Use of flavonoid in preparation of drugs for treating stroke

Abstract

The application discloses application of xanthohumol in preparation of a drug for treating stroke, and the xanthohumol can inhibit brain injury, promote brain angiogenesis, reduce oxidative stress, reduce Fe 2+ Level, reduce ferroptosis, reduce HSP90 expression, and can be used for treating stroke. The xanthohumol is a natural active ingredient, has low side effects, is easy to be clinically accepted, and can inhibit ferroptosis in brain tissue by reducing HSP90 expression, thereby promoting blood vessel regeneration in a stroke rat model, and provides a new treatment direction for stroke patients. The application has important clinical application value and development value.

Description

Technical Field

[0001] This invention relates to the field of biomedicine, and in particular to the application of senna lignin in the preparation of drugs for treating stroke. Background Technology

[0002] Stroke is a common neurological disorder caused by the sudden rupture or blockage of blood vessels in the brain, leading to brain tissue damage. It includes ischemic and hemorrhagic strokes. In most cases, cerebral ischemia-reperfusion injury is the primary pathological mechanism of ischemic stroke, severely impacting brain function. Stroke is characterized by high morbidity, high mortality, and high disability rates. Currently, there are no specific neuroprotective drugs to completely prevent brain tissue damage caused by stroke. Therefore, a deeper understanding of the pathological mechanisms of stroke is crucial for finding new preventative and therapeutic drugs.

[0003] In recent years, utilizing natural products to alleviate stroke damage has become a research hotspot. Fustin, one of the active ingredients in Gleditsia sinensis thorns, mainly exhibits antiviral, antitumor, and anti-inflammatory activities. However, recent studies suggest that fustin plays an important role in the pathogenesis of cognitive impairment. Cognitive impairment is a complication of stroke, suggesting that fustin may play a significant role in stroke, although the specific mechanism of action remains unknown.

[0004] Using the TCMSP database, heat shock protein 90 (HSP90) was identified as a potential downstream target of Fustin. HSP90 is a highly conserved protein molecule widely found in prokaryotes and eukaryotes, synthesized under stress conditions (such as viral infection, hypoxia, and ischemia). Also known as a stress protein, it primarily participates in cell development, growth, and differentiation as a molecular chaperone. Studies have found that inhibiting HSP90 can protect brain microvascular endothelial cells from oxidative stress damage and promote cerebral angiogenesis. Furthermore, HSP90 can promote ferroptosis. Ferroptosis is an iron-dependent, novel type of programmed cell death, distinct from apoptosis, necrosis, and autophagy. Reports indicate that Fustin can alleviate oxidative stress responses. This suggests that Fustin may inhibit ferroptosis in brain tissue by downregulating HSP90 expression, thereby alleviating brain damage caused by stroke. Summary of the Invention

[0005] The purpose of this invention is to provide an application of sclerotin in the preparation of drugs for treating stroke. Sclerotin inhibits ferroptosis by downregulating HSP90 and promotes angiogenesis in a rat model of stroke.

[0006] The technical solution adopted in this invention is:

[0007] Application of safflower lignin in the preparation of drugs for treating stroke.

[0008] The chemical structural formula of safflower lignin is shown below:

[0009]

[0010] Huangyan lignin reduces brain damage area, promotes cerebral angiogenesis, reduces oxidative stress, and lowers Fe. 2+ It can lower ferrode levels, reduce ferroptosis, and decrease HSP90 expression, thus playing a role in the treatment of stroke.

[0011] This invention also provides: stellaria ternatin in the preparation of substances that inhibit brain damage, promote cerebral angiogenesis, reduce oxidative stress, and decrease Fe... 2+ Application in drugs that reduce ferroptosis or decrease HSP90 expression.

[0012] The present invention also provides a preparation of a drug for treating stroke, the drug comprising senna extract.

[0013] This invention discovers that inhibiting HSP90 expression can be used to treat stroke. HSP90 inhibitors can inhibit ferroptosis in brain tissue caused by stroke and promote cerebral angiogenesis. Chlorophyll can reduce brain damage and treat stroke by downregulating HSP90 expression levels.

[0014] HSP90 inhibitors can be one or more of the following: small interfering RNA (siRNA) of the HSP90 gene, RNA interference vector of the HSP90 gene, HSP90 antibody, substances that inhibit HSP90 expression level, reduce HSP90 activity, or enhance HSP90 metabolism.

