Application of BnaA07.ST1 gene in improving salt tolerance of brassica napus

Abstract

The application relates to application of a BnaCnng10710D gene in improving the salt resistance of Brassica napus. The BnaCnng10710D gene is located on an A07 chromosome in the Brassica napus Westar, belongs to a Glycine-rich protein family (GRP) member, and is named as BnaA07.ST1. An overexpression vector pCAMBIA1305-BnaA07.ST1 of the gene is constructed, and the genetic transformation is realized by means of an agrobacterium mediation, so that the salt resistance of the Brassica napus is improved, and the application has great application potential and prospect, and provides an ideal way for cultivating a new salt-resistant Brassica napus variety.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, specifically relating to the application of the BnaA07.ST1 gene in improving the salt tolerance of Brassica napus. Background Technology

[0002] Soil salinization is one of the main factors limiting crop production. The improvement of saline-alkali land mainly involves physical, chemical, and biological methods. Among these, biological measures, primarily vegetation restoration, are widely considered the most economical and effective approach.

[0003] Rapeseed has multi-functional applications. Besides traditional uses for oil and rapeseed cake as feed / fertilizer, fresh rapeseed can also be used as feed, fertilizer, vegetable (rapeseed flower stalks), for honey production, and for tourism during its flowering period. Practice shows that rapeseed has a high tolerance for saline-alkali soils. Whether in coastal saline-alkali lands dominated by sodium chloride, inland saline-alkali lands dominated by sodium sulfate and sodium carbonate, or even soda saline-alkali lands dominated by sodium carbonate and sodium bicarbonate—which are considered the most difficult to improve—rapeseed exhibits good bioremediation effects.

[0004] Transgenic technology, as a rapid and effective method for genetic improvement of rapeseed, has brought enormous development potential to rapeseed genetic breeding. Currently, however, there are no reports on the number of members, gene and CDS sequences, relationship with salt tolerance, and applications of the BnaA07.ST1 gene in Brassica napus. Summary of the Invention

[0005] The purpose of this invention is to provide a BnaA07.ST1 gene from Brassica napus and the application of its overexpression in plants. This invention utilizes Agrobacterium-mediated genetic transformation to obtain transgenic material using Brassica napus Westar as the recipient. Studies have shown that overexpression of the BnaA07.ST1 gene from Brassica napus can improve the salt tolerance of Brassica napus. Therefore, the BnaA07.ST1 gene from Brassica napus can be applied to rapeseed breeding to improve the salt tolerance of Brassica napus, providing an ideal approach for cultivating new salt-tolerant Brassica napus varieties.

[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0007] One of the objectives of this invention is to provide the application of the BnaA07.ST1 gene in improving plant salt tolerance, wherein the amino acid sequence encoded by the BnaA07.ST1 gene is shown in SEQ ID NO:3.

[0008] Furthermore, the nucleotide sequence of the BnaA07.ST1 gene is shown in SEQ ID NO:1, and the CDS sequence of the BnaA07.ST1 gene is shown in SEQ ID NO:2.

[0009] Furthermore, the plants include plants of the genus Brassica in the family Brassicaceae.

[0010] Furthermore, the plant includes rapeseed (Brassica napus).

[0011] A second objective of this invention is to provide a method for improving the salt tolerance of plants, comprising introducing the BnaA07.ST1 gene or an expression vector encoding it into plant cells, wherein the amino acid sequence of the BnaA07.ST1 gene is shown in SEQ ID NO:3.

[0012] Furthermore, the plants include plants of the genus Brassica in the family Brassicaceae.

[0013] Furthermore, the plant includes rapeseed (Brassica napus).

[0014] Furthermore, the expression vector includes pCAMBIA1305.

[0015] A third objective of this invention is to provide the application of the BnaA07.ST1 gene or an overexpression vector containing the BnaA07.ST1 gene in the cultivation of transgenic plants tolerant to salt stress, wherein the amino acid sequence encoded by the BnaA07.ST1 gene is shown in SEQ ID NO:3.

[0016] Furthermore, the overexpression vector containing the BnaA07.ST1 gene includes pCAMBIA1305, and the plant includes Brassica napus.

