Arthrobacter oligosporus genetically engineered strain with antibacterial activity, construction method and application thereof

Abstract

The present application provides a genetically engineered Scedosporium minutum strain with antibacterial activity, belonging to the technical field of microbial genetic engineering. The genetically engineered strain is obtained by knocking out the AoSkn7 gene in the genome of Scedosporium minutum. The genetically engineered Scedosporium minutum strain has antibacterial activity and can be used to eliminate the inhibition of Bacillus amyloliquefaciens on Scedosporium minutum. The present application also provides a construction method and application of the genetically engineered Scedosporium minutum strain with antibacterial activity.

Description

Technical Field

[0001] This invention belongs to the field of microbial genetic engineering technology, and specifically relates to a oligosporous Aranea spp. genetically engineered strain with antibacterial activity, its construction method, and its application. Background Technology

[0002] Nematodes, especially plant-parasitic nematodes, are major plant pathogens and a leading cause of plant diseases worldwide. There are hundreds of species of plant-pathogenic nematodes, and their sheer numbers cause severe economic losses globally, amounting to tens of billions of US dollars annually. For decades, the control of plant-pathogenic nematodes has primarily relied on chemical methods, with chemical pesticides accounting for over 90% of all commercial insecticides on the market. Because the damage caused by chemical pesticides to the environment and many organisms, including nematodes, is irreversible, the research and development of biological nematicides has become a crucial issue that must be addressed for the sustainable development of modern agriculture.

[0003] Arthrobotrys oligospora is a model strain for studying the interaction between nematode-preying fungi and nematodes. In the presence of nematodes and other inducing factors, the vegetative hyphae of Arthrobotrys oligospora develop specialized predatory organs, namely a three-dimensional sticky fungal web, which then traps and kills nematodes. This is a crucial step in the control of nematode diseases. However, the growth of Arthrobotrys oligospora in soil is inhibited by some soil bacteria, such as Bacillus amyloliquefaciens. Therefore, overcoming this interspecies inhibition is essential for the control of nematode diseases. Summary of the Invention

[0004] To address the aforementioned technical problems, this invention provides a genetically engineered strain of Oligosporium with antibacterial activity. By knocking out the Oligosporium AoSkn7 (AOL_s00097g218) gene through genetic engineering, the obtained Oligosporium genetically engineered strain exhibits antibacterial activity and can be used to relieve the inhibition of Oligosporium by Bacillus amyloliquefaciens in the soil, providing a basis for the biological control of nematodes.

[0005] The present invention also provides a method for constructing and applying a genetically engineered strain of Oligosporium nobile with antibacterial activity.

[0006] This invention is achieved through the following technical solution: This invention provides a genetically engineered strain of Oligosporium nobile with antibacterial activity. The genetically engineered strain is based on Oligosporium nobile and is obtained by knocking out the AoSkn7 (i.e., AOL_s00097g218) gene in the Oligosporium nobile genome.

[0007] Furthermore, the originating strain was obtained from the American Standard Biological Collection Center (ATCC), strain number: ATCC24927.

[0008] Based on the same inventive concept, this invention provides a method for constructing a genetically engineered strain of *Armillaria oliguria* with antibacterial activity, the method comprising: Using the genome of Oligosporium argentea as a template, AoSkn7-5f / AoSkn7-5r primers were used to amplify the 5' homologous arm of the AoSkn7 gene by PCR, and AoSkn7-3f / AoSkn7-3r primers were used to amplify the 3' homologous arm of the AoSkn7 gene by PCR. The 5' homologous arm, the hygromycin resistance gene fragment, and the 3' homologous arm were ligated into the linear vector pCE-zero-2 using DNA ligase to obtain the AoSkn7 gene knockout vector. The AoSkn7 gene knockout vector was transferred into host bacteria for culture, positive colonies were screened, plasmids of positive colonies were extracted, and the knockout fragment was amplified by PCR to verify the positive clones. Using positive colony plasmids as templates, PCR was performed with AoSkn7-5f / AoSkn7-3r primers to prepare the knockout fragment. The knockout fragment was transformed into oligosporus protoplasts to obtain oligosporus genetically engineered strains.

