-02, single-site mutant BLAPRm1 containing F365W was provided, as well as two-site mutants BLAPRm2 to BLAPRm4 containing F365W / S193A, F365W / F155M, and F365W / G125M, and three-site mutants BLAPRm5 and BLAPRm6 containing F365W / H100R / S193A and F365W / L186I / S193A.

[0017] Compared to wild-type proteases, the modified mutants BLAPRm1 to BLAPRm6 of this invention exhibit significantly improved acid resistance, increasing from 36% to 45.5%, 59.0%, 54.0%, 49%, 56.5%, and 60.0%, respectively, representing an increase of 26%-67%. This substantial improvement in acid resistance will promote the application of proteases in feed and animal husbandry. Based on animal digestive characteristics, when used in feed, it enhances the retention rate of proteases in the acidic environment of the animal's stomach, ensuring effective digestibility of protein feed ingredients in the animal's intestines. Simultaneously, it saves costs and reduces environmental pollution, demonstrating promising market application prospects. Attached Figure Description

[0018] Figure 1 It is a plate screening for protease mutants.

[0019] Figure 2 The results show the acid resistance residual rate of protease mutants after treatment with pH 3.5 for 30 minutes.

[0020] Figure 3 These are fermentation data for protease in a 30L fermenter. Detailed Implementation

[0021] To facilitate understanding of the present invention, the invention will be described more fully and in detail below with reference to the accompanying drawings and embodiments, but the scope of protection of the present invention is not limited to the following specific embodiments.

[0022] Molecular biology experimental methods not specifically described in the following examples can be performed according to the specific methods listed in J. Sambrook's *Molecular Cloning: A Laboratory Manual* (3rd Edition), or according to the kit and product instructions. Unless otherwise specified, the reagents and biological materials used in the specific examples are commercially available.

[0023] 1. Strains and vectors Bacillus subtilis WB600, plasmid pUB110, Escherichia coli BL21, and plasmid pET-21a(+) were purchased from Invitrogen. The T vector and DH5α competent Escherichia coli cells were purchased from Sangon Biotech (Shanghai) Co., Ltd.

[0024] 2. Reagents and Culture Media Plasmid extraction kit, fragment purification and recovery kit, restriction endonucleases, etc. were purchased from Takara Bio Engineering (Dalian) Co., Ltd.; GeneMorph II random mutation PCR kit was purchased from Stratagene; ampicillin, IPTG, etc. were purchased from Sangon Biotech (Shanghai) Co., Ltd.; protein marker: Blue Plus II Protein Marker (14-120 kDa) was purchased from TransGen Biotech Co., Ltd.

[0025] LB medium formulation: 1% tryptone, 0.5% yeast extract, 1% NaCl.

[0026] Fermentation medium: 50-80 g / L soybean meal powder, 60-100 g / L corn starch, 2-4 g / L disodium hydrogen phosphate, 1-2 g / L sodium carbonate, natural pH.

[0027] Example 1: Construction of a protease saturation mutant library Through the Bacillus licheniformis After analyzing the three-dimensional structure, conserved regions, and active sites of the protease gene (nucleotide sequence as shown in SEQ ID NO:2) and amino acid sequence (amino acid sequence as shown in SEQ ID NO:1) derived from WX-02, it was determined that position 365 might have a significant impact on acid resistance. Therefore, a saturation mutation was performed on position 365, and the mutation primers are shown in Table 1. The upstream and downstream gene fragments were amplified using the corresponding primers, then ligated into a T-vector, transformed into *E. coli* DH5α, and the obtained mutants were sequenced. After successful sequencing, a saturation mutant library was obtained.

[0028] Table 1: Primer Design for Saturation Mutation

[0029] After screening for protease saturation mutants, the sequencing was correct and 19 saturation mutants were obtained. PCR amplification needs to be performed again, and the primer sequences used are as follows: BLAPR-F: GC TCTAGA ATGATGAGGAAGAAATC (SEQ ID NO:15); BLAPR-R: CGC GGATCC TTACTGTGCAGCTGCTTCGA (SEQ ID NO: 16).

[0030] The PCR reaction conditions were: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 58℃ annealing for 30 s and 72℃ extension for 1 min, for a total of 30 cycles.