[0017] Beneficial effects

[0018] Brassica napus is an important economic crop. Studies have found that overexpression of the BnaA07.ST1 gene can improve the salt tolerance of Brassica napus. Therefore, applying the BnaA07.ST1 gene to rapeseed breeding to improve its salt tolerance has great application potential and prospects, providing an ideal approach for breeding new salt-tolerant Brassica napus varieties. Attached Figure Description

[0019] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0020] Figure 1Gel image of the BnaA07.ST1 gene cloned from Brassica napus cDNA. Labeling: DNA Marker band sizes (from top to bottom: 2000bp, 1500bp, 1000bp, 750bp, 500bp, 250bp, 100bp).

[0021] Figure 2 : A gel image showing positive identification after pCAMBIA1305-BnaA07.ST1 was transformed into E. coli DH5α following homologous recombination. Labeling: DNA Marker band sizes (from top to bottom: 2000bp, 1500bp, 1000bp, 750bp, 500bp, 250bp, 100bp).

[0022] Figure 3 : A gel image showing positive identification after transforming the plasmid containing pCAMBIA1305-BnaA07.ST1 into Agrobacterium GV3101. Labeling: DNA Marker band sizes (from top to bottom: 2000bp, 1500bp, 1000bp, 750bp, 500bp, 250bp, 100bp).

[0023] Figure 4 Image of the pCAMBIA1305-BnaA07.ST1 overexpression plasmid vector. Figure label explanation: The vector backbone is pCAMBIA1305, its resistance in bacteria is kanamycin, the transgenic plants are hygromycin-resistant, and the target gene BnaA07.ST1 is driven by the constitutive promoter 35S.

[0024] Figure 5 : Gel image of PCR positive test results for transgenic material. Labeling explanation: Lane M represents the marker (from top to bottom: 2000bp, 1500bp, 1000bp, 750bp, 500bp, 250bp, 100bp).

[0025] Figure 6 The structure, target location, and triple mutant editing of the BnaA07.ST1 gene and its homologs.

[0026] Figure 7 Temporal expression pattern of BnaA07.ST1 gene under salt stress.

[0027] Figure 8 qRT-PCR detection of BnaA07.ST1 transgenic material.

[0028] Figure 9Phenotypic characteristics of wild-type, overexpression, and triple mutant materials under 7 days of salt stress treatment under hydroponic conditions. Scale bar in figure is 4cm.

[0029] Figure 10 Phenotypes of wild-type, overexpression, and triple mutant materials under salt stress under soil culture conditions. Scale bar in figure is 4cm.

[0030] Figure 11 : Relative growth (RGY), absolute growth rate (AGR), and relative growth rate (RGR) of wild-type and triple mutant materials under 7 days of salt stress under hydroponic conditions. Detailed Implementation

[0031] The embodiments of the technical solution of the present invention will be described in detail below with reference to the accompanying drawings. The following embodiments are only used to more clearly illustrate the technical solution of the present invention, and are therefore merely examples and should not be used to limit the scope of protection of the present invention. It should be noted that, unless otherwise stated, the technical or scientific terms used in this application should have the ordinary meaning understood by those skilled in the art. As a professional agricultural research institution, the applicant has long preserved relevant germplasm materials, and the relevant rapeseed varieties are all publicly available in the market or in existing germplasm banks.

[0032] Unless otherwise specified, the reagents, methods, and equipment used in this invention are conventional reagents, methods, and equipment in this technical field. Unless otherwise specified, the reagents and materials used in the following examples are all commercially available.

[0033] Example 1: Cloning and overexpression vector construction of the BnaA07.ST1 gene and expression analysis under salt stress.

[0034] 1. RNA extraction and cDNA acquisition

[0035] Westar seedlings were treated with 0 mM NaCl and 150 mM NaCl for 0 h, 1 h, 4 h, 8 h, 12 h, 24 h, and 7 days after germination, with three seedlings per biological replicate. RNA was extracted using a kit (Promega), and cDNA was synthesized using 3 μg of RNA as a template (Thermo Fisher). Each cDNA sample was diluted to 500 μL and stored at -20 °C for later use.