[0009] Furthermore, the nucleotide sequence of AoSkn7-5f is shown in SEQ ID NO.1, the nucleotide sequence of AoSkn7-5r is shown in SEQ ID NO.2, the nucleotide sequence of AoSkn7-3f is shown in SEQ ID NO.3, and the nucleotide sequence of AoSkn7-3r is shown in SEQ ID NO.4.

[0010] Furthermore, the primers used for PCR amplification of the hygromycin resistance gene fragment include hphF and hphR, the nucleotide sequence of hphF is shown in SEQ ID NO.5, and the nucleotide sequence of hphR is shown in SEQ ID NO.6.

[0011] Furthermore, the Oligosporium argentis is from the American Center for Standard Biological Collections (ATCC), strain number: ATCC24927.

[0012] Furthermore, the host bacteria includes Escherichia coli DH5α.

[0013] Based on the same inventive concept, this invention also provides the application of genetically engineered strains of Oligosporium with antibacterial activity in relieving the inhibition of Oligosporium by Bacillus amyloliquefaciens in soil.

[0014] One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages: The present invention relates to a genetically engineered strain of Oligosporium with antibacterial activity. By knocking out the AoSkn7 gene of Oligosporium through genetic engineering technology, the obtained Oligosporium genetically engineered strain has antibacterial activity, which can relieve the inhibition of Oligosporium by Bacillus amyloliquefaciens in the soil, and the antibacterial activity is strong, with a maximum inhibition zone of up to 17 mm. Attached Figure Description

[0015] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0016] Figure 1 PCR validation pattern of AoSkn7 gene transformants.

[0017] Figure 2 The image shows the antibacterial activity of the genetically engineered strain AoSkn7 before and after gene knockout. Detailed Implementation

[0018] The present invention will be described in detail below with reference to specific embodiments and examples, thereby making the advantages and various effects of the present invention more clearly apparent. Those skilled in the art should understand that these specific embodiments and examples are for illustrative purposes only and are not intended to limit the present invention.

[0019] Throughout this specification, unless otherwise specified, the terminology used herein should be understood as having the meaning commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. In the event of any conflict, this specification shall prevail.

[0020] Unless otherwise specified, all raw materials, reagents, instruments and equipment used in this invention can be purchased from the market or prepared by existing methods.

[0021] The following will provide a detailed description of the oligosporous Araneae strain with antibacterial activity, its construction method, and its application, in conjunction with embodiments and experimental data.

[0022] Example 1 Construction of Oligosporium Araneae Genetically Engineered Strains 1. Culture medium preparation and uses LB solid medium: NaCl 10g, tryptone 10g, yeast extract 5g, agar 15g, ddH2O to a final volume of 1000mL; LB liquid medium: NaCl 10g, tryptone 10g, yeast extract 5g, ddH2O to a final volume of 1000mL; PDA medium: 200g potato, 20g glucose, 15g agar, ddH2O to a final volume of 1000mL; CMY medium: 20g corn, 2g yeast extract, 15g agar, ddH2O to a final volume of 1000mL; TG medium: 10g tryptone, 10g glucose, ddH2O to a final volume of 1000mL; ssPDA medium: 0.3g peptone, 0.3g tryptone, 0.3g yeast extract, 200g sucrose, 7.5g agar, and ddH2O to a final volume of 1000mL.

[0023] LB solid medium is used for the purification and culture of Bacillus amyloliquefaciens, LB liquid medium is used for the small-scale fermentation of Bacillus amyloliquefaciens, ssPDA medium is used for protoplast regeneration, TG medium is used for liquid culture of fungi, CMY medium is used for solid culture of fungi, and PDA medium is used to determine the inhibitory effect of fungi on bacteria and to screen for genetically engineered strains of AoSkn7 knockout.

[0024] 2. Test fungi This embodiment uses Oligosporium argentis (… Arthrobotrys oligospora The wild type (purchased from the American Standard Biological Collection Center (ATCC), strain number: ATCC24927) was the starting strain.