[0015] The beneficial effects of this invention are as follows:

[0016] This invention discloses for the first time the role of stellaria zetatum in the treatment of stroke. Stellaria zetatum can reduce the area of ​​cerebral ischemia and promote cerebral angiogenesis in a rat model of stroke, indicating that stellaria zetatum has a protective effect against brain injury caused by stroke. In addition, stellaria zetatum can inhibit oxidative stress and Fe2+ in stroke models (rats and vascular endothelial cells). 2+ Levels, ferroptosis, and HSP90 expression. In damaged vascular endothelial cells, luteolin promoted cell viability and angiogenesis, indicating that luteolin has a protective effect on vascular endothelial cells. This invention also found that HSP90 overexpression reversed the protective effect of luteolin on vascular endothelial cells, suggesting that luteolin exerts its protective effect partly by downregulating HSP90 expression levels and inhibiting ferroptosis in stroke, suggesting that HSP90 is a promising target for stroke prevention and treatment.

[0017] This invention provides a novel drug for treating stroke. The active ingredient, senna extract, is a natural compound with low side effects and is easily accepted clinically. Senna extract can protect against stroke-induced damage and can inhibit ferroptosis in brain tissue by downregulating HSP90 expression, thereby promoting angiogenesis in a rat model of stroke. This provides a new treatment direction for stroke patients and develops HSP as a new target for stroke prevention and treatment. This invention has significant clinical application and development value. Attached Figure Description

[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0019] Figure 1 The figures show the effects of Fustin on cerebral ischemia area, angiogenesis, and antioxidant-related indicators in a rat model of stroke. Figure A shows a photograph and bar chart comparing the cerebral ischemia area; Figure B shows a fluorescent photograph and bar chart comparing angiogenesis in the ischemic hemisphere cortex detected by immunofluorescence; Figure C shows a comparison chart of reduced glutathione (GSH) levels; Figure D shows a comparison chart of malondialdehyde (MDA) levels; and Figure E shows a comparison chart of superoxide dismutase (SOD) levels.

[0020] Figure 2 Fustin was used to measure lipid peroxidation levels and Fe in a rat model of stroke. 2+ The results of the effects of lipid peroxidation levels, ferroptosis-related proteins, and HSP90 protein expression are shown in the figure. Figure A shows the comparison of lipid peroxidation levels, and Figure B shows the effect of Fe... 2+ The comparison charts show that: Figure C shows the detection results of ferroptosis-related proteins, and Figure D shows the comparison of HSP90 protein expression levels.

[0021] Figure 3 Figure 1 shows the effects of Fustin on Erastin-induced vascular endothelial cell viability, angiogenesis, and antioxidant-related indicators. Figure 2 shows the effects of different concentrations of Fustin on vascular endothelial cell viability; Figure 3 shows the effects of Fustin on Erastin-induced vascular endothelial cell viability; Figure 4 shows the effects of Fustin on Erastin-induced angiogenesis; Figure 5 shows the effects of Fustin on Erastin-induced reduced glutathione (GSH) levels; Figure 6 shows the effects of Fustin on Erastin-induced malondialdehyde (MDA) levels; and Figure 7 shows the effects of Fustin on Erastin-induced superoxide dismutase (SOD) levels.

[0022] Figure 4 Fustin's effect on Erastin-induced lipid peroxidation levels in vascular endothelial cells and Fe 2+ The results of the effects of Fustin on the level of ferroptosis-related proteins and HSP90 protein expression are shown in Figure A. Figure A shows the effect of Fustin on Erastin-induced lipid peroxidation levels in vascular endothelial cells, and Figure B shows the effect of Fustin on Erastin-induced Fe... 2+ The results of the level effects are shown in Figure C, which compares the effects of Fustin on the levels of ferroptosis-related proteins induced by Erastin, and Figure D, which compares the effects of Fustin on the expression levels of HSP90 protein induced by Erastin.

[0023] Figure 5 The results show that HSP90 overexpression reversed the effects of Fustin on Erastin-induced vascular endothelial cell viability, angiogenesis, and antioxidant-related indicators. Figure A shows the HSP90 expression levels in vascular endothelial cells transfected with the HSP90 plasmid and plasmid vector; Figure B compares the viability of vascular endothelial cells under Erastin, Fustin, and HSP90 overexpression; Figure C compares the angiogenesis under Erastin, Fustin, and HSP90 overexpression; Figure D compares the reduced glutathione (GSH) levels under Erastin, Fustin, and HSP90 overexpression; Figure E compares the malondialdehyde (MDA) levels under Erastin, Fustin, and HSP90 overexpression; and Figure F compares the superoxide dismutase (SOD) levels under Erastin, Fustin, and HSP90 overexpression.

