Gliocladium ovalisporum strain f4, application thereof, compound microbial inoculant, preparation method and application thereof

CN117946877BActive Publication Date: 2026-09-22HENAN AGRICULTURAL UNIVERSITY
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
CN202410154842.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-02-04
Publication Date
2026-09-22
Estimated Expiration
2044-02-04

AI Technical Summary

Technical Problem

但很少有关于促进农作物生长、缓解盐碱障碍的卵形孢球托霉被报道

Benefits of technology

[0027]本发明提供了一株卵形孢球托霉(Gongronella butleri)F4,经实施例验证,卵形孢球托霉F4能够有效促进小麦生长,具有促进秸秆降解和溶磷的功能,可为农业秸秆降解提供菌种资源,为卵形孢球托霉的进一步开发利用提供参考。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117946877B_ABST
    Figure CN117946877B_ABST
Patent Text Reader

Abstract

The present application belongs to the field of microbial technology, and particularly relates to a Gongronella butleri F4 strain and application thereof, a compound microbial inoculant and a preparation method and application thereof. The Gongronella butleri F4 strain is preserved in the China General Microbiological Culture Collection Center, and has a preservation number of CGMCC No.40972. The Gongronella butleri F4 strain provided in the present application can effectively promote the growth of wheat, rice and corn, and significantly optimize the rhizosphere microbial community structure of rice and corn. In addition, the Gongronella butleri F4 strain provided in the present application has the functions of promoting straw degradation and dissolving phosphorus, can provide a strain resource for agricultural straw degradation, and can provide a reference for further development and utilization of Gongronella butleri.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of microbial technology, specifically relating to a strain of *Thiopyramidalis* F4 and its application, a compound microbial agent and its preparation method and application. Background Technology

[0002] Gongronella butleri fungi, belonging to the family Cronachianidae, are well-known soil-dwelling fungi. Currently, the known applications of Gongronella butleri are primarily in the fermentation of chitosan (Maw et al., 2002. Selection of Gongronella butleri strains for enhanced chitosany with UV mutagenesis. Journal of Biotechnology 95, 189–193). There are also studies reporting applications of Gongronella butleri in the production of amylase through solid-state fermentation (Cavalheiro et al., 2017. Catalytic properties of amylolytic enzymes produced by Gongronella butleriusing agroindustrial residues on solid-state fermentation. BioMed Research International 2017, 7507523.). In 2022, Valsalan et al. published a draft genome of *Gongronella butleri*, suggesting its potential for biodegradation (Valsalan et al., 2022. Draft genome of *Gongronella butleri* reveals the genes contributing to its biodegradation potential. *Journal of Genetic Engineering and Biotechnology*, 20, 74.). Patent CN103087926A discloses that *Gongronella butleri* promotes efficient limestone erosion. Varela-Benavides' research shows that, as a nematode-eating fungus, *Gongronella butleri* has the potential to control nematode diseases (Varela-Benavides et al., 2017. In vitro assessment often strains of *nematophagous* fungi to control *Meloidogyne exigua*, *Meloidogyne incognita* and *Radopholussimilis*. *Revista Tecnolog*, 30, 27–37.). However, there are few reports on ostioglobulus ovalis promoting crop growth and alleviating salinity problems. Summary of the Invention

[0003] The purpose of this invention is to further develop and utilize *Thiopyramidalis* to provide microbial resources for the degradation of agricultural straw.

[0004] This invention provides a strain of *Gongronella butleri* F4, which is deposited at the China Microbial Culture Collection Center with accession number CGMCC No. 40972.

[0005] The present invention also provides the application of the above-described *Thioclase ovalis* F4 in any one or more of the following:

[0006] (1) Promotes straw degradation;

[0007] (2) Promotes the increase of phosphorus availability in the soil;

[0008] (3) Improve the structure of the rhizosphere soil microbial community and promote plant growth.

[0009] Preferably, the plants include wheat, corn, and rice.

[0010] The present invention also provides a compound microbial agent, the compound microbial agent comprising *Thiopyrox ovalis* F4 and *Pterocaryonium* strain;

[0011] The *Cyclocarya ovalis* F4 strain is deposited at the China Microbial Culture Collection Center, with accession number CGMCC No. 40972.

[0012] The fungal strains mentioned include Mortierella elongata, Mortierella alpina, Mortierella sp. F34 (unnamed), and Mortierella capitata.

[0013] Preferably, the concentration of *Thiophanate-methyl* is 2–3 × 10⁻⁶. 7 / g of compound microbial agent, wherein the concentrations of *Morchella spp.*, *Morchella alpineensis*, *Morchella unnamed* F34, and *Cephalospora* are all 2–10 × 10⁻⁶. 6 / g compound microbial agent.

[0014] This invention also provides a method for preparing the compound microbial agent described in the above technical solution, comprising the following steps:

[0015] The F4 strain of *Thiopyramidalis* and the *Spirulina* strain were mixed and cultured on a large scale to obtain a mixed bacterial solution; the mixed bacterial solution was then inoculated into a fermentation substrate for fermentation culture to obtain a compound bacterial agent.

[0016] The ratio of viable bacteria counts of *Cyclocarya ovalis* F4, *Metroxylum bungeanum*, *Metroxylum alpineum*, *Metroxylum unnamed* F34, and *Cephalocarya cephalocarya* inoculated was 2–5:1:1:1:1;

[0017] By weight, the fermentation substrate comprises 1000 parts wheat straw, 80-120 parts woody peat, 180-220 parts soybean meal, 1.67-2.00 parts potassium chloride, 0.96-1.10 parts potassium dihydrogen phosphate, and 6-12 parts humic acid; the moisture content of the fermentation substrate is 35%-45%.

[0018] Preferably, the expanded culture includes mixing *Thalassiosporium ovale* F4 and *Pterocaryon* strains and inoculating them onto a culture medium, wherein the ratio of *Thalassiosporium ovale* F4 to the culture medium is 10:1. 7 ~10 9 CFU / mL culture medium.

[0019] Preferably, the ratio of the mixed bacterial solution to the fermentation substrate is 10 mL: 100 g; the concentration of the mixed bacterial solution is 10. 9 CFU / mL culture medium.

[0020] Preferably, the temperature for the expansion culture is 25°C, the rotation speed is 180 rpm, and the culture time is 5 days; the temperature for the fermentation culture is 20-28°C, and the culture time is 7 days.

[0021] The present invention also provides the application of the compound microbial agent described in the above technical solution or the compound microbial agent prepared by the preparation method described in the above technical solution in any of the following:

[0022] (1) Increase the nitrogen and available phosphorus content in the soil;

[0023] (2) Increase the species abundance of beneficial bacteria in the soil;

[0024] (3) Promotes plant growth and increases crop yield;

[0025] (4) Improve plant disease resistance and stress resistance.