[0036] 2. Using cDNA as a template and pCAMBIA1305 vector plasmid as a backbone, PCR amplification was performed using the following primers to construct the BnaA07 overexpression vector pCAMBIA1305-BnaA07.ST1:

[0037] pCAMBIA1305-BnaA07.ST1-F:gagctcggtacccggggatccATGGCTTCAAAGACTTTGATTATGC;

[0038] pCAMBIA1305-BnaA07.ST1-R: cttgcatgcctgcaggtcgacGTTGCCAGGCTGAG TCTGAACA (SEQ ID NO: 4-5).

[0039] The PCR reaction conditions were as follows: 98℃ pre-denaturation for 3 min; 34 cycles of 98℃ for 10 sec, 56℃ for 30 sec, and 72℃ for 15 sec; extension at 72℃ for 5 min. The PCR products were recovered using a purification and recovery kit (Tiangen) and ligated into the pCAMBIA1305 vector using homologous recombination (homogeneous recombinase purchased from Novizan) at 37℃ for 30 min. The restriction enzyme sites of pCAMBIA1305 were F: BamHI and R: SalⅠ. Digestion with Thermo Fisher Scientific restriction endonucleases was performed at 37℃, followed by purification and recovery using a purification and recovery kit (Tiangen).

[0040] 3. The recombinant plasmid was transformed into DH5α (Qingke Biotechnology) using the heat shock transformation method. After 10-12 hours, single clones were picked for PCR positive detection and sent to Qingke Biotechnology for sequencing. The sequencing primers are as follows:

[0041] pCAMBIA1305-BnaA07.ST1-F:

[0042] gagctcggtacccggggatccATGGCTTCAAAGACTTTGATTATGC(SEQ ID NO:4)

[0043] 1305-R: GCTGGTGACCTCACTTATCGTCATC (SEQ ID NO: 6)

[0044] By comparing the sequencing results with the Westar reference genome, its coding sequence was determined as shown in SEQ ID NO:2, and the protein sequence encoded by the gene was shown in SEQ ID NO:3.

[0045] 4. Expression pattern analysis of BnaA07.ST1 gene under salt stress

[0046] Using the diluted cDNA obtained in step A as a template, design primers:

[0047] Qpcr-A07-F:GGAAATGAAGGTTACAACGGAC

[0048] Qpcr-A07-R:GTTATATCCTCCACCTCCCTTG(SEQ ID NO:7-8)

[0049] And primer BnaActin-F: CTATCCTCCGTCTCGATCTCGC

[0050] BnaActin-R: CTTAGCCGTCTCCAGCTCTTGC (SEQ ID NO:9-10)

[0051] It was used as an internal reference primer for relative quantitative analysis.

[0052] The results are as follows Figure 6 As shown, the expression level of the BnaA07.ST1 gene is significantly increased under salt stress, indicating that it can respond to salt stress.

[0053] Example 2: Transformation of the BnaA07.ST1 gene and screening and identification of positive plants

[0054] The test material was Brassica napus Westar.

[0055] The specific steps are as follows:

[0056] (1) Westar sterilizes rapeseed seeds with 0.1% mercuric chloride solution for 10-12 minutes, then rinses the seeds with sterile water 3-4 times, and then sows the seeds in MO medium and incubates them in the dark for 7 days.

[0057] (2) On the evening of the 6th day, Agrobacterium GV3101 containing pCAMBIA1305-BnaA07.ST1, which was stored at -80℃, was taken out and inoculated into 50 mL of LB medium containing kanamycin and gentamicin. The medium was then placed in a shaker at 28℃ and incubated overnight at 200 rpm. The colonies were collected and suspended in acetylsuccinone (AS) as a suspension.

[0058] (3) Cut the hypocotyl of the dark-cultured Brassica napus into small segments of 0.5-1cm and infect them with suspended Agrobacterium for 10 minutes.

[0059] (4) Inoculate the infected hypocotyls into M1 medium (the specific components are described below) and co-culture in the dark for 24 hours.