[0024] Figure 6 HSP90 overexpression reversed the effects of Fustin-erastin-induced lipid peroxidation and Fe2+ levels in vascular endothelial cells. 2+ The results show the effects of ferroptosis-related proteins on lipid peroxidation levels. Figure A compares lipid peroxidation levels under Erastin, Fustin, and HSP90 overexpression. Figure B shows the Fe levels under Erastin, Fustin, and HSP90 overexpression. 2+ The horizontal comparison diagram shows that Figure C is a comparison of the levels of ferroptosis-related proteins under Erastin, Fustin, and HSP90 overexpression. Detailed Implementation

[0025] The technical solution of the present invention will be further described below with reference to embodiments. Those skilled in the art can refer to the content of this document and appropriately improve the process parameters to achieve the desired result. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in the present invention. The method of the present invention has been described through preferred embodiments, and those skilled in the art can obviously make modifications or appropriate alterations and combinations to the products described herein without departing from the content, spirit, and scope of the present invention to realize and apply the technology of the present invention. The scope of protection of the present invention is not limited thereto.

[0026] Example 1: Study on the efficacy of Fustin in treating stroke

[0027] (1) Construction of a rat model of stroke

[0028] A rat model of cerebral ischemia-reperfusion injury (MCAO / reperfusion) was established using the suture occlusion method to simulate stroke. After isoflurane anesthesia, the right carotid artery was exposed through a midline incision on the right side of the neck. Then, a V-shaped incision was made on the common carotid artery, and a nylon suture was slowly inserted into the initial segment of the middle cerebral artery (approximately 18 mm). The suture was tightened, and cerebral blood flow was blocked for 2 hours. To restore blood flow, the nylon suture was removed, thus initiating reperfusion, and the incision was sutured. Control rats underwent all neck surgeries, with skin incisions sutured, but without the insertion of nylon sutures to block cerebral blood flow.

[0029] (2) Animal grouping and treatment plan

[0030] Thirty-two SD rats were randomly divided into four groups of eight each: control (Con), model (Mod), Fustin-50, and Fustin-100. Rats in the Con group underwent all neck surgeries as described in Case 1(1), with skin incisions sutured but without nylon sutures to block cerebral blood flow. The other three groups underwent MCAO / reperfusion procedures as described in step (1). Rats in the Fustin-50 and Fustin-100 groups were then administered 50 mg / kg / day and 100 mg / kg / day of Fustin, respectively, by gavage for 14 days. Rats in the Con and Mod groups were treated with an equal volume of saline. After 14 days, rats were anesthetized with isoflurane, and all rats were euthanized by cervical dislocation. Brain tissue was collected for further experiments.

[0031] (3) Triphenyltetrazolium chloride (TTC) staining to detect cerebral ischemia area

[0032] Brain tissue was immediately frozen at -20°C after extraction and then cut into 2mm thick continuous coronal sections. The sections were stained with 2% TTC solution in the dark for 15 minutes (37°C). Ischemic areas appeared white, while non-ischemic areas appeared red. Images were recorded using an E-M5 Mark III digital camera, and the ischemic area was analyzed using Image-Pro Plus 6.0.

[0033] The results are as follows Figure 1 As shown in Figure A, compared with the Con group, the Mod group rats had a significantly increased cerebral ischemia area, but Fustin reduced the cerebral ischemia area caused by MCAO / reperfusion in a concentration-dependent manner.

[0034] (4) Immunofluorescence detection of angiogenesis in the ischemic hemisphere cortex

[0035] CD31 is a marker of angiogenesis used to assess the presence of endothelial tissue. Paraffin-embedded sections of ischemic hemispheric cortex were dewaxed with xylene and then dissolved in water. Samples were treated with 0.01 mol / L sodium citrate buffer and then washed with phosphate buffer. Samples were then sequentially reacted with 5% bovine serum albumin inhibitor, CD31 antibody (1:500), and Alexa... The samples were incubated with 594 secondary antibody (1:100). After staining with DAPI solution for 5 minutes, fluorescence images were finally captured using a confocal fluorescence microscope (resolution: 50 μm, ×400).

[0036] The results are as follows Figure 1 As shown in Figure B, compared with the Con group, the Mod group rats showed significantly reduced cerebral angiogenesis, but Fustin promoted MCAO / reperfusion-inhibited cerebral angiogenesis in a concentration-dependent manner.