[0026] Beneficial effects

[0027] This invention provides a strain of *Gongronella butleri* F4. Verification through examples shows that *Gongronella butleri* F4 can effectively promote wheat growth and has the functions of promoting straw degradation and phosphorus solubilization. It can provide strain resources for agricultural straw degradation and provide a reference for the further development and utilization of *Gongronella butleri*.

[0028] The present invention combines the aforementioned *Thiopyramidalis* F4 and *Pterocaryonium* strains to obtain a compound microbial agent that can effectively promote lignin degradation, enhance plant disease resistance, effectively promote plant root growth, improve crop salt and alkali tolerance, and promote the health of the crop rhizosphere soil environment.

[0029] Biological Preservation Information

[0030] Gongronella butleri F4 was deposited on November 7, 2023, at the China Microbiological Culture Collection Center, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, with accession number CGMCCNo. 40972. Attached Figure Description

[0031] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.

[0032] Figure 1 The colony morphology of strain F4 grown on different culture media;

[0033] Figure 2 Phylogenetic tree for identifying strain F4;

[0034] Figure 3 The dry matter statistics of the combined strain of *Thiospora ovata* F4 and *Morchella* under liquid co-culture.

[0035] Figure 4 The combined culture medium of *Thiopyroxon ovalis* F4 and *Morchella spp.* was tested under different culture media.

[0036] Figure 5 To test the rice growth status of the control group and the experimental group in Example 4;

[0037] Figure 6 The relative abundance of rice rhizosphere soil bacterial communities at the phylum level;

[0038] Figure 7 The relative abundance of rice rhizosphere soil bacterial communities at the scientific level;

[0039] Figure 8 The relative abundance of rice rhizosphere soil bacterial communities at the genus level;

[0040] Figure 9 The relative abundance of rice rhizosphere soil fungal communities at the phylum level;

[0041] Figure 10 The relative abundance of rice rhizosphere soil fungal communities at the scientific level;

[0042] Figure 11 The relative abundance of rice rhizosphere soil fungal communities at the genus level;

[0043] Figure 12 The field growth of maize in the control and experimental groups;

[0044] Figure 13 The relative abundance of soil bacterial communities in the root zone of maize at the phylum level;

[0045] Figure 14 The relative abundance of soil bacterial communities in the root zone of maize at the scientific level;

[0046] Figure 15 The relative abundance of soil bacterial communities in the root zone of maize at the genus level;

[0047] Figure 16 The relative abundance of soil fungal communities in the rhizosphere of maize at the phylum level;

[0048] Figure 17 The relative abundance of soil fungal communities in the root zone of maize at the scientific level;

[0049] Figure 18 The relative abundance of soil fungal communities in the rhizosphere of maize at the genus level. Detailed Implementation

[0050] This invention provides a strain of *Gongronellabutleri* F4, which is deposited at the China Microbial Culture Collection Center with accession number CGMCC No. 40972.

[0051] This invention isolates and screens a strain of *Thalassiosporium ovale* F4 from saline-alkali soil. It has been verified that this strain can improve the degradation rate of straw and increase the content of available phosphorus and the concentration of reducing sugar in the culture medium.

[0052] Based on the effects of *Thioclase ovalis* F4 provided by this invention, the applications of *Thioclase ovalis* F4 and / or its metabolites in promoting straw degradation, promoting the dissolution of ineffective phosphorus in the soil, improving the rhizosphere soil microbial community structure, and promoting plant growth, in one or more of these areas, also fall within the scope of protection of this invention. In this invention, the plants preferably include wheat, corn, and rice.

[0053] The present invention also provides a compound microbial agent, the compound microbial agent comprising *Thiopyrox ovalis* F4 and *Morchella* strain;

[0054] The *Cyclocarya ovalis* F4 strain is deposited at the China Microbial Culture Collection Center, with accession number CGMCC No. 40972.

[0055] The aforementioned Mortierella strains include Mortierella elongata (CGMCC No. 14151, patent number: ZL201710907142.X), Mortierella alpina (CGMCC No. 17077, patent number: ZL201911182423.9), unnamed Mortierella sp. F34 (CGMCC No. 40122, patent number: ZL202211478572.1), and Mortierella capitata (CGMCC No. 18560, patent number: ZL201911127227.1).

[0056] In this invention, the concentration of *Thiophanate-methyl* in the compound microbial agent is preferably 2–3 × 10⁻⁶. 7 / g of compound microbial agent, wherein the concentrations of *Morchella spp.*, *Morchella alpineensis*, *Morchella unnamed* F34, and *Cephalospora* are preferably 2–10 × 10⁻⁶ g, respectively. 6 / g compound microbial agent.

[0057] This invention also provides a method for preparing the compound microbial agent described in the above technical solution, comprising the following steps:

[0058] The F4 strain of *Thiopyramidalis* and the *Spirulina* strain were mixed and cultured on a large scale to obtain a mixed bacterial solution; the mixed bacterial solution was then inoculated into a fermentation substrate for fermentation culture to obtain a compound bacterial agent.

[0059] The ratio of viable bacteria counts of *Morchella ovalis* F4, *Morchella longiflora*, *Morchella cephalosporia*, *Morchella unidentified* F34, and *Morchella alpineensis* inoculated was 2–5:1:1:1:1;

[0060] By weight, the fermentation substrate comprises 1000 parts wheat straw, 80-120 parts woody peat, 180-220 parts soybean meal, 1.67-2.00 parts potassium chloride, 0.96-1.10 parts potassium dihydrogen phosphate, and 6-12 parts humic acid; the moisture content of the fermentation substrate is 35-45%.

[0061] The present invention first mixes and expands the culture of *Thiopyramidalis* F4 and *Pseudomonas* strains to obtain a mixed bacterial solution.

[0062] In this invention, the preferred temperature for the expanded culture is 25°C; the preferred rotation speed for the expanded culture is 180 rpm; the preferred culture time for the expanded culture is 5 days; and the preferred ratio of *Thiophanate-methyl* F4 to the culture medium is 10:1. 7 ~10 9 CFU / mL culture medium, more preferably 10 CFU / mL. 9CFU / mL culture medium; the expansion culture preferably includes mixing *Morchella ovalis* F4 and *Morchella* strains and inoculating them onto the culture medium, wherein the ratio of viable bacteria of *Morchella ovalis* F4, *Morchella longiflora*, *Morchella cephalospora*, *Morchella unnamed* F34 and *Morchella alpineensis* is preferably 2-5:1:1:1:1, more preferably 2:1:1:1:1:1.

[0063] After obtaining the mixed bacterial solution, the present invention inoculates the mixed bacterial solution into a fermentation substrate for fermentation culture to obtain a compound bacterial agent.

[0064] In this invention, the ratio of the mixed bacterial solution to the fermentation substrate is 10 mL: 100 g; the concentration of the mixed bacterial solution is 10. 9 The fermentation substrate, by mass, comprises 1000 parts wheat straw, 80-120 parts woody peat, 180-220 parts soybean meal, 1.67-2.00 parts potassium chloride, 0.96-1.10 parts potassium dihydrogen phosphate, and 6-12 parts humic acid; more preferably, it comprises 1000 parts wheat straw, 100 parts woody peat, 200 parts soybean meal, 1.67 parts potassium chloride, 0.96 parts potassium dihydrogen phosphate, and 10 parts humic acid; the moisture content of the fermentation substrate is 35%-45%, more preferably 40%. The fermentation temperature is preferably 20-28℃; the fermentation time is preferably 7 days, more preferably 3 days of static culture in a clean bench followed by 4 days of continued culture in an indoor environment.

[0065] The present invention also provides the application of the compound microbial agent described in the above technical solution or the compound microbial agent prepared by the preparation method described in the above technical solution in any of the following:

[0066] (1) Increase the nitrogen and available phosphorus content in the soil;

[0067] (2) Increase the species abundance of beneficial bacteria in the soil;

[0068] (3) Promotes plant growth and increases crop yield;

[0069] (4) Improve plant disease resistance and stress resistance.

[0070] To further illustrate the present invention, the following detailed description, in conjunction with the accompanying drawings and embodiments, describes the F4 strain of *Cyclocarya paliurus* provided by the present invention, its application, the compound microbial agent, its preparation method, and its application. However, these descriptions should not be construed as limiting the scope of protection of the present invention.

[0071] Example 1

[0072] Microorganisms in saline-alkali soil were isolated and purified using the dilution plating method, and a strain named F4 was obtained. The isolation medium was Sigma-Aldrich red agar, and the purification medium was PDA medium.

[0073] The F4 strain was identified with reference to Chinese patent CN202211477950.4, and its colony morphology is as follows: Figure 1 As shown, a represents the colony morphology of strain F4 on the front side of the PDA plate, b represents the colony morphology of strain F4 on the back side of the PDA plate, and c represents the colony morphology of strain F4 in the soil.

[0074] The ITS sequence of strain F4 is as follows:

[0075] GTAATGCTTCGTAGTGACCTGCGGAGGATCATTATCAATGCAAAGTTT

[0076] CTCCAATGAATTTTGGGGTTTCTTTGATAAAATTTCTCTTCTTTTCCTTCTT

[0077] TGAGGGAATTGAAGGAATCCACTGTGATCTGTTTCGAGCTTTTCATTTGA

[0078] AAAAGCTACAACCCGTTTTTTTCTTTGGAAACAAACGGGTGTGGGGCCTTT

[0079] TAGGTCCTCGCAATTCAATATACTTTATGAAATTCTTGATTGATTCTTAATTGA

[0080] AACAAAAAACAACTTTCAACAATGGATCTCTCGGCTTACGCATCGATGAAG

[0081] AACGCAGCGAATCGCGATATGTAATGTGATCTGCATTTAGTGAATCATCGAA

[0082] TCTTTGAACGCATCTTGCGCCCAAGGGTAATCCTTTGGGCACGCCTGTTTC

[0083] AGTGTTATGTTAAACCCAAAATCTCTTTTTTGGTGATGTAACGTTGGGCTTG

[0084] CCAATCATTTTTTTGATCGGTCTTGCTTGGAATGATATCAATTCCAGTCGGAT

[0085] CACCTTATTCTTCAGATCAGGCTTTGGTAGACTACCGAAAGTCGCGTTTGA

[0086] ACGGATTTAGGCCCGAATTGATGGGATTTTTAAACATTTTCAATATTTAACC

[0087] TGAAATCAGGCGGGGACTACCCGCTGAACTTAAGCATATCAAAAAGGGGGG

[0088] AAGGAAA (SEQ ID No. 1).

[0089] After comparison with the NCBI website, representative sequences were selected, and a Mega 7.0.0.26 phylogenetic tree was constructed, as follows: Figure 2 As shown. By Figures 1-2 It can be seen that the colony morphology of F4 is: milky white colony, large colony, and vigorous aerial hyphae. Strain F4 is *Typhonium ovale*, which is named *Typhonium ovale* F4 and is biopreserved.

[0090] Example 2

[0091] Three replicates were prepared as follows:

[0092] (1) In a clean bench, pick out the mycelium of *Typhonium ovale* F4 and place it on PDA plate medium (200g potato, 20g sucrose, 20g agar and 1000mL deionized water, natural pH) for activation. Incubate in the dark at 25℃ for 5 days. Use a punch with a diameter of 1cm to punch holes to obtain *Typhonium ovale* F4 agar block culture. The thickness of the *Typhonium ovale* F4 agar block culture is 3mm.

[0093] (2) Prepare a sufficient amount of clean and uniform straw, and cut it to 1cm with scissors. 3 Size. Weigh out 0.50g yeast extract, 20.0g straw, 5.0g tricalcium phosphate, 0.50g ammonium sulfate, 0.20g potassium chloride, 0.10g magnesium sulfate heptahydrate, 0.0001g manganese sulfate monohydrate, and 0.0001g ferrous sulfate heptahydrate. Add to deionized water, adjust the pH to 7.0, and bring the volume to 1L. Transfer to a 1L culture flask, sterilize at 121℃ for 20min, and let cool for later use to obtain straw culture medium.

[0094] (3) Inoculate two 1cm diameter oocystis tetrodera F4 agar blocks prepared in step (1) into the straw culture medium obtained in step (2), and culture them in a shaker at 25℃ and 170rpm for 7 days to obtain the culture medium.

[0095] Comparative Example 1

[0096] Three replicates were prepared as follows:

[0097] Pour the prepared PDA medium (200g potato, 20g sucrose, 20g agar, and 1000mL deionized water, natural pH) into a petri dish. After cooling, you will get an agar block with a thickness of 0.3cm. Incubate the PDA plate petri dish in the dark at 25℃ for 5 days. Punch holes with a 1cm diameter punch to obtain a blank agar block with a thickness of 5mm.

[0098] Straw culture medium was prepared according to the method described in Example 2, and blank agar blocks with a diameter of 1 cm were inoculated onto the straw culture medium and cultured in a shaker at 25°C and 170 rpm for 5-7 days to obtain the culture solution.

[0099] Test Example 1

[0100] 1. Determination of soluble phosphorus

[0101] Molybdenum-antimony reagent: Weigh 10.0g of ammonium molybdate and dissolve it in 250mL of water at 60℃, then cool and dilute to 300mL. Slowly pour 181mL of concentrated H2SO4 (analytical grade) into 800mL of water, cool, and then add dilute sulfuric acid into the molybdenum solution, stirring well. Weigh 0.3g of potassium antimony tartrate and add it to the ammonium molybdate dilute sulfuric acid solution, then dilute to 2L with water to obtain the molybdenum-antimony reagent. Store in a brown bottle for long-term preservation. When using, add 1.5g of L-ascorbic acid to every 100ml of molybdenum-antimony reagent to obtain the molybdenum-antimony reagent solution.

[0102] Accurately pipette 1 mL of the culture medium from Example 2 and Comparative Example 1 into 25 mL volumetric flasks, then accurately add 12.5 mL of distilled water using a burette, and then add 2.5 mL of molybdenum antimony reagent using a pipette. Shake well, let stand for 30 min, and then bring the volume up to 50 mL. Shake well and then perform colorimetric analysis at a wavelength of 700 nm.

[0103] The standard curve used for the determination of soluble phosphorus is y = 1.3935x, R² = 0.9959, where x is the absorbance value and y is the concentration of orthophosphate in the system.

[0104] 2. The straw degradation rate was calculated using the drying difference method.

[0105] The straw in the culture bottles of the three replicates in Example 2 and the three replicates in Comparative Example 1 were sieved and washed respectively. A small amount of mycelium on the surface was removed with tweezers. The straw in the culture bottles was dried at 50°C to constant weight for 12-24 hours. The dry weight of the straw after degradation was recorded. The calculation formula (1) is as follows:

[0106] Straw degradation rate = (dry weight of straw - dry weight of straw after degradation) / dry weight of straw × 100% (1)

[0107] 3. The reducing sugar content was determined using the DNS method (dinitrosalicylic acid method), and the steps are as follows:

[0108] DNS solution preparation method: Weigh 3.25g of 3,5-dinitrosalicylic acid and dissolve it in a small amount of water. Transfer the solution to a 500mL volumetric flask, add 162.5mL of 2M sodium hydroxide, then add 22.5g of glycerol. Shake well and bring the volume to 500mL. Store in a refrigerator at 4℃ in the dark for later use.

[0109] The culture media of the three replicates in Example 2 and the three replicates in Comparative Example 1 were allowed to stand. Then, 2 mL of the supernatant of the culture media was taken into a glass test tube, 1.5 mL of DNS solution was added, the tube was boiled in a water bath for 5 min, immediately cooled on ice, and the color was developed at room temperature for 20 min. Then, the color was measured at 540 nm using an ELISA reader.

[0110] Take 2g of sucrose and dry it at 98℃ for 2 hours until constant weight. Accurately weigh 1.0000g of the dried sucrose and make up to 1L. Prepare standard solutions with concentrations of 0mg / mL, 0.1mg / mL, 0.3mg / mL, 0.5mg / mL, 0.7mg / mL, and 0.9mg / mL, respectively. Boil in a water bath for 5 minutes, then immediately cool on ice for 10 minutes. Develop the color at room temperature for 20 minutes and measure the color at 540nm to create a standard curve.

[0111] SPSS 20.0 statistical software was used for analysis. The experimental data are expressed as mean ± standard deviation. The Tukey sb(K) test was used to test the homogeneity of the data. The results are shown in Table 1.

[0112] Table 1. Phosphate-saturating effect, straw degradation rate, and reducing sugar concentration in culture medium of *Thiopyramidalis* F4.

[0113]

[0114] Note: "*" indicates that the difference was statistically significant at the P=0.05 level.

[0115] As shown in Table 1, inoculation with *Cyclocarya ovalis* F4 significantly promoted straw degradation, increased the content of available phosphorus and the concentration of reducing sugar in the culture medium, indicating that *Cyclocarya ovalis* F4 has a strong promoting effect on the dissolution of tricalcium phosphate, and the amount of reducing sugar released by its degradation of straw is significantly higher than its own absorption.

[0116] Test Example 2

[0117] Weigh 2g of fresh mycelial balls from each of the three replicate culture media in Example 2, simply absorb water with sterile filter paper, weigh, grind, add 5mL of 0.05M PBS solution to dissolve for 30min, centrifuge at 8000rpm for 10min, take the supernatant to obtain crude enzyme solution.

[0118] The activities of β-mannanase, β-glucosidase, and endo-β-1,4-glucanase in the crude enzyme solution, as well as the protein concentration in the sample, were determined.

[0119] 1. Determination of β-mannase:

[0120] Weigh 3.4 g of potassium dihydrogen phosphate and dissolve it in 400 mL of water. Adjust the pH to 7.0 with NaOH / HCl and bring the volume to 500 mL to obtain a phosphate buffer solution. Weigh 1.00 g of locust bean gum and dissolve it in 100 mL of 0.05 mol / L phosphate buffer solution (pH = 7) to obtain a 1% (w / v) locust bean gum solution. Take 1.8 mL of the 1% (w / v) locust bean gum solution, add 0.2 mL of crude enzyme solution, incubate at 37°C for 15 min, then add 3 mL of DNS reagent, incubate at boiling water for 15 min, cool, and bring the volume to 25 mL. Measure the absorbance at 575 nm and 540 nm.

[0121] 2. Determination of β-glucosidase:

[0122] Weigh 0.150625 g of 4-nitrobenzene-β-D-glucopyranoside and dissolve it in 100 mL of 0.1 mol / L Tris-HCl buffer (pH = 8) to obtain a 5 mmol / L 4-nitrobenzene-β-D-glucopyranoside (β-PNPG) solution. Take 1.8 mL of the 5 mmol / L β-PNPG solution, add 0.2 mL of crude enzyme solution, incubate at 37 °C for 30 min, then add 0.5 mL of cold 0.5 mol / L sodium carbonate solution to terminate the reaction, and measure the absorbance at 373 nm.

[0123] 3. Determination of endo-β-1,4-glucanase (EC):

[0124] Weigh 2.0 g of sodium carboxymethyl cellulose and dissolve it in 100 mL of 0.1 mol / L pH 5 sodium acetate buffer to obtain a 2% (w / v) sodium carboxymethyl cellulose solution. Take 1.8 mL of the 2% (w / v) sodium carboxymethyl cellulose solution, add 0.2 mL of crude enzyme solution, incubate at 37 °C for 30 min, and finally add 0.5 mL of pre-cooled 0.5 mol / L sodium carbonate solution to terminate the reaction. Measure the absorbance at 373 nm.

[0125] 4. Determination of sample protein concentration:

[0126] Preparation of Reagent A: Weigh 10g Na₂CO₃, 2g NaOH, and 0.25g potassium sodium tartrate (KNaC₄H₄O₆-4H₂O), dissolve in 500mL distilled water to obtain solution a; weigh 0.5g copper sulfate (CuSO₄-5H₂O), dissolve in 100mL distilled water to obtain solution b. Before use, mix 50 parts of solution a with 1 part of solution b to obtain reagent A.

[0127] Preparation of Folin-phenol reagent B: In a 2L ground glass joint reflux flask, add 100g sodium tungstate (Na₂WO₄·2H₂O), 25g sodium molybdate (Na₂MOO₄·2H₂O), and 700mL distilled water. Then add 50mL of 85% phosphoric acid and 100mL of concentrated hydrochloric acid, mix thoroughly, connect a reflux tube, and reflux gently for 10 hours. At the end of reflux, add 150g lithium sulfate (Li₂SO₄), 50mL distilled water, and a few drops of liquid bromine. Continue boiling for 15 minutes to remove excess bromine. After cooling, the solution will be yellow (if it is still green, repeat the step of adding liquid bromine). Dilute to 1L, filter, and store the filtrate in a brown reagent bottle. When using, titrate with standard NaOH using phenolphthalein as an indicator, then dilute appropriately, adding approximately 1 part water to achieve a final acid concentration of about 1N. (Alternatively, a ready-made 2N folin-phenol reagent can be purchased and used directly.)

[0128] Standard protein solution: Prepare a standard bovine serum albumin (BSA) solution with a concentration of 250 mg / mL. If the BSA solution is turbid when dissolved in water, a 0.9% NaCl solution can be used instead. Take seven 10 mL test tubes and add 0 mL, 0.1 mL, 0.2 mL, 0.4 mL, 0.6 mL, 0.8 mL, and 1.0 mL of the standard protein solution (concentration of 250 mg / mL) to each tube, respectively. Then, add water to each tube to bring the volume to 1 mL. Incubate at room temperature for 10 min, then add 0.5 mL of reagent ethyl phenol (Follen-phenol reagent) to each tube, mix immediately, and measure the color after 30 min. The treatment with 0 mL of standard protein solution serves as a blank control.

[0129] The standard curve obtained is y = 948.22x (R²). 2=0.9633). Where y is the absorbance at a wavelength of 700 nm, and x is the protein concentration in the sample (mg / L).

[0130] SPSS 20.0 statistical software was used for analysis. Experimental data are expressed as mean ± standard deviation. Tukey sb(K) test was used to test for data homogeneity, and the results are shown in Table 2. Table 2 shows that the activities of β-mannanase, β-glucosidase, and endo-β-1,4-glucanase in Example 2 were all higher than those in Comparative Example 1, and the protein concentration was also significantly higher. These enzymes play an important role in the degradation of straw, indicating that *Thoctomyces ovalis* F4 secretes a large amount of β-mannanase, β-glucosidase, and endo-β-1,4-glucanase during straw degradation, which can effectively promote straw degradation.

[0131] Table 2. Determination of straw degradation-related enzyme activities in Example 2 and Comparative Example 1: *Thioclase ovalis*

[0132]

[0133] Note: "*" indicates that the difference was statistically significant at the P=0.05 level.

[0134] Example 3

[0135] Preparation of Mortierella strains: Four Mortierella fungi, Mortierella elongata (CGMCC No. 14151), Mortierella alpina (CGMCC No. 17077), Mortierella sp. F34 (CGMCC No. 40122), and Mortierella capitata (CGMCC No. 18560), were inoculated into freshly prepared PDA medium and activated by incubation at 25°C in the dark for 5 days. After activation, agar blocks of each Mortierella strain with a diameter of 8 mm and a thickness of 5 mm were obtained by punching holes with an 8 mm diameter hole. The activated Mortierella strains were inoculated into 250 mL Erlenmeyer flasks containing 100 mL of potato dextrose broth, with one mycelial block of each fungus as the inoculation amount. The mixtures were incubated at 25°C in the dark with shaking for 5 days at 180 rpm to obtain a mixed Mortierella culture broth.

[0136] Disinfection and germination of maize: Inbred line B73 maize seeds (available from the China Crop Germplasm Information Network) were mutagenized for 12 hours at 20℃ using 0.4% EMS (CAS No.: 62-50-0), then soaked in 5% sodium thiosulfate solution for 10 minutes, followed by rinsing with water for 2 hours to obtain the mutagenized material. After planting, individuals without root hairs were screened to obtain the rtl6 mutant. Experiments were conducted using inbred line B73 maize material (parental line) and the root-hairless mutant rtl6 obtained after EMS mutagenesis, respectively. Fifty B73 maize seeds and fifty rtl6 maize seeds were selected and disinfected in 10% hydrogen peroxide solution for 5 minutes, followed by washing five times with distilled water to completely remove residual hydrogen peroxide solution. After soaking in distilled water for 10 hours, the seeds are germinated. Specifically, clean filter paper of 90 mm size is added to a 90 mm glass petri dish, 5-10 mL of distilled water is added, 30 seeds are placed in the dish with the endosperm facing upwards, the petri dish is covered to keep the environment humid, and the seeds are cultured at 28℃ for 3 days to obtain germinated corn.

[0137] Planting: Soil from Fengzhuang Village, Gongyi City, Henan Province was selected as the potting soil. The soil type is sandy moist soil with a pH of 7.7, an organic matter content of 12.71 g / kg, a total nitrogen content of 0.62 g / kg, and a moisture content of 23%. After passing through a 2 mm sieve, the soil was filled into pots. Each pot contained 300 g of soil, thoroughly watered, and soaked for 2 hours. Then, the prepared corn was placed in the pot with the roots facing down, and 30 g of dry soil was lightly covered on top. The planted corn was placed in a constant temperature incubator and cultured at 28℃ for 16 hours daily (light intensity of 30,000 lm), followed by 8 hours of dark culture at 20℃.

[0138] When the corn plants reach the 3-4 leaf stage, thin them out, leaving one plant per pot. Divide the B73 corn plants into a parental control group and a parental control group with added bacteria, and the rtl6 corn plants into a mutant control group and a mutant control group with added bacteria. Inoculate the plants according to the following method:

[0139] Parental control group: Each pot was inoculated with 4 blank agar blocks with a diameter of 8 mm and a thickness of 5 mm prepared in Comparative Example 1 at a depth of 15 mm below the topsoil layer;

[0140] Parental inoculation group: Each pot was inoculated with mycelial blocks of 4 different strains of *Morchella* at a depth of 15 mm below the topsoil layer, with one mycelial block inoculated for each strain of *Morchella*.

[0141] Mutant control group: consistent with the parental control group;

[0142] Mutant strain plus bacterial group: consistent with parent strain plus bacterial group.

[0143] After inoculation, cover with sieved, moist, loose soil, but do not compact it to facilitate observation of mycelial growth. Water the soil surface with a spray bottle after inoculation to keep it moist. After 14 days of cultivation, collect samples from corn plants and soil for relevant parameter measurements.

[0144] Test Example 3

[0145] Method for determining available phosphorus: The soil sample from Example 3 was air-dried to constant weight. 5g of the air-dried soil sample was weighed and poured into a 250mL plastic bottle. One spoonful of phosphorus-free activated carbon and 100mL of 0.5mol / L sodium bicarbonate solution were added, and the pH was adjusted to 8.5. The bottle was tightly sealed, and the mixture was shaken on a shaker for 30 minutes. Immediately afterward, the mixture was filtered through phosphorus-free filter paper, and the filtrate was collected in a 100mL Erlenmeyer flask. 1mL of the filtrate was transferred to a 25mL volumetric flask, and 15mL of distilled water was accurately added using a burette. Then, 2.5mL of molybdenum antimony reagent was added via pipette, and the mixture was shaken well and brought to volume. After standing for 30 minutes, the mixture was shaken again, and the sample was measured at 800nm ​​wavelength.

[0146] The biomass of each group of maize samples in Example 3 was determined, and the activity of phosphatase was measured using a soil neutral phosphatase activity assay kit (Suzhou Mengxi Biomedical Technology Co., Ltd.). The results are shown in Tables 3 and 4.

[0147] Table 3. Determination of maize biomass and soil-related indicators under different treatments.

[0148]

[0149] Note: Different letters indicate that the difference is significant at the P=0.05 level. Soil neutral phosphatase activity (U) is defined as 1 μmol of phenol released per gram of soil per day at 37°C as one unit of enzyme activity.

[0150] Table 3 shows that the *Morchella* strain significantly increased the root dry weight and total dry weight of the parent maize, and significantly increased the content of rhizosphere soil phosphatase. The root dry weight, aboveground dry weight, and total weight of the mutant were significantly lower than those of the parent. The effect of the inoculum treatment on the mutant was not as good as the control, indicating that the growth-promoting effect of the *Morchella* strain on maize is highly dependent on root hair structure.

[0151] Table 4. Results of maize root growth parameters

[0152]

[0153] Note: Different letters indicate that the difference is significant at the P=0.05 level.

[0154] Table 4 shows that inoculation with *Morchella esculenta* significantly increased the number of root tips and root forks in the parent maize, while decreasing the average root diameter and length-to-volume ratio. This indicates that the *Morchella esculenta* strain increased the forking and elongation of normal maize roots. The *Morchella esculenta* strain significantly increased the average root diameter of rtl6 maize, while root length, number of root tips, and root forks decreased, but not significantly. This suggests that the promoting effect of *Morchella esculenta* on maize root growth is highly dependent on root hairs.

[0155] Example 4

[0156] The effects of different fertilizers on the growth of compound microbial systems

[0157] Under both liquid and solid culture medium conditions, different types of fertilizers were added to the culture medium to explore the effect of fertilizer type on compound microbial agents.

[0158] Screening media were prepared by adding chemical fertilizers to the PDA / PD medium according to the equivalent ratio of N-P2O5-K2O = 150:75:150 kg / ha in the topsoil. The specific ingredients are shown in Table 5.

[0159] Table 5. Ingredients of Culture Media for Different Fertilizer Types

[0160]

[0161] Two treatments were set up on solid culture medium: Treatment 1 involved inoculation of F4 alone, and Treatment 2 involved inoculation of both F4 and *Morchella* strains simultaneously. Each treatment was inoculated with three culture media. In Treatment 1, an 8mm diameter mycelial block was inoculated in the center of the plate. In Treatment 2, an F4 mycelial block of the same size was inoculated in the center of the plate, while *Morchella* blocks of the same size were inoculated around the F4 block. Figure 4 a) After 28 hours, the colony diameter was measured, and the mycelial growth rate was calculated.

[0162] Under liquid culture conditions, cellophane-isolated chambers were set up in 250 mL Erlenmeyer flasks. During inoculation, 20 mL of culture medium was added to each sterile cellophane chamber, followed by inoculation of four 8 mm diameter F4 agar blocks containing mycelium. 80 mL of culture medium was added to the Erlenmeyer flasks, and four different *Morchella* species were inoculated, with two 8 mm diameter agar blocks inoculated for each species. The cultures were incubated in the dark at 28 °C for 5 days at a rotation speed of 180 rpm. After incubation, the mycelium in both the cellophane chambers and the Erlenmeyer flasks was dried at 50 °C, and the dry matter weight was recorded. The results are shown below. Figure 3 As shown.

[0163] Figure 3 The ANOVA in the data was performed using Tukey's sb., with a significance level of 0.05. Figure 3It can be seen that ammonium sulfate has the best growth-enhancing effect on *Cyclocarya ovalis* F4 in liquid culture, followed by urea; urea has the best growth-enhancing effect on *Morchella* strains in liquid culture, followed by potassium chloride. Considering the overall growth of *Cyclocarya ovalis* F4 and *Morchella* strains, urea is the most effective choice.

[0164] On solid culture media of different fertilizer types in Table 5, *Typhae ovalis* F4 and *Morchella* strains (F30, Y44, F52, Y61) were inoculated and cultured at 28°C in the dark for 28 h. The colony diameter of different fungi was measured to calculate their average growth rate.

[0165] SPSS 20.0 statistical software was used for analysis. Experimental data are expressed as mean ± standard deviation. The Tukey sb(K) test was used to test for data homogeneity, and the results are shown in Table 6.

[0166] Table 6. Growth rate (mm / h) of Sterculia ovale F4 under different fertilizer addition conditions.

[0167]

[0168] Note: Different letters indicate that the difference is significant at the P=0.05 level. In the table above, N: urea, NS: ammonium sulfate, Pca: monocalcium phosphate, PK: potassium dihydrogen phosphate, KCl: potassium chloride, and KS: potassium sulfate.

[0169] During the solid-state culture stage, the growth-promoting and balancing ratio between the target strain and the *Morchella* flora was considered, ensuring that the difference in strain ratio was within one order of magnitude, with a 1:1 ratio yielding the best results. Table 6 shows that potassium chloride provided the most balanced growth promotion for *Thiophanate-Oolong* F4 in the presence of *Morchella* strains. Based on the results of previous experiments, urea and potassium chloride are the preferred fertilizers.

[0170] Example 5

[0171] Liquid culture medium was prepared by adding 1.085 g of urea to 500 mL of PD medium. The glass chamber was removed, and the remaining inoculum size and culture conditions remained the same as in Example 4. A mixed bacterial culture (e.g., ...) was obtained. Figure 4 (as shown in b).

[0172] The preparation method of solid fermentation substrate is as follows: Cut wheat straw to a length of about 2cm or less, weigh 1000g of wheat straw, 100g of woody peat, 200g of soybean meal, 1.67g of potassium chloride, 0.96g of potassium dihydrogen phosphate and 10g of humic acid, mix them thoroughly, add water to make it moist but not dripping when squeezed by hand (moisture content of about 60%), put it into polypropylene bags (each bag contains about 100g of sample) and seal it, sterilize at 121℃ for 2h to obtain solid fermentation substrate.

[0173] Each bag of solid fermentation substrate was inoculated with 100 mL of mixed bacterial solution. After two days of static growth in a clean bench, it was placed in an indoor environment for seven days of static cultivation, maintaining the temperature between 20 and 28°C, until the mycelium completely covered the substrate, thus obtaining the compound bacterial agent (e.g. Figure 4 (as shown in c).

[0174] The combined inoculum of *Thiopyramidalis* F4 and *Morchella* strains under different culture media conditions, such as... Figure 4 As shown; where a represents the growth on potato dextrose agar (PDA), b represents the growth on liquid medium, and c represents the growth on solid fermentation substrate.

[0175] Test Example 4

[0176] Thirty rice seeds of variety Songliao 186 were selected, placed in a disposable petri dish, distilled water was added, and the petri dish was covered to keep the environment humid. The seeds were then cultured in an incubator for 3 days to promote germination.

[0177] Northeast saline-alkali soil was selected as the potting soil. The soil contained 0.47 g / kg total nitrogen, 46.50 mg / kg available nitrogen, 17.50 mg / kg available phosphorus, 153 mg / kg available potassium, 10.58 g / kg organic matter, pH 9.16, and 1.08 g / kg salt. 200 g of soil was sieved through a 2 mm sieve and placed in pots, with approximately 300 g of soil per pot. After thorough watering, rice seedlings with relatively uniform growth after germination were selected and sown into the soil at a depth of 5 mm. The sown rice was divided into a control group and an experimental group, with three replicates in each group. After one week of growth in an incubator, the rice was treated as described below.

[0178] Experimental group: Rice was inoculated with the compound microbial agent prepared in Example 5. The agent was inoculated into the rhizosphere of the rice plants, with about 5g of compound microbial agent inoculated per hole. After inoculation, the soil was covered with about 2cm of soil.

[0179] Control group: No compound bacterial strain was inoculated.

[0180] Each control and experimental group had three replicates, with one pot of rice per replicate. Each pot contained 15 rice plants inoculated at a depth of 1 cm. The plants were cultured under natural conditions. After 3 days, the seedlings were removed, leaving one seedling per pot. The entire process was repeated for 40 days. The rice growth was observed as follows: Figure 5 As shown, the left side represents the control group rice, and the right side represents the experimental group rice.

[0181] After cultivation, root scans were performed on rice in the experimental and control groups, and plant height, aboveground biomass, root proline content, root malondialdehyde content, root catalase content, and root superoxide dismutase content were measured. At the same time, the contents of ammonium nitrogen, available phosphorus, total nitrogen, and organic matter in non-rhizosphere soil were determined.

[0182] The root system was scanned using a root scanner.

[0183] Aboveground biomass was measured using the drying and weighing method.

[0184] The proline, malondialdehyde (MDA), catalase, and superoxide dismutase (SOD) contents in rice roots were determined using a kit (Suzhou Keming Biotechnology Co., Ltd.). Fresh samples were homogenized on ice, centrifuged at 8000g and 4℃ for 10 min, and the supernatant was collected. The experiments were performed according to the kit instructions, and the samples were allowed to stand at room temperature for 30 min before colorimetric analysis at 560 nm.

[0185] Superoxide dismutase activity U = [inhibition percentage ÷ (1 - inhibition percentage) × Vsample total] ÷ (W × Vsample ÷ Vsample total) = 11.11 × inhibition percentage ÷ (1 - inhibition percentage) ÷ W.

[0186] Wherein, the inhibition percentage = (A control tube - A test tube) ÷ A control tube × 100%.

[0187] In the formula:

[0188] Vreactiontotal: Total volume of the reaction system, 0.2 mL [volume of reaction in the well plate]

[0189] V sample: 0.018 mL of the sample volume added to the reaction system [tissue fluid after grinding and centrifugation].

[0190] V total: Add the extraction solution volume, 1 mL

[0191] W sample quality, g

[0192] The experimental data were analyzed using SPSS statistical software and expressed as mean ± standard deviation. The results are shown in Tables 7-10. "**" indicates significance at the 0.01 level, and "*" indicates significance at the 0.05 level.

[0193] Table 7. Rice root system measurement results

[0194]

[0195] Table 8. Rice biomass parameters for comparative and example studies.

[0196]

[0197] Table 9. Content of stress resistance indicators in rice root systems in comparative and example studies.

[0198]

[0199] Note: Definition of peroxidase: 1 unit of enzyme activity (U) is defined as the ability of 1 μmol of hydrogen peroxide to be catalyzed per minute per gram of tissue.

[0200] Table 10. Determination of relevant indicators in rice soil for the examples and comparative examples.

[0201]

[0202]

[0203] As shown in Tables 7-10, the root length, root surface area, root volume, number of root tips, and number of branches in the experimental group were significantly higher than those in the control group, increasing by 5.5 times, 7 times, 7 times, 3.5 times, and 6.5 times, respectively, indicating that the compound microbial system had a very strong promoting effect on rice root growth. Simultaneously, the root fresh weight, aboveground fresh weight, and plant height in the experimental group were also significantly increased, with increases of 62%, 84%, and 30%, respectively. The contents of superoxide dismutase and catalase in rice roots were significantly higher than those in the control group, indicating that the compound microbial system improved the antioxidant capacity of rice. There were no significant differences in the contents of ammonium nitrogen, total nitrogen, organic matter, and organic carbon in the soil of the experimental group compared to the control group, suggesting that the compound microbial system may promote rice growth through biostimulation.

[0204] High-throughput sequencing was used to determine the root zone microbial community structure of rice in Test Example 4 and the comparative example (Li, et al., 2020. Rare fungus, Mortierella capitata, promotes crop growth by stimulating primary metabolisms). The results are as follows: Figures 6-11 As shown.

[0205] For the bacterial component, the abundance of Proteobacteria, Rhodospirillaceae, Xanthomonadaceae, Phenylobacterium, Geobacter, Azospirillum, and Enhydrobacter increased in the experimental group. Proteobacteria, the most abundant phylum, increased by 6%, while Azospirillum and Enhydrobacter showed the largest relative increases, increasing 20-fold. For the fungal component, the abundance of various fungi differed significantly between the control and experimental groups at all three taxonomic levels. The abundance of Mortierellomycota and Mortierellaceae, which were relatively low in the control group, increased dramatically in the examples, increasing 6-fold and 3-fold, respectively. The abundance of Basidiomycota, Agaricomycetes, Pseudeurotiaceae, and the genera *Pseudeurotium* and *Coprinus*, which constituted a large proportion of the species, was significantly reduced in the experimental group. Among them, *Azospirillum* can bind with the rhizosphere to fix nitrogen, increasing plant height, promoting plant development, enhancing crop salt tolerance, and improving yield (Cassán et al., 2020. Everything you must know about Azospirillum and its impact on agriculture and beyond. Biology and Fertility of Soils 56, 461–479.). Aquatic bacteria can produce cellulase and chitinase, promoting the degradation of carbohydrates (Hao Zhikui, Wu Hangui, Xi Limin, 2013. Screening and identification of chitinase-producing Enhydrobacter sp. MBRH2 strains, The 8th National Symposium on Medical Biochemistry and Molecular Biology and The 5th National Symposium on Clinical Application of Biochemistry and Molecular Biology in East China, Qingdao, Shandong, China, p.1.; Premalatha et al., 2015. Optimization of cellulase production by Enhydrobacter sp. ACCA2 and its application in biomass saccharification. Frontiers in Microbiology 6.).Mortierellaceae species promote nitrogen and phosphorus absorption in plants, synthesize plant hormones, and protect plants from pathogens (Ozimek and Hanaka, 2021. Mortierella species as the plant growth-promoting fungi present in the agricultural soils, Agriculture.). Therefore, the fertilizer prepared in this invention has advantages over the comparative example in promoting root growth and plant development, and improving plant resistance to salinity and pathogens.

[0206] Test Example 5

[0207] A field trial was conducted in June 2023 at the North China Wheat-Maize Rotation Nutrition and Fertilization Scientific Observation and Experiment Station of the Ministry of Agriculture and Rural Affairs. Maize seeds of the variety Yudan 132 were selected. Six ponds were set up in the field, with five rows planted in each pond, approximately 30 holes per row, alternating between odd and even rows. The ponds were divided into a control group and an experimental group, with three ponds in each group, and the following treatments were applied:

[0208] Experimental group (M+F4): Corn was inoculated with a compound microbial agent that had been cultured for 5 days at the five-leaf stage. The agent was applied in holes, reaching the root zone of the corn plants, with approximately 100g of the compound microbial agent per hole. After inoculation, the holes were covered with old straw. This experiment was conducted in three parallel groups with three ponds.

[0209] Control group (CK): No combined bacterial agent was inoculated; all other conditions were the same as the experimental group. This experiment was conducted with three parallel groups in three pools.

[0210] The effects of the F4 strain and the combined strain of *Morchella* on soil chemical properties, plant traits, root hormones, soil physical properties at maturity, and plant yield were investigated during the tasseling stage of maize in the field. The results are shown in Tables 11-15. "**" indicates significance at the P=0.01 level, and "*" indicates significance at the P=0.05 level.

[0211] Table 11 Effects of F4 and the combined strain of *Morchella* on soil chemical properties

[0212]

[0213] Table 12 Effects of microbial inoculation on soil physical properties

[0214]

[0215]

[0216] Table 1. Effects of 3F4 combined with Mucor on plant traits.

[0217]

[0218] Table 14. Effects of F4 and Mucor spore-associated strains on root hormone levels.

[0219]

[0220] Table 15. Effects of F4 and the combined strain of *Morchella* on yield indicators.

[0221]

[0222] As shown in Tables 11-15, inoculation with the microbial agent significantly increased soil nitrate nitrogen content, with an increase of up to 77.74%. Analysis of soil physical properties revealed that inoculation significantly increased the proportion of aggregates in the soil samples, while reducing the proportion of micro-aggregates and macro-aggregates. Plant phenotypic observations showed that inoculation significantly increased the proportions of fresh weight of maize leaves, total fresh weight, plant height, and stem diameter by 49.10%, 50.10%, 10.60%, and 19.56%, respectively. This directly indicates that inoculation with the microbial agent is beneficial to maize plant growth. Measurements of hormone content in maize roots revealed significant increases in abscisic acid (ABA), auxin (IAA), jasmonic acid (JA), and zeatin (ZR), indicating that the combined effect of inoculation with the microbial agent provides endogenous assistance to the improvement of drought resistance and growth capacity in maize. Inoculation with the combined bacteria significantly increased the average number of ears per plant by 15%, and also significantly improved the 100-kernel weight, number of kernels per ear, and fresh weight of corn ears, indicating that inoculation with the inoculant increases corn yield by increasing the number of kernels per ear and the 100-kernel weight.

[0223] Sampling was conducted at maturity to assess the growth status of the corn plants. Figure 12 As shown, the left side represents the control group corn, and the right side represents the experimental group corn. High-throughput sequencing was used to determine the microbial community structure of the corn root zone. The abundance of fungi and bacteria in the corn root zone is shown in the figure below. Figures 13-18 As shown.

[0224] Depend on Figures 13-18It can be seen that, in the bacterial component, compared with the comparative example, the relative abundance of the most dominant bacterial groups at all three taxonomic levels—Firmicutes, Bacillaceae, and Bacillus—increased, while the abundance of the second most dominant bacterial groups—Proteobacteria, Sphingomonadaceae, and Sphingomonas—decreased by about 20%. Among these, the relative abundance of Plantococceae and Paenisporosarcina showed the largest increases, increasing by 3-fold and 11-fold, respectively. In the fungal component, compared with the comparative example, the relative abundance of Ascomycota, Chaetomiaceae, and Acrophialophora increased significantly in the examples, with Acrophialophora showing the largest increase, increasing by 15-fold. Meanwhile, the reduction in Basidiomycota was significant in the examples, decreasing by 57%. Among them, the antibacterial substances produced by Bacillaceae can control various plant diseases and also possess biological activities such as phosphorus solubilization, potassium solubilization, and nitrogen fixation, which are beneficial to increasing crop yield (Su et al., 2020. Bacillus subtilis: a universal cell factory for industry, agriculture, biomaterials and medicine. Microbial Cell Factories 19, 173.). Paenisporosarcina can significantly inhibit the growth of the root rot pathogen Rhizoctonia solani (Wang et al., 2021. Volatile organic compounds from rice rhizosphere bacteria inhibit growth of the pathogen Rhizoctonia solani, Agriculture.). Acrophialophora exhibits strong antagonistic effects against seven pathogens, including *Acrophialophora spp.*, and shows a certain degree of control over root rot in *Saposhnikovia divaricata* (Han et al. A strain of *Acrophialophora* MR-57 and its application, p. 22). Therefore, the fertilizer prepared in this invention has advantages over the comparative example in improving plant disease resistance and promoting plant growth.

[0225] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A strain of *Thiosporium ovale* ( Gongronella butleri F4, deposited at the China Microbial Culture Collection Center, accession number CGMCC No. 40972.

2. The use of *Thiophanate-Ovoopodioides* F4 as described in claim 1 in any one or more of the following: (1) Promotes straw degradation; (2) Promotes the increase of phosphorus availability in the soil; (3) Improve the structure of the rhizosphere soil microbial community and promote plant growth.

3. The application according to claim 2, characterized in that, The plants include one or more of wheat, corn, and rice.

4. A compound microbial agent, characterized in that, The compound microbial agent includes *Thiopyroxon ovalis* F4 and *Morchella* strains; The *Cyclocarya ovalis* F4 strain is deposited at the China Microbial Culture Collection Center, with accession number CGMCC No. 40972. The *Morchella* fungal strain includes *Morchella* (… Mortierella elongata ), Alