Use of LDC000067 in the preparation of a medicament for the treatment of influenza virus infection

Abstract

The application relates to the technical field of the use of LDC000067, in particular to the application of LDC000067 in the preparation of a medicine for treating influenza virus infection. The application includes avoiding or reducing the infection of the influenza virus; inhibiting the replication of the influenza virus; inhibiting the proliferation of the influenza virus; influenza virus RNA synthesis; inhibiting the synthesis of the NP protein of the influenza virus; improving or avoiding the cell damage of the body caused by the infection of the influenza virus; improving or avoiding the alveolar structure damage of the body caused by the infection of the influenza virus; improving or avoiding the myocardial tissue damage of the body caused by the infection of the influenza virus; or eliminating, improving or avoiding the otitis media of the body caused by the infection of the influenza virus.

Description

Technical Field

[0001] This application relates to the technical field of LDC000067, specifically to the use of LDC000067 in the preparation of drugs for treating influenza virus infection. Background Technology

[0002] LDC000067 (CAS:1073485-20-7) is a cyclin-dependent kinase 9 (CDK9) inhibitor. CDK9 is an important member of the CDK family. CDK9 is the catalytic methylene group in the positive transcription elongation factor P-TEFb. When negative transcription elongation factors (NELF, N-TEFs) participate in the negative regulation of cellular transcription, positive P-TEFb is recruited into the system where NELF and N-TEFs inhibit transcription elongation, causing the negative transcription elongation factors to disengage, thus allowing transcription to continue. By inhibiting CDK9, and subsequently blocking the phosphorylation of the RNA Poly-IIC terminal region by P-TEFb, transcription is repressed.

[0003] LDC000067 is selective for CDK9, 55-fold more selective than for CDK2, and more than 230-fold more selective than for CDK6 and CDK7. LDC067 inhibits transcription in an ATP-competitive and dose-dependent manner. In intact cells, LDC000067 can also selectively reduce short-lived mRNAs, including MYC and MCL1, which encode proteins regulating apoptosis and cell proliferation. Summary of the Invention

[0004] However, the inventors of this application have discovered that LDC000067 has the potential to be used against influenza viruses.

[0005] Therefore, the embodiments of this application disclose at least the following technical solutions:

[0006] In the first aspect, the embodiments disclose the application of LDC000067 in the preparation of anti-influenza virus drugs. The term "anti" means interfering with the infection process of influenza virus; inhibiting the growth of influenza virus; inhibiting the proliferation of influenza virus; inhibiting the synthesis of influenza virus mRNA; inhibiting the synthesis of influenza virus NP protein; improving or avoiding cell damage to the body caused by influenza virus infection; improving or avoiding alveolar structure damage to the body caused by influenza virus infection; improving or avoiding myocardial tissue damage to the body caused by influenza virus infection; or eliminating, improving or avoiding otitis media to the body caused by influenza virus infection.

[0007] In an embodiment of the first aspect, the influenza virus is selected from one or more of influenza A and B viruses. In some embodiments, the influenza virus is selected from at least one of the H1N1, H2N2, and H3N2 subtypes of influenza A virus and all subtypes of avian influenza virus.

[0008] In an embodiment of the first aspect, the application is selected from at least one of the following: interfering with the infection process of influenza virus; inhibiting the growth of influenza virus; inhibiting the proliferation of influenza virus; inhibiting the synthesis of influenza virus mRNA; inhibiting the synthesis of influenza virus NP protein; improving or avoiding cell damage to the body caused by influenza virus infection; improving or avoiding alveolar structure damage to the body caused by influenza virus infection; improving or avoiding myocardial tissue damage to the body caused by influenza virus infection; or eliminating, improving or avoiding otitis media to the body caused by influenza virus infection.

[0009] In the embodiments of the first aspect, LDC000067 at a concentration of not less than 5 μM inhibits the proliferation of influenza virus.

[0010] In the embodiments of the first aspect, LDC000067 at a concentration of not less than 5 μM inhibits influenza virus mRNA synthesis.

[0011] In the embodiments of the first aspect, LDC000067 at a concentration of not less than 5 μM inhibits the synthesis of influenza virus NP protein.