[0037] (5) Antioxidant index detection

[0038] Antioxidant markers included reduced glutathione (GSH), malondialdehyde (MDA), and superoxide dismutase (SOD). GSH, MDA, and SOD levels in the ischemic hemisphere cortex were measured using GSH, MDA, and SOD kits (purchased from Solarbio). Following the manufacturer's instructions, the collected ischemic hemisphere cortex was homogenized, centrifuged for 10 minutes (8000×g), and the supernatant was collected for measurement. The prepared test solutions were mixed with the samples, and after sufficient reaction, the absorbance was measured using a microplate reader (GSH: 412 nm; MDA: 532 nm and 600 nm; SOD: 560 nm).

[0039] The results are as follows Figure 1As shown in Figures C-E, compared with the Con group, the Mod group rats had significantly lower GSH and SOD levels and significantly higher MDA levels. However, Fustin reversed the effects of MCAO / reperfusion on these antioxidant indicators in a concentration-dependent manner. These results indicate that Fustin can enhance the antioxidant capacity of stroke rats.

[0040] (6) Detection of lipid peroxidation level

[0041] The lipid peroxidation level in the ischemic hemispheric cortex was detected using a thiobarbituric acid reactive saturates (TBARS) kit, purchased from Wuhan Elairite. Following the manufacturer's instructions, the collected ischemic hemispheric cortex was homogenized, centrifuged for 10 minutes (10,000×g), and the supernatant was collected for measurement. After the prepared reagent solution was fully reacted with the sample, the corresponding absorbance (520 nm) was measured using a microplate reader.

[0042] The results are as follows Figure 2 As shown in Figure A, compared with the Con group, the TBARS level in the Mod group rats was significantly increased, but Fustin reduced the MCAO / reperfusion-promoted TBARS level in a concentration-dependent manner.

[0043] (7)Fe 2+ Horizontal detection

[0044] Fe in the cortex of the ischemic hemisphere 2+ Horizontal tissue Fe 2+ The content was detected using a assay kit (purchased from Beijing Solarbio). Following the manufacturer's instructions, the collected ischemic hemispheric cortex was homogenized, centrifuged for 10 minutes (4000×g), and the supernatant of the tissue sample was collected for measurement. After the prepared reagent solution was fully reacted with the sample, the corresponding absorbance (520nm) was measured using an ELISA reader.

[0045] The results are as follows Figure 2 As shown in Figure B, compared with the Con group, the Mod group rats had lower Fe levels. 2+ Levels were significantly elevated, but Fustin reduced MCAO / reperfusion-promoted Fe in a concentration-dependent manner. 2+ level.

[0046] (8) Western blot detection of ferroptosis-related protein and HSP90 protein expression

[0047] Proteins were extracted from the ischemic hemispheric cortex using RIPA lysis buffer containing a protease inhibitor, and protein concentration was measured using a BCA protein assay kit. Protein samples were denatured in boiling water at 99°C for 10 min, then separated by SDS-PAGE, and transferred to a PVDF membrane. The membrane was blocked with 5% skim milk at room temperature for 1 hour. The membrane was then incubated overnight with primary antibody at 4°C. Subsequently, the membrane was incubated with horseradish peroxidase (HRP)-conjugated secondary antibody at room temperature for 1 hour. Finally, development was performed using an ECL chemiluminescence assay kit. GAPDH was used as an internal control.

[0048] The results are as follows Figure 2 As shown in Figure C, compared with the Con group, the Mod group rats had significantly lower levels of ferroptosis-related proteins (GPX4 and SLC7A11). However, Fustin increased the expression of MCAO / reperfusion inhibition-related GPX4 and SLC7A11 proteins in a concentration-dependent manner, indicating that Fustin can reduce ferroptosis in the brain tissue of stroke-affected rats. Furthermore, the HSP90 protein expression results are as follows... Figure 2 As shown in Figure D, compared with the Con group, the HSP90 protein level in the Mod group rats was significantly increased, but Fustin reduced the expression of MCAO / reperfusion-promoted HSP90 protein in a concentration-dependent manner.

[0049] Example 2: HSP90 overexpression reversed the effect of Fustin on Erastin-induced vascular endothelial cells.