[0025] 3. Construction of genetically engineered strains This embodiment uses homologous recombination to knock out the AoSkn7 gene. The specific steps are as follows: (1) Material preparation: Oligosporium genomic DNA, used to obtain the target gene and upstream and downstream fragments; pCSN44 plasmid used to amplify the hygromycin resistance gene; pCE-zero-2 plasmid digested with ECORV, used to ligate the knockout vector fragment and construct the knockout vector; Escherichia coli DH5α, used for transformation.

[0026] (2) Primer design: obtained from the NCBI database AoSkn7The gene sequence was used for primer design. Approximately 2kb flanking sequences (5' homologous arms) were selected upstream and downstream of the gene for primers (3' homologous arms). Primers were also designed to screen for the hygromycin resistance gene. All primers were synthesized by Beijing Qingke Biotechnology Co., Ltd. The specific primer sequences are as follows: Primers for amplifying the 5' end 2020bp fragment of the AoSkn7 gene AoSkn7-5f:5'- aattcggatcttccagagatatcTGTCTGTGAGGGTGTGTG -3' AoSkn7-5r:5'- atccttctttGCTAGGGTGGAATTCCCAC -3' Primers for amplifying the 2238 bp fragment at the 3' end of the AoSkn7 gene AoSkn7-3f:5'-tcatcttctgGCTGGTGGAGGATGATCC -3' AoSkn7-3r:5'-ttcaactgccgttcgacgatatcGAAGAAGACGACGAAGGC -3' Primers for amplifying the hygromycin resistance gene fragment hphF:5'-ccaccctagcAAAGAAGGATTACCTCTAAAC-3' hphR:5'- ctccaccagcCAGAAGATGATATTGAAGGAG- 3' Primers used for PCR verification of gene knockout AoSkn7-F:CGAAGCCGCTTAGTACGAC AoSkn7-R:CGATGTCATGGCGATAACAGGAGG (3) In vitro amplification of fragments: Using the genome of *Ardisia oligospora* ATCC24927 as a template, flanking sequences were amplified using high-fidelity PCR enzyme. The reaction volume was 25 μL, with 20-100 ng of genome. Primers AoSkn7-5f / AoSkn7-5r were used to amplify the upstream sequence of the gene, and primers AoSkn7-3f / AoSkn7-3r were used to amplify the downstream sequence of the gene. Using PCSN44 plasmid DNA as a template, the hph fragment was amplified using high-fidelity PCR enzyme. The reaction volume was 25 μL, with 12-40 ng of plasmid. Primers hphF / hphR were used to amplify the hph fragment. The PCR program is as follows: Pre-denaturation: 95℃ for 3 min; denaturation: 95℃ for 15 s, 56-68℃ for 15 s, 72℃ for 30-60 s / kb, 30-35 cycles; 72℃ for 5-10 min; 12℃ for 10 min. Take 2 μL of each for 1% agarose gel electrophoresis. Store the remaining product at -20℃.

[0027] (4) Ligation of amplified fragments: The 5' homologous arm, hygromycin resistance gene fragment, and 3' homologous arm were ligated to the linear vector pCE-zero-2, which had been digested with ECORV restriction endonucleases, using C115 ligase 2×clon ExPress mix. The reaction mixture consisted of 10 μL of 2×clon ExPress mix and 5 μL of 2×clon ExPress mix. The amount of vector used was [0.02 × the number of base pairs] ng, and the amount of each fragment used was [0.02 × the number of base pairs of each fragment] ng. Note that the sample volume of each component should be ≥1 μL. PCR program: 50℃, 15 min.

[0028] (5) Heat shock transformation of Escherichia coli: Take competent cells (Escherichia coli DH5α) from the -80℃ freezer and thaw them slowly on ice; take 5 μL of the ligated plasmid recombinant product and vortex it into 50 μL of competent cells, and incubate on ice for 30 min; heat shock at 42℃ for 75-90 s; immediately place on ice for 2-3 min; perform the operation in a clean bench and add 500 μL of LB medium; incubate at 37℃ and 200 rpm for 1-2 h, and then revive; after revival, centrifuge at 5000 rpm for 5 min; remove part of the supernatant, gently suspend the remaining precipitate, and spread it on LB plates containing antibiotics; incubate at 37℃ for 12-16 h; then pick single colonies for culture and extract plasmids.

[0029] (6) Verification of recombinant products: PCR verification was performed using primers AoSkn7-5F / AoSkn7-3R. At the same time, the plasmid was verified by enzyme digestion. If the band size was correct, it was stored at -20℃.

[0030] (7) Recovery of full-length knockout vector fragment: Amplify the full length using primers AoSkn7-5F / AoSkn7-3R, and recover the DNA fragment using a gel recovery kit.

[0031] (8) Preparation of Oligosporium ATCC24927 protoplasts: Oligosporium ATCC24927 plates synchronized for 5 days on CMY medium were inoculated into 200 ml of TG medium and cultured overnight at 28°C and 180 rpm. Hyphae were collected by filtration through 6 layers of lens paper and washed with MN Buffer. The hyphae were picked into enzyme solution and digested at 28°C and 110 rpm for 4 h. The transparent spherical protoplasts were observed under a microscope. The protoplasts were collected by filtration through 6 layers of lens paper and placed into 1.5 ml sterile EP tubes. The tubes were centrifuged at 5000 rpm for 5 min, the supernatant was discarded, and 1 mL of STC Buffer was added to wash the protoplasts. The tubes were centrifuged at 5000 rpm for 5 min and the supernatant was discarded. The protoplasts were resuspended in 100 μL of STC Buffer and their concentration was examined under a microscope.

[0032] (9) Transformation of Oligosporium argentea protoplasts: Add 10 μL of the knockout fragment purified and recovered in step (7) to 100 μL of protoplasts and incubate on ice for 30 min. Add 1 mL of PTC buffer and incubate at 28 °C for 1-2 h. After spotting the above mixture onto a blank plate, pour in ssPDA+Amp+Kana medium at a suitable temperature and seal the plate. Incubate at 28 °C for 3 days. After 3 days, pour in a second layer of PDA medium with a concentration of 1 / 1000 hygromycin and incubate at 28 °C for 6-7 days.

[0033] (10) Validation of knockout transformants: Transformants were selected and cultured in PDA plates containing hygromycin. They were then transferred to PDA medium, and mycelia were scraped to extract the genome. Using this genome as a template and AoSkn7-F / AoSkn7-R as primers, the full-length target gene fragment and the knockout fragment were amplified by PCR. The results are as follows: Figure 1 As shown, the fragment size was consistent with the prediction after electrophoresis comparison, thus confirming that the knockout was successful.

[0034] The full-length AoSkn7 gene is 1772 bp, and the knockout fragment is 2631 bp. Figure 1 In the text, "+" represents a positive control, "-" represents a negative control, and S55, S56, S61, S64, and S65 represent AoSkn7 knockout strains.

[0035] Example 2 Determination of antibacterial activity of oligosporous Arthropoda genetically engineered strains 1. Test bacteria The bacteria tested in this embodiment were Bacillus amyloliquefaciens (Bacillus amyloliquefaciens). Bacillus amyloliquefaciens (), preserved in the strain bank of the State Key Laboratory of Yunnan Biological Resources Conservation and Utilization, Yunnan University.

[0036] 2. Activation and small-scale fermentation of Bacillus amyloliquefaciens For LB solid culture, Bacillus amyloliquefaciens, frozen and stored at -80°C, was taken into 90 mm diameter Petri dishes. After thawing, 100 μL of the bacterial culture was added to an LB plate and incubated overnight at 37°C. After the culture had grown, single colonies were streaked with an inoculation loop and incubated overnight at 37°C. Once single colonies had grown, they were picked up with a sterilized pipette tip and inoculated into LB liquid medium, then incubated overnight at 37°C and 180 rpm for later use.