[0031] The amplified PCR product was double-digested with Xba I and BamH I, purified, and ligated into the pET-21a(+) vector. This vector was then transformed into *E. coli* BL21-DE3, and positive clones were selected using ampicillin-resistant LB agar plates to obtain pET-BLAPRx. The synthesized original gene was ligated into the pET-21a(+) vector and transformed into *E. coli* BL21-DE3 using the same method to obtain pET-BLAPR0.

[0032] Selected single colonies were inoculated into 96-well deep-well plates. Two single colonies expressing BLAPR0 were inoculated into each plate as controls. 300 μL of LB liquid medium (containing 100 μg / mL ampicillin) was added to each well, and the plates were incubated at 37°C and 200 rpm with shaking for 4 hours. After incubation, 50 μL of bacterial culture was transferred to a new 96-well plate for preservation. 200 μL of LB-Amp medium containing IPTG was added to the remaining bacterial culture on the plate to bring the final IPTG concentration to 1 mM and the final ampicillin concentration to 100 μg / mL. The plates were then incubated at 37°C and 200 rpm with shaking for 10 hours to induce protease expression.

[0033] The induced bacterial culture was repeatedly frozen and thawed to disrupt it. The disrupted cell culture was centrifuged to collect the supernatant, which was then acid-treated (pH 3.5, 37℃ for 30 min). The remaining activity of the protease was then measured.

[0034] A mutant F365W (named BLAPRm1) with improved acid resistance was obtained by screening, with its amino acid sequence shown in SEQ ID NO:3 and its encoding gene nucleotide sequence shown in SEQ ID NO:4.

[0035] Example 2: Error-prone PCR construction of a BLAPRm1 mutant library of protease Based on the screening results of Example 1, primers were designed using the protease amino acid sequence of BLAPRm1 (as shown in SEQ ID NO:3) and DNA sequence (as shown in SEQ ID NO:4). An Xba I restriction enzyme site was designed at the 5' end and a BamH I restriction enzyme site was designed at the 3' end.

[0036] Using the GeneMorph II random mutagenesis PCR kit, random mutations were performed on the gene SEQ ID NO:4 as a template. The primer sequences used are as follows: BLAPR-F: GC TCTAGA ATGATGAGGAAGAAATC (SEQ ID NO:15); BLAPR-R: CGC GGATCC TTACTGTGCAGCTGCTTCGA (SEQ ID NO: 16).

[0037] The PCR reaction conditions were: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 58℃ annealing for 30 s and 72℃ extension for 1 min, for a total of 30 cycles.

[0038] The amplified random mutant PCR product was digested with Xba I and BamH I, purified and recovered, and ligated into the pET-21a(+) vector. The vector was then transformed into Escherichia coli BL21-DE3, and positive clones were screened on ampicillin-resistant LB plates to obtain pET-BLAPRx.

[0039] Selected single colonies were inoculated into 96-well deep-well plates. Two single colonies expressing BLAPRm1 were inoculated into each plate as controls. 300 μL of LB liquid medium (containing 100 μg / mL ampicillin) was added to each well, and the plates were incubated at 37°C and 200 rpm with shaking for 4 hours. After incubation, 50 μL of bacterial culture was transferred to a new 96-well plate for preservation. 200 μL of LB-Amp medium containing IPTG was added to the remaining bacterial culture on the plate to bring the final IPTG concentration to 1 mM and the final ampicillin concentration to 100 μg / mL. The plates were then incubated at 37°C and 200 rpm with shaking for 10 hours to induce protease expression.

[0040] The induced bacterial culture was repeatedly freeze-thawed to disrupt the cells. The disrupted cell slurry was centrifuged, and the supernatant was collected and acid-treated (pH 3.5, 37°C for 30 min). The remaining protease activity was then measured. Mutant genes with higher remaining enzyme activity than BLAPRm1 were sequenced.