[0050] (1) Cell culture and grouping

[0051] Human vascular endothelial cells were cultured in endothelial cell culture medium containing 10% fetal bovine serum, 1% endothelial cell growth supplement, and 1% antibiotic solution, and the cells were cultured in an incubator at 37°C and 5% CO2. In subsequent experiments, the vascular endothelial cells were divided into four fractions.

[0052] Part 1: To investigate the effects of different concentrations of Fustin (0, 10, 20 and 40 μM) on vascular endothelial cell viability, vascular endothelial cells were incubated with 0, 10, 20 and 40 μM Fustin for 24 and 48 hours, respectively.

[0053] Part 2: To simulate ferroptosis conditions following stroke, vascular endothelial cells were incubated with a ferroptosis inducer (Erastin, 5 μM) for 24 hours to mimic the state of ferroptosis in vascular endothelial cells after stroke. Cells were divided into five groups: the Con group (normal cell culture), the Erastin group (cells incubated with 5 μM Erastin for 24 hours), the Erastin+Fustin-10 group, the Erastin+Fustin-20 group (cells incubated with 5 μM Erastin and 20 μM Fustin for 24 hours), and the Erastin+Fustin-40 group (cells incubated with 5 μM Erastin and 40 μM Fustin for 24 hours).

[0054] Part 3: To detect the efficiency of HSP90 overexpression, the HSP90 plasmid and its negative control (NC) were transfected into vascular endothelial cells for 24 hours.

[0055] Part 4: To verify whether the effect of Fustin on vascular endothelial cells is achieved through the regulation of HSP90, cells were divided into five groups, including the Con group (normal cell culture), the Erastin group (cells incubated with 5 μM Erastin for 24 hours), the Fustin group (cells incubated with 5 μM Erastin and 40 μM Fustin for 24 hours), the Fustin+NC group (cells transfected with NC and incubated with 5 μM Erastin and 40 μM Fustin for 24 hours), and the Fustin+HSP90 group (cells transfected with HSP90 plasmid and incubated with 5 μM Erastin and 40 μM Fustin for 24 hours).

[0056] (2) Cell viability detection

[0057] Assess cell viability using a CCK-8 assay kit. Follow the manufacturer's instructions to use 1×10⁶ cells. 4 Endothelial cells were seeded into 96-well plates. After 24 hours of treatment following the grouping method in step (1), 10 μL of CCK-8 reagent was added to each cell sample well, and the cells were incubated at 37°C for 2 hours. Finally, the absorbance (450 nm) was measured using a microplate reader.

[0058] (3) Detection of cell angiogenesis capacity

[0059] The angiogenesis capacity of vascular endothelial cells was evaluated using a tube formation assay. 1×10⁻⁶ cells were used. 5 Vascular endothelial cells were seeded into 24-well plates coated with matrix gel and cultured for 6 hours. The resulting blood vessels were then imaged using a microscope (resolution: 50 μm, ×100), and the angiogenesis capabilities were analyzed using ImageJ 1.8.0 software.

[0060] (4) Detection of antioxidant-related indicators

[0061] Antioxidant markers included reduced glutathione (GSH), malondialdehyde (MDA), and superoxide dismutase (SOD). GSH, MDA, and SOD levels in vascular endothelial cells were measured using GSH, MDA, and SOD kits (purchased from Solarbio). Following the manufacturer's instructions, collected vascular endothelial cells were sonicated, centrifuged for 10 minutes (8000×g), and the supernatant was collected for measurement. The prepared test solutions were mixed with the samples, and after sufficient reaction, the corresponding absorbance was measured using a microplate reader (GSH: 412 nm; MDA: 532 nm and 600 nm; SOD: 560 nm).

[0062] (5) Detection of lipid peroxidation level

[0063] The lipid peroxidation level of vascular endothelial cells was detected by C11 BODIPY staining. 2 μM C11 BODIPY staining solution was added to the cells treated in step (1), and the cells were incubated at 37°C in the dark for 30 minutes. Finally, fluorescence images were captured using a confocal fluorescence microscope (resolution: 50 μm, ×200) (excitation light for peroxidation was 488 nm; excitation light for non-peroxidation was 581 nm).

[0064] (6)Fe 2+ Horizontal detection

[0065] Fe in vascular endothelial cells 2+ Horizontal use of cell Fe 2+ The content was detected using a assay kit (purchased from Beijing Solarbio). Following the manufacturer's instructions, the collected vascular endothelial cells were disrupted using an ultrasonic homogenizer, centrifuged for 10 minutes (8000×g), and the supernatant of the cell sample was collected for measurement. The prepared test solution was mixed with the sample, and after sufficient reaction, the corresponding absorbance (510nm) was measured using an ELISA reader.

[0066] (7) Western blot detection of ferroptosis-related protein and HSP90 protein expression

[0067] Proteins were extracted from vascular endothelial cells using RIPA lysis buffer containing protease inhibitors, and protein expression was then detected according to step (8) of Example 1.

[0068] (8) The cell transfection steps are as follows:

[0069] HSP90 plasmid was purchased from Ubisoft Biotechnology, and pDONR223 was used as the vector. Cell transfection was performed using Lipofectamine 2000. 1×10 6Vascular endothelial cells were seeded in 6-well plates and cultured for 24 hours. Transfection reagents and plasmids were diluted with serum-free medium, mixed together, and then added to the cells. Cells were collected 24 hours after transfection to determine the transfection efficiency of the HSP90 plasmid.

[0070] (9) Detection of HSP90 plasmid transfection efficiency by QRT-PCR

[0071] Total RNA was extracted from vascular endothelial cells using an RNA isolation kit. RNA concentration was detected using an Evolution 260 biospectrophotometer. cDNA was synthesized using a cDNA synthesis kit. Next, qPCR was performed using a SYBR Green qRT-PCR kit. All procedures were performed according to the manufacturer's instructions. Conditions were as follows: initial denaturation at 95°C for 3 minutes, followed by 40 cycles of the following steps: denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, extension at 72°C for 20 seconds; and a final extension at 72°C for 5 minutes. GAPDH was used as an internal control. Relative expression levels were calculated using the 2-ΔΔCt method. Primers are shown in Table 1.

[0072] Table 1: Primers for qRT-PCR synthesis

[0073] HSP90 (human) forward GTCTAGTTGACCGTTCCGCA HSP90 (human) reverse TAACAGGTGCCCTGCTTCTC GAPDH (human) forward GGATTTGGTCGTATTGGGCG GAPDH (human) reverse TCCCGTTCTCAGCCATGTAG

[0074] The above experimental results are analyzed as follows:

[0075] like Figure 3 As shown in Figure A, different concentrations of Fustin (0, 10, 20, and 40 μM) had no significant effect on vascular endothelial cell viability. Figure 3 As shown in Figures B-C, compared to the Con group, the Erastin group exhibited significantly reduced endothelial cell viability and angiogenesis capacity. However, Fustin alleviated the inhibition of cell viability and angiogenesis by Erastin in a concentration-dependent manner. Additionally, as... Figure 3 As shown in the D-F diagram, compared with the Con group, Erastin can significantly reduce GSH and SOD levels and promote MDA levels, but these effects are reversed by different concentrations of Fustin.

[0076] Results of lipid peroxidation level detection in vascular endothelial cells as follows Figure 4 As shown in Figure A, Erastin promoted lipid peroxidation levels compared to the Con group, but Fustin reversed this effect in a concentration-dependent manner. Additionally, as... Figure 4 As shown in Figures B to C, Fe 2+The levels of ferroptosis-related proteins (GPX4 and SLC7A11) were significantly increased under Erastin treatment, while the levels were significantly decreased; these effects were reversed by different concentrations of Fustin. Notably, Erastin promoted HSP90 expression levels compared to the Con group, but this effect was reversed by different concentrations of Fustin (e.g., ...). Figure 4 (as shown in Figure D).

[0077] like Figure 5 As shown in Figure A, compared to the NC group, HSP90 was successfully overexpressed in vascular endothelial cells, and HSP90 plasmid transfection was successful. Furthermore, Fustin's effect on Erastin-induced vascular endothelial cell viability (e.g., ...) was also observed. Figure 5 As shown in Figure B), angiogenesis (such as...) Figure 5 As shown in Figure C), antioxidant indicators (such as...) Figure 5 (as shown in the DF diagram), lipid peroxidation level (e.g.) Figure 6 (as shown in Figure A) Fe 2+ Horizontal (e.g.) Figure 6 (as shown in Figure B) and ferroptosis-related protein levels (such as...) Figure 6 The effects shown in C) were all reversed by HSP90 overexpression. The results indicate that HSP90 overexpression reversed the protective effect of chamomile on vascular endothelial cells, while chamomile, by downregulating HSP90 expression levels, inhibited ferroptosis in stroke and promoted cerebral angiogenesis.

[0078] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. Application of safflower lignin in the preparation of drugs for treating stroke.

Images