[0060] (5) After co-culture, the culture medium was transferred to M2 medium (the specific components are described below) and cultured in a light-controlled culture room (16 hours of light, 8 hours of darkness, temperature 22℃).

[0061] (6) After 2 weeks, inoculate into M3 medium (specific components are described below) and culture in a light-controlled incubator (16 hours of light, 8 hours of darkness, temperature 22℃).

[0062] (7) Inoculate the redifferentiated tissue culture seedlings into M4 medium (the specific components are described below) until complete plants are obtained.

[0063] (8) Transplant the rooted plants into pots and extract DNA for positive identification.

[0064] (9) RNA was extracted from positive plants and the relative expression level was detected by qRT-PCR.

[0065] The results are as follows Figure 7 As shown, the BnaA07.ST1 gene was successfully overexpressed in the positive plants.

[0066] The culture medium formulation used in this embodiment

[0067] LB medium: Trypone 10g / L, yeast extract 5g / L, NaCl 10g / L.

[0068] M0 medium: MS 2.2 g / L, sucrose 15 g / L, agar powder 6 g / L, adjust pH to 5.9-6.0.

[0069] M1 medium: MS 4.4 g / L, sucrose 30 g / L, mannitol 18 g / L, 2,4-D 1000 μL / L, KT 1000 μL / L, agar powder 6 g / L, adjust pH to 5.9-6.0. After sterilization, add AS and dispense for later use.

[0070] M2 medium: MS 4.4 g / L, sucrose 30 g / L, mannitol 18 g / L, 2,4-D 1000 μL / L, KT 1000 μL / L, agar powder 6 g / L, adjust pH to 5.9-6.0. After sterilization, add TMT, hygromycin and STS, and dispense for later use.

[0071] M3 medium: MS 4.4 g / L, glucose 10 g / L, xylose 0.25 g / L, MES 0.6 g / L, agar powder 6 g / L, adjust pH to 5.9-6.0. After sterilization, add TMT, reverse zeatin, hygromycin and auxin, and dispense for later use.

[0072] M4 medium: MS 4.4 g / L, sucrose 10 g / L, agar powder 6 g / L, adjust pH to 5.9-6.0. After sterilization, add hygromycin and dispense for later use.

[0073] The basic MS medium formulation described above is as follows: macroelements (KNO3 1.9 g / L, NH4NO3 1.65 g / L, KH2PO4 0.17 g / L, MgSO4·7H2O 0.37 g / L, CaCl2·2H2O 0.44 g / L), microelements (KI 0.83 mg / L, H3BO3 6.2 mg / L, MnSO4·4H2O 22.3 mg / L, ZnSO4·7H2O 8.6 mg / L, Na2MoO4·2H2O 0.25 mg / L, CuSO4·5H2O 0.025 mg / L, CoCl2 0.025 mg / L), and iron salts (Na2·EDTA 37.3 mg / L, FeSO4·7H2O). 27.8 mg / L), organic components (inositol 100 mg / L, Gly 2 mg / L, VB 10.1 mg / L, VB 60.5 mg / L, VB50.5 mg / L).

[0074] Example 3: Functional Study of BnaA07.ST1

[0075] A. pCAMBIA1305-BnaA07.ST1 was transformed into Brassica napus Westar via Agrobacterium-mediated genetic transformation; BnIR (Brassica napus multi-omics database(information resource))local BLAST A search for homologous genes of BnaA07.ST1 in Westar yielded three homologous genes. (The search was conducted on a target search website.) (CRISPR-P v2.0(hzau.edu.cn)) The target was designed, and a CRISPR / Cas9 vector was constructed using pKSE401 as the plasmid backbone and transformed into Brassica napus Westar. Triple mutant material BnaA07.ST1 was obtained by Hi-Tom sequencing. With 0 mM NaCl as the control and 200 mM NaCl as the experimental group, the three-leaf-one-heart stage was subjected to stress treatment for 7 days under hydroponic conditions (16 hours of light, 8 hours of darkness, temperature 22℃, hydroponic nutrient solution formula is shown in the table below).

[0076] B. Through Agrobacterium-mediated genetic transformation, pCAMBIA1305-BnaA07.ST1 was transformed into Brassica napus Westar, and triple mutant materials were constructed. With 0 mM NaCl as the control and 385 mM NaCl as the experimental group, stress treatment was carried out at the three-leaf-one-heart stage under greenhouse (soil cultivation) conditions (16 hours of light, 8 hours of darkness, temperature 22℃).

[0077] The hydroponic nutrient solution formula in this embodiment is as follows:

[0078] Mother liquor: KNO3 102g / L, MgSO4﹒7H2O 98g / L, KH2PO4 28g / L, Ca(NO3)2﹒5H2O 236g / L, Na2﹒ EDTA 3.722g / L, FeSO4﹒7H20 2.7 99g / L, MnCl2﹒4H2O3.62g / L, ZnSO4﹒7H2O 0.44g / L, CuSO4﹒5H2O 0.16g / L, H3BO3 5.72g / L, Na2MoO4﹒4H2O 0.18g / L.

[0079] Working solution: KNO3 5mL / L, MgSO4﹒7H2O 5mL / L, KH2PO4 5mL / L, Ca(NO3)2﹒5H2O 5mL / L, Na2﹒ EDTA 5mL / L, FeSO4﹒7H2O 5mL / L, MnCl2﹒4H2O0.25mL / L, ZnSO4﹒7H2O 0.25mL / L, CuSO4﹒5H2O0.25mL / L, H3BO3 0.25mL / L, Na2MoO4﹒4H2O 0.25mL / L.

[0080] Example 4: Phenotypic Observation

[0081] A. Phenotypic observation and statistical analysis were performed on A in Example 3, and the results are as follows: Figure 9 As shown, the results indicate that under salt stress, the leaves of the overexpressing BnaA07.ST1 strain are extended and the overall morphology is relatively normal, making it more salt-tolerant. The leaves of the wild type and the triple mutant are wrinkled and curled, and the growth of the triple mutant is inhibited, making it less salt-tolerant.

[0082] B. Phenotypic observation and statistical analysis were performed on B in Example 3, and the results are as follows: Figure 10 As shown, the results indicate that under salt stress, the BnaA07.ST1 overexpression line can complete its life cycle (flowering), while the wild-type and triple mutant lines cease their life cycle and cannot flower. This means the BnaA07.ST1 overexpression line is more salt-tolerant.

[0083] C. Growth testing was performed on the triple mutant material in Example 3A, and the results are as follows: Figure 11 As shown, the results indicate that under salt stress, the growth of mutant materials is inhibited compared to wild-type materials, meaning they are more sensitive to salt stress and relatively less salt-tolerant.

[0084] The above detailed embodiments describe the implementation of the present invention; however, the present invention is not limited to the specific details described in the above embodiments. Within the scope of the claims and technical concept of the present invention, various simple modifications and changes can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.

Claims

1. The application of overexpression of the BnaA07.ST1 gene in improving plant salt tolerance, characterized in that, The amino acid sequence encoded by the BnaA07.ST1 gene is shown in SEQ ID NO:3, and the plant is Brassica napus.

2. The application according to claim 1, characterized in that, The nucleotide sequence of the BnaA07.ST1 gene is shown in SEQ ID NO:1, and the CDS sequence of the BnaA07.ST1 gene is shown in SEQ ID NO:

2.

3. A method for improving the salt tolerance of plants, characterized in that, The BnaA07.ST1 gene or its expression vector is introduced into plant cells. The amino acid sequence of the BnaA07.ST1 gene is shown in SEQ ID NO:

3. The plant is Brassica napus.

4. The method according to claim 3, characterized in that, The expression vector includes pCAMBIA1305.

5. The application of the BnaA07.ST1 gene or an overexpression vector containing the BnaA07.ST1 gene in the cultivation of salt-tolerant transgenic plants, characterized in that, The amino acid sequence encoded by the BnaA07.ST1 gene is shown in SEQ ID NO:3, and the plant is Brassica napus.

6. The application according to claim 5, characterized in that, The overexpression vector containing the BnaA07.ST1 gene includes pCAMBIA1305.

Images