[0012] Secondly, the embodiments disclose an antiviral drug. The composition comprises an effective amount of LDC000067 or a combination of drugs and pharmaceutically acceptable excipients having an antiviral effect against influenza.

[0013] In some embodiments of the second aspect, the pharmaceutically acceptable excipient is selected from one or more of solvents, dispersants, diluents, fillers, wetting agents, binders, disintegrants, lubricants, preservatives, suspending agents, emulsifiers, excipients, flavoring agents, and carriers. In some embodiments, the dosage form of the composition includes tablets, capsules, granules, pellets, liquid formulations, decoctions, suppositories, gels, aerosols, or patches.

[0014] Thirdly, the embodiments disclose a composition. This composition includes LDC000067 and other components. The other components are selected from at least one of the following: antiviral drugs (amantadine, rimantadine, baloxavir, oseltamivir, zanamivir, peramivir, ribavirin, interferon, arbidol, remdesivir); nonsteroidal anti-inflammatory drugs (aspirin, ibuprofen, naproxen, diclofenac, indomethacin, ketoprofen, meloxicam, celecoxib, piroxicam, sulinda); glucocorticoids (prednisone, methylprednisolone, dexamethasone, hydrocortisone, triamcinolone, betamethasone); and other anti-inflammatory drugs (colchicine, allopurinol, febuxostat, methotrexate, TNF inhibitors, IL-6 inhibitors, JAK inhibitors, selective COX-2 inhibitors).

[0015] Fourthly, the embodiments disclose an antiviral drug for influenza. The drug is a liquid formulation containing a concentration of not less than 0.01 μM LDC000067. The drug provided in this application can be in single-dose or multi-dose form. Optionally, the final concentration of LDC000067 in the drug is 0.01 μM-500 μM. This concentration refers to the final concentration of LDC000067 in the composition, such as the liquid formulation. The amount of LDC000067 taken during treatment is adjusted according to the final concentration, dosage form, and the individual to be treated to ensure a therapeutically effective dose.

[0016] In some embodiments of the fourth aspect, the drug is a liquid formulation containing a concentration of not less than 5 μM LDC000067. In some embodiments, the drug is a liquid formulation containing a concentration of not less than 10 μM LDC000067. In some embodiments, the drug is a liquid formulation containing a concentration of not less than 15 μM LDC000067. In some embodiments, the drug is a liquid formulation containing a concentration of not less than 20 μM LDC000067. In some embodiments, the drug is a liquid formulation containing a concentration of not less than 25 μM LDC000067. In some embodiments, the drug is a liquid formulation containing a concentration of not less than 30 μM LDC000067. In some embodiments, the drug is a liquid formulation containing a concentration of not less than 35 μM LDC000067. In some embodiments, the drug is a liquid formulation containing a concentration of not less than 40 μM LDC000067. In some embodiments, the drug is a liquid formulation containing a concentration of not less than 80 μM LDC000067.

[0017] One test case showed that LDC000067 exhibited weak toxicity to A549 cells when treated at a concentration of 80 μM, with a half-maximal toxicity concentration (CMC) of approximately 100%. 50 Greater than 80μM.

[0018] One test case showed that LDC000067 had a significant inhibitory effect on influenza virus proliferation in A549 cells at concentrations ranging from 5 to 20 μM, and exhibited a good dose-response relationship.

[0019] One test case showed that LDC000067 significantly inhibited the synthesis of influenza virus mRNA in A459 cells at concentrations ranging from 5 to 20 μM, and exhibited a good dose-response relationship.

[0020] One test case showed that LDC000067 significantly inhibited the synthesis of influenza virus proteins in A549 cells at a concentration range of 5–10 μM, and exhibited a good dose-response relationship.

[0021] The term "pharmaceutically acceptable excipient" refers to a component that does not interfere with the efficacy of the biological activity of compound LDC000067 and is not significantly toxic to the body at its therapeutically effective concentration. This includes any one or a combination of at least two of solvents, dispersants, diluents, fillers, wetting agents, binders, disintegrants, lubricants, preservatives, suspending agents, emulsifiers, excipients, flavoring agents, and carriers. The use of the aforementioned components in pharmaceutically active substances is well known in the art. For example, the solvents include, but are not limited to, dimethyl sulfoxide (DMSO), and the carriers include, but are not limited to, polyethylene glycol, polyhydroxyethoxylated castor oil, peanut oil, olive oil, gelatin, lactose, gypsum powder, sucrose, cyclodextrin, amylose, magnesium stearate, pectin, gum arabic, stearic acid, or lower alkyl ethers of cellulose. Each component can be used alone or in combination with several others.

[0022] The terms "effective amount" and "therapeutic effective amount" refer to the amount of a compound, reagent, preparation, or composition required, when taken orally, to provide some degree of relief for one or more symptoms of a disease or condition being treated, with the intended goal of reducing and / or alleviating symptoms or causes, or any other desired change in the body. For example, a therapeutic effective amount is the amount of a composition containing the compounds disclosed in this application required to provide significant symptom relief in a clinical setting, and the effective amount suitable for any individual case can be determined using techniques such as dose escalation testing. The therapeutic effective amount will vary depending on the compound activity, the severity of the symptom caused by the viral infection, and the size and health status of the individual being treated. Exemplarily, a therapeutic effective amount in a mouse model can be 1 mg / kg to 150 mg / kg, preferably 1 mg / kg to 100 mg / kg, more preferably 5 mg / kg to 30 mg / kg, such as 10 mg / kg or 20 mg / kg, twice daily.

[0023] The term "treatment" and similar terms encompass any therapeutic action on humans or animals other than humans. Treatment can be directed at an existing condition or can be preventative (preventative treatment), including curative, ameliorative, or preventative effects. Treatment can also include curing, ameliorating, or preventing symptoms associated with a disease rather than acting on the underlying cause of the disease. The term "prevention" and similar terms include reducing the likelihood of a patient developing or experiencing a disease or symptom worsening, such as during the period of medication administration following exposure to the influenza virus but before infection occurs. Treatment can also be directed at the initial infection or infection following the activation of the latent virus.

[0024] The compositions provided in this application are adaptable to any route of administration for the prevention and / or treatment of influenza viruses, including but not limited to oral, nasal, transdermal, intravenous, and gastrointestinal administration, with oral administration being preferred. Those skilled in the art can select appropriate formulations based on the route of administration; for example, for oral administration, conventional solid and liquid formulations can be prepared. In some specific embodiments, dosage forms include, but are not limited to: tablets, capsules, granules, pellets, liquid formulations, decoctions, suppositories, gels, aerosols, or patches. Attached Figure Description

[0025] Figure 1 The graph shows the effect of different concentrations of LDC000067 on the survival rate of A549 cells, as provided in the examples. "***" indicates a highly significant difference from the untreated control wells (Cell) (P<0.001). "LDC000067+Concentration" indicates the drug-treated wells.

[0026] Figure 2 The figure shows the inhibitory effect of different concentrations of LDC000067 on influenza virus proliferation in A549 cells, as provided in the examples. "***" indicates a highly significant difference from the virus group (P<0.001). "Mock" represents the uninfected group, and "ND" indicates not detected. "Virus" represents the virus group. "Virus+LDC000067" represents the test group.

[0027] Figure 3 The figure shows the inhibitory effect of different concentrations of LDC000067 on influenza virus mRNA synthesis in A549 cells, as provided in the examples. "***" indicates a highly significant difference from the virus group (P<0.001). "Mock" represents the uninfected group. "Virus" represents the virus group. "Virus+LDC000067" represents the test group.

[0028] Figure 4The figure provided in the example shows the results of Western blotting analysis of the inhibitory effect of different concentrations of LDC000067 on the synthesis of influenza virus NP protein in A549 cells. "IAV" represents influenza virus, "+" indicates infection with influenza virus, and "-" indicates no infection with influenza virus.

[0029] Figure 5 The figures show the weight change curves of mice in a lethal influenza infection model in mice at different concentrations of LDC000067, as provided in the examples. "Mock" represents the uninfected group, "IAV" represents the infected group, and "IAV+LDC00006720mg / kg / day" represents the test group.

[0030] Figure 6 The survival curves of mice in a lethal influenza infection model with different concentrations of LDC000067 provided in the examples are shown. "Mock" represents the uninfected group, "IAV" represents the infected group, and "IAV+LDC00006720mg / kg / day" represents the test group. Detailed Implementation

[0031] To make the objectives, technical solutions, and advantages of this application clearer, the following detailed description is provided in conjunction with embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the scope of this application. Reagents not specifically described in detail herein are all conventional reagents and are commercially available; methods not specifically described in detail are all conventional experimental methods and can be learned from the prior art.

[0032] Influenza viruses belong to the family Orthomyxoviridae, genus *Influenzavirus*. Based on the antigenic and genetic characteristics of their nucleoprotein (NP) and matrix protein (M), influenza viruses are classified into three types: A, B, and C, also known as types A, B, and C. The complete genome of type A influenza virus consists of eight single-stranded negative-sense RNAs of varying sizes, named segments 1 through 8. The viral genome is approximately 13.6 kb in length, encoding 10 structural proteins (PB2, PB1, PA, HA, NP, NA, M1, M2, PB1-F2, and NS2 / NEP) and a non-structural protein (NS1). Based on the differences in the viral particle surface glycoproteins hemagglutinin (HA) and neuraminidase (NA), type A influenza viruses can be further divided into 17 H (H1-H17) and 10 N (N1-N10) subtypes. Human influenza viruses are mainly of the H1, H2, and H3 subtypes. Currently, the most dangerous highly pathogenic avian influenza strains are H5, H7, and H9 subtypes, with H5N1 having the highest mortality rate. Type B influenza viruses often cause localized epidemics, not global pandemics, and have only been found in humans and seals. Type C influenza viruses mostly exist sporadically, primarily affecting infants and young children, generally not causing epidemics, but can infect humans and pigs. Since their discovery in the early 20th century, influenza viruses have caused five major pandemics globally, with an outbreak occurring approximately every ten years, resulting in enormous losses worldwide. Influenza epidemics cause 250,000 to 500,000 deaths and 3 million to 5 million severe cases annually, infecting approximately 5% to 15% of the global population. Influenza outbreaks place a huge burden on the global economy and seriously threaten human health. Although influenza can be prevented and treated with vaccines and existing antiviral drugs, the high variability of the influenza virus makes vaccines delayed, unable to prevent the spread of new strains, and rendering existing drugs ineffective against drug-resistant strains. Therefore, there is an urgent need to develop new antiviral drugs, especially antiviral drugs targeting new targets.

[0033] In this application, some test cases tested the inhibitory effect of LDC000067 on influenza virus proliferation in cells. Some test cases also tested the anti-influenza virus activity of LDC000067 in a mouse model of lethal influenza infection.

[0034] 1. Test materials

[0035] A549 cells: purchased from the American Type Culture Collection (ATCC);

[0036] Virus strain: Influenza A virus H1N1 subtype A / Puerto Rico / 8 / 1934, provided by the Virus Preservation Center of Wuhan Institute of Virology, Chinese Academy of Sciences.

[0037] Mice: SPF grade 6 to 8-week-old Balb / c mice, purchased from Guangdong Provincial Medical Laboratory Animal Center.

[0038] LDC000067 was purchased from Taoshu Biotechnology Co., Ltd. For cell experiments, the drug was dissolved in DMSO. For animal experiments, it was dissolved in 10% DMSO + 40% PEG300 + 5% Tween-80 + 45% physiological saline.

[0039] DMEM medium and fetal bovine serum (FBS) were purchased from GIBCO.

[0040] Cell The Luminescent cell proliferation assay kit was purchased from Promega.

[0041] The EnSpire multi-functional microplate reader was purchased from PerkinElmer.

[0042] The CO2 cell incubator was purchased from Thermo.

[0043] 2. LDC000067 showed no cytotoxicity.

[0044] (1) Cell Culture

[0045] After resuscitating frozen A549 cells and passaged twice, the cells were expanded into DMEM medium containing 10% fetal bovine serum and penicillin 100 U / mL and streptomycin 100 μg / mL, with a seeding density of at least 5 × 10⁶ cells / mL. 5 cell / mL, passage density not exceeding 2×10 6 cell / mL.

[0046] (2) Preparation of the test solution

[0047] Prepare a DMSO solution containing 10 mM LDC000067 as the test solution.

[0048] (3) Cytotoxicity test

[0049] Drug treatment wells: A549 cells at 2.5 × 10⁻⁶ 5Cells were seeded per well (100 μL) in 96-well cell culture plates. The test solution was diluted with fresh DMEM to create 10 concentration gradients, with 3 replicates for each gradient, resulting in final concentrations of 1.25 μM, 2.5 μM, 5 μM, 10 μM, 20 μM, 40 μM, and 80 μM. After 24 h of culture, the supernatant was discarded. 100 μL of phosphate-buffered saline (PBS) containing 30% Cell titer-glo reagent was added to the remaining cells, and the cells were incubated at room temperature for 10 min. The OD450 reading was measured using a Varioskan LUX microplate reader.

[0050] Untreated control wells: The difference from drug-treated wells is that no test solution was added.

[0051] Cell viability (%) = (OD450 of drug-treated wells / OD450 of untreated control wells) × 100%

[0052] like Figure 1 It can be seen that LDC000067 has no cytotoxicity to A549 cells.

[0053] 3. Virus proliferation inhibition test

[0054] (1) Preparation of virus-infected cell fluid

[0055] After resuscitating frozen A549 cells and passaged twice, the cells were expanded into DMEM medium containing 10% fetal bovine serum and penicillin 100 U / mL and streptomycin 100 μg / mL, with a seeding density of at least 5 × 10⁶ cells / mL. 5 cell / mL, passage density not exceeding 2×10 6 cell / mL.

[0056] Remove 2×10 6 The culture medium in A549 cell solution was washed twice with PBS, and then H1N1 PR8 virus diluted to 0.3 MOI (multiple of infection) with fresh DMEM was added for infection. The cells were incubated at 37°C for 1 h, the viral supernatant was discarded, and the cells were washed once with PBS to obtain the virus-infected cell solution.

[0057] (2) Group Test

[0058] The obtained H1N1 PR8 virus solutions were divided into a test group (Virus+LDC000067) and a virus group (Virus). Additionally, using the aforementioned 2×10... 6A549 cell suspension at a concentration of [cells / mL] was used as the control cell group (Mock), without virus inoculation or LDC000067 treatment. The test groups were diluted with fresh DMEM and added to the virus suspension to final concentrations of 0.15 μM, 0.3 μM, and 0.6 μM of LDC000067, respectively. Neither the virus group nor the control cell group underwent LDC000067 treatment. The virus suspension or cell suspension in each group was cultured for 24 hours, after which the culture was terminated and samples were collected.

[0059] Virus titer assay: Sample solutions from each group were repeatedly freeze-thawed at -80℃ and 4℃ to ensure complete cell lysis, releasing all intracellular virus into the cell supernatant. The supernatant from each well was then collected. The freeze-thawed samples were placed on ice and serially diluted 10-fold eight times with fresh DMEM. A549 cells were removed and washed with PBS. The diluted samples were seeded at 100 μL / well, one column per dilution. Each group was seeded with virus-free maintenance medium as a negative control and cultured further. After 2 hours, the cells were washed twice with PBS, replaced with blank maintenance medium, and cultured again. After 72 hours, cytopathic effects were recorded, and the virus titer (TCID50 value) was calculated. Figure 2 As shown, LDC000067 significantly inhibited the proliferation of influenza virus in A549 cells within a concentration range of 5–20 μM, and exhibited a good dose-response relationship.

[0060] qRT-PCR detection: Cell plates were repeatedly freeze-thawed three times at -80℃ and 4℃ to ensure complete cell lysis, releasing all intracellular virus into the cell supernatant. The supernatant from each well was then collected. Total RNA was extracted from the collected cell supernatant using the recommended procedure of the Total RNA Rapid Extraction Kit (Shanghai Feijie Biotechnology Co., Ltd.). Immediately after RNA extraction, reverse transcription was performed. Using cDNA as a template and GAPDH as an internal reference gene, Real-Time PCR was used to detect the copy number of the influenza virus NP gene. A normal control group was used as a reference to evaluate changes in NP mRNA.

[0061] Among them, the upstream and downstream primer sequences of the influenza virus NP gene are:

[0062] NSP9-F:AGCATTGTTTCCAACTCCTTT, SEQ ID NO.1

[0063] NSP9-R:GACGATGCAACGGGCTGGTCTG, SEQ ID NO.2

[0064] GAPDH gene upstream and downstream primer sequences:

[0065] GAPDH-F:TGGGGAAGGTGAAGGTCG, SEQ ID NO.3

[0066] GAPDH-R:TAAAAGCAGCCCTGGTGACC, SEQ ID NO.4.

[0067] like Figure 3 It can be seen that LDC000067 has a significant inhibitory effect on influenza virus mRNA synthesis in A459 cells within the concentration range of 5-20 μM, and exhibits a good dose-response relationship.

[0068] Western Blot Analysis: Each sample solution was placed on ice, and 100 μL of RIPA lysis buffer was added per well. After pipetting, the liquid was transferred to a centrifuge tube and centrifuged at 12,000 rpm for 10 minutes. The supernatant was then transferred to another clean tube for later use. After determining the protein concentration of each sample using the BCA method, Western blotting was used to detect the bands of the influenza virus NP protein and the internal reference protein GAPDH. All reagents used in the experiment were purchased from Shanghai Beyotime Biotechnology Co., Ltd. Figure 4 It can be seen that LDC000067 has a significant inhibitory effect on the synthesis of influenza virus NP protein in A549 cells within the concentration range of 5-10 μM, and shows a good dose-response relationship.

[0069] 4. Anti-influenza virus activity test in a mouse model of lethal influenza infection

[0070] (1) Grouping

[0071] Six- to eight-week-old BALB / c mice were randomly divided into an uninfected group (Mock), an infected group (IAV), and a test group (IAV+LDC000067), with 10 mice in each group.

[0072] (2) Test sample

[0073] Prepare a DMSO solution containing 10 mM LDC000067 as the test solution.

[0074] (3) Group administration

[0075] Test group: Mice were allowed to acclimatize to the environment for 2-3 days before the formal experiment. On the day of challenge, mice were lightly anesthetized with isoflurane and then infected with 30 μL of 2LD50 H1N1 mouse lung-adapted virus solution via nasal drop using a pipette. After infection, the mice were given the test sample intraperitoneally at a dose of 20 mg / kg / day for 4 consecutive days.

[0076] Infection group: Mice were infected in the same manner as the test group, and after infection with the virus, they were given the same volume of solvent (containing 10% DMSO, 40% PEG300, 5% Tween-80 and 45% physiological saline) via intraperitoneal injection for 4 days.

[0077] Uninfected mice were left untreated.

[0078] (4) Weight and survival rate test

[0079] The weight of each group of animals was measured daily at regular intervals to observe the survival status of the mice. Bedding, water, and food were changed and added regularly, and dead mice were removed promptly until the experiment was completed. Based on the statistical results, weight change curves and survival rate curves were plotted.

[0080] like Figure 5 It can be seen that, compared with the infection group, the average weight of mice in the test group treated with LDC000067 did not decrease significantly.

[0081] like Figure 6 The mortality rate in the infected group was 80% (8 / 10) on day 21 post-infection, while the mortality rate in the test group was 60% (6 / 10) on day 21 post-infection. This indicates that LDC000067 has significant anti-influenza virus activity in mice.

[0082] In summary, the results show that LDC000067 has good anti-influenza virus activity in A549 cells and can be used to develop drugs for the treatment of influenza virus infection, with broad application prospects.

[0083] The above description is merely a preferred embodiment of this application, but the scope of protection of this application is not limited thereto. Any variations or substitutions that can be easily conceived by those skilled in the art within the scope of the technology disclosed in this application should be included within the scope of protection of this application.

Claims

1. The application of LDC000067 in the preparation of anti-influenza virus drugs, characterized in that, The influenza virus in question is the H1N1 subtype of influenza A virus.

2. The application according to claim 1, characterized in that, The application is selected from: To avoid or reduce the infection rate of influenza virus; Inhibit the growth of influenza virus; Inhibit the proliferation of influenza virus; Inhibit influenza virus RNA synthesis; Inhibit the synthesis of influenza virus NP protein; At least one of them.

3. The application according to claim 1, characterized in that, LDC000067 at a concentration of not less than 5 μM inhibits the proliferation of influenza virus.

4. The application according to claim 1, characterized in that, LDC000067 at a concentration of not less than 5 μM inhibits influenza virus mRNA synthesis.

5. The application according to claim 1, characterized in that, LDC000067 at a concentration of not less than 5 μM inhibits the synthesis of influenza virus NP protein.

Images