[0041] The following mutants with improved acid resistance were finally screened: The BLAPRm2 mutation is F365W / S193A (phenylalanine at position 365 is replaced with tryptophan and serine at position 193 is replaced with alanine), and its amino acid sequence is shown in SEQ ID NO:5. The nucleotide sequence of the encoding gene is shown in SEQ ID NO:6. The BLAPRm3 mutation is F365W / F155M (phenylalanine at position 365 is replaced with tryptophan and phenylalanine at position 155 is replaced with methionine), and its amino acid sequence is shown in SEQ ID NO:7. The nucleotide sequence of the encoding gene is shown in SEQ ID NO:8. The BLAPRm4 mutation is F365W / G125M (phenylalanine at position 365 is replaced with tryptophan and glycine at position 125 is replaced with methionine), and its amino acid sequence is shown in SEQ ID NO:9. The nucleotide sequence of the encoding gene is shown in SEQ ID NO:10.

[0042] The BLAPRm5 mutation is F365W / H100R / S193A (phenylalanine at position 365 is replaced with tryptophan, histidine at position 100 is replaced with arginine, and serine at position 193 is replaced with alanine), and its amino acid sequence is shown in SEQ ID NO:11. The nucleotide sequence of the encoding gene is shown in SEQ ID NO:12.

[0043] The BLAPRm6 mutation is F365W / L186I / S193A (phenylalanine at position 365 is replaced with tryptophan, leucine at position 186 is replaced with isoleucine, and serine at position 193 is replaced with alanine), the amino acid sequence is shown in SEQ ID NO:13, and the nucleotide sequence of the encoding gene is shown in SEQ ID NO:14.

[0044] Example 3: Validation of expression of an acid-resistant protease mutant in Bacillus subtilis The mutant from Example 2 and BLAPR0 were cloned into the Xba I and BamH I sites of plasmid pUB110, respectively. Following the Bacillus subtilis transformation method established by Spizizen, the recombinant plasmids were transformed into Bacillus subtilis WB600 to obtain recombinant bacteria. After plate screening, mutants BLAPRm1 to BLAPRm6 were obtained as follows: Figure 1 As shown. After the recombinant bacteria were fermented in a shake flask in the fermentation medium for 78 h, the culture medium was centrifuged to obtain the supernatant. The average enzyme activity of the supernatant of the fermentation broth for each mutant was measured. The supernatant of the transformant with the highest enzyme activity in each mutant was taken and treated at pH 3.5 and 37℃ for 30 min. The enzyme activity retention rate was then compared.

[0045] The results are as follows Figure 2As shown, the acid resistance residual rates of the mutated proteases BLAPRm1 to BLAPRm6 were 45.5%, 59%, 54%, 49.0%, 56.5%, and 60%, respectively, which were 26%-67% higher than the control (BLAPR0 acid resistance residual rate 36%).

[0046] The above results indicate that mutating Phe at position 365 of BLAPR0 to Trp improves its acid tolerance while maintaining the original enzyme activity. Furthermore, further mutations in the acid tolerance of mutants—such as mutating Ser at position 193 to Ala, Phe at position 155 to Met, Gly at position 125 to Met, His at position 100 to Arg and Ser at position 193 to Ala, or Leu at position 186 to Ile and Ser at position 193 to Ala—further enhance the acid tolerance. Therefore, the mutants exhibit significantly improved acid tolerance compared to the wild type, making them more suitable for applications in feed and food.

[0047] Example 4: Fermentation and preparation of protease mutants in a 30L fermenter The recombinant bacteria expressing the protease BLAPR0 and its mutants BLAPRm1, BLAPRm2, BLAPRm3, BLAPRm4, BLAPRm5, and BLAPRm6 from Example 3 were streaked onto LB agar plates containing kanamycin (final concentration 20 μg / mL) resistance. They were incubated at 37°C until single colonies grew. Healthy single colonies were selected and further streaked onto LB agar plates containing kanamycin (final concentration 20 μg / mL) resistance. This process was repeated three times to activate the resulting recombinant Bacillus subtilis colonies. These colonies were then inoculated into 50 mL of LB medium containing kanamycin (final concentration 20 μg / mL) and incubated at 37°C and 200 rpm for 24 h. Finally, 2% of the inoculum was added to 1 L of LB medium containing kanamycin (final concentration 20 μg / mL) and incubated at 37°C and 200 rpm until the OD600 reached approximately 5. This inoculum was then used as seed culture for inoculating fermenters.

[0048] Fermentation process: Soybean meal 5-10%, corn flour 1-5%, PPG-20000 0.1-1.0%, protease 0.1-1.0%, amylase 0.1-1.0%, disodium hydrogen phosphate (12 water) 0.2-0.5%, natural pH, temperature 37℃, stirring speed 600 rpm, aeration 1.5 (v / v), dissolved oxygen controlled above 20%. The pH is natural during fermentation. Enzyme activity is measured starting 24 hours after fermentation and measured every 4 hours until fermentation ends (48 hours).

[0049] Enzyme activity results as follows Figure 3 As shown, the enzyme activity of the protease continued to increase with the increase of fermentation time. The enzyme activity of the protease mutant was comparable to that of the wild-type protease BLAPR0, but the acid resistance of the protease mutant was better than that of the wild type.

[0050] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions claimed by the present invention.

Claims

1. A protease BLAPRm1 with enhanced acid resistance, characterized in that, The amino acid sequence of the protease BLAPRm1 is shown in SEQ ID NO:

3.

2. The protease BLAPRm1 according to claim 1, characterized in that, The protease BLAPRm1 is obtained by changing phenylalanine at position 365 of the protease, as shown in SEQ ID NO:1, to tryptophan.

3. A gene encoding a gene, characterized in that, The encoding gene is the encoding gene of the protease BLAPRm1 as described in claim 1, and its nucleotide sequence is shown in SEQ ID NO:

4.

4. A protease mutant with enhanced acid resistance, characterized in that, The protease mutant is obtained by mutating the protease BLAPRm1 according to claim 1, and its amino acid sequence is as follows: (1) The amino acid sequence as shown in SEQ ID NO: 5; Or (2) the amino acid sequence shown in SEQ ID NO: 7; Or (3) the amino acid sequence shown in SEQ ID NO: 9; Or (4) the amino acid sequence shown in SEQ ID NO: 11; Or (5) the amino acid sequence shown in SEQ ID NO:

13.

5. The protease mutant according to claim 4, characterized in that, The protease mutant is obtained by changing serine at position 193 to alanine in the protease BLAPRm1 with the amino acid sequence as shown in SEQ ID NO: 3; or changing phenylalanine at position 155 to methionine; or changing glycine at position 125 to methionine; or changing histidine at position 100 to arginine and serine at position 193 to alanine; or changing leucine at position 186 to isoleucine and serine at position 193 to alanine.

6. The encoding gene of the protease mutant according to claim 4, characterized in that, The nucleotide sequence of the encoding gene is as follows: (1) The nucleotide sequence as shown in SEQ ID NO: 6; Or (2) the nucleotide sequence shown in SEQ ID NO: 8; Or (3) the nucleotide sequence shown in SEQ ID NO: 10; Or (4) the nucleotide sequence shown in SEQ ID NO: 12; Or (5) the nucleotide sequence shown in SEQ ID NO:

14.

7. A recombinant expression vector, characterized in that, The recombinant expression vector contains the coding gene as described in claim 3 or claim 6.

8. A genetically engineered bacterium, characterized in that, The genetically engineered bacteria contain the encoding gene as described in claim 3 or claim 6.

9. The use of the protease of claim 1 or the protease mutant of claim 4 in the preparation of feed additives or food additives.

10. The application according to claim 9, characterized in that, The feed additive or food additive contains at least one of the following: protease BLAPRm1 with the amino acid sequence shown in SEQ ID NO: 3; protease mutant BLAPRm2 with the amino acid sequence shown in SEQ ID NO: 5; protease mutant BLAPRm3 with the amino acid sequence shown in SEQ ID NO: 7; protease mutant BLAPRm4 with the amino acid sequence shown in SEQ ID NO: 9; protease mutant BLAPRm5 with the amino acid sequence shown in SEQ ID NO: 11; and protease mutant BLAPRm6 with the amino acid sequence shown in SEQ ID NO: 13.

Citation Information

Patent Citations

  • Mutant timp-3

    CN101291953A

  • Serine proteases of bacillus species

    CN106170546A