[0037] 3. Determination of antibacterial activity of genetically engineered strains In a clean bench, 100 μL of cultured bacteria (Bacillus amyloliquefaciens) were transferred to PDA medium and spread evenly. Using a 7 mm punch, bacterial blocks of wild-type and genetically engineered *Arthrobacter oligosporus* strains were obtained from CMY medium and inoculated onto the spread bacteria on the PDA medium. After culturing for 2-3 days, the presence and size of inhibition zones were observed and measured. The experiment was repeated 6 times. Results are as follows: Figure 2 As shown, Figure 2 In the middle section, I represents the wild-type strain of Oligosporium nobile, and II represents the genetically engineered strain of Oligosporium nobile.

[0038] In this embodiment, *Bacillus amyloliquefaciens* was used as the test bacterium to determine its antibacterial activity. Figure 2 It can be seen that the Oligosporium argentis AoSkn7 knockout strain has a significant inhibitory effect on Bacillus amyloliquefaciens, with an inhibition zone of up to 1.7 cm, while the Oligosporium argentis wild-type strain has no obvious inhibitory effect on Bacillus amyloliquefaciens.

[0039] Finally, it should be noted that the terms “comprising,” “including,” or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such process, method, article, or apparatus.

[0040] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including both the preferred embodiments and all changes and modifications falling within the scope of the invention.

[0041] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. A genetically engineered strain of *Arthropoda oligospora* with antibacterial activity, wherein the genetically engineered strain is *Arthropoda oligospora* (… Arthrobotrys oligospora The starting strain is characterized by, The genetically engineered strain was obtained by knocking out the AoSkn7 gene in the genome of Oligosporium nobile.

2. The oligosporous Araneae strain with antibacterial activity according to claim 1, characterized in that, The starting strain was obtained from the American Standard Biological Collection Center (ATCC), strain number: ATCC24927.

3. The method for constructing a oligosporous Araneae strain with antibacterial activity as described in claim 1 or 2, characterized in that, The construction method includes: Using the genome of Oligosporium argentea as a template, AoSkn7-5f / AoSkn7-5r primers were used to amplify the 5' homologous arm of the AoSkn7 gene by PCR, and AoSkn7-3f / AoSkn7-3r primers were used to amplify the 3' homologous arm of the AoSkn7 gene by PCR. The 5' homologous arm, the hygromycin resistance gene fragment, and the 3' homologous arm were ligated into the linear vector pCE-zero-2 using DNA ligase to obtain the AoSkn7 gene knockout vector. The AoSkn7 gene knockout vector was transferred into host bacteria for culture, positive colonies were screened, plasmids of positive colonies were extracted, and the knockout fragment was amplified by PCR to verify the positive clones. Using positive colony plasmids as templates, PCR was performed with AoSkn7-5f / AoSkn7-3r primers to prepare the knockout fragment. The knockout fragment was transformed into oligosporus protoplasts to obtain oligosporus genetically engineered strains.

4. The method for constructing a oligosporous Araneae strain with antibacterial activity according to claim 3, characterized in that, The nucleotide sequence of AoSkn7-5f is shown in SEQ ID NO.1; the nucleotide sequence of AoSkn7-5r is shown in SEQ ID NO.2; the nucleotide sequence of AoSkn7-3f is shown in SEQ ID NO.3; and the nucleotide sequence of AoSkn7-3r is shown in SEQ ID NO.

4.

5. The method for constructing a oligosporous Araneae strain with antibacterial activity according to claim 3, characterized in that, The primers used for PCR amplification of the hygromycin resistance gene fragment include hphF and hphR, the nucleotide sequence of hphF is shown in SEQ ID NO.5, and the nucleotide sequence of hphR is shown in SEQ ID NO.

6.

6. The method for constructing a oligosporous Araneae strain with antibacterial activity according to claim 3, characterized in that, The Oligosporium argentis species was obtained from the American Standard Biological Collection Center (ATCC), strain number: ATCC24927.

7. The method for constructing a oligosporous Araneae strain with antibacterial activity according to claim 3, characterized in that, The host bacteria include Escherichia coli DH5α.

8. The application of the oligosporus arbuscularis genetically engineered strain with antibacterial activity as described in claim 1 or 2 in relieving the inhibition of oligosporus arbuscularis by Bacillus amyloliquefaciens in soil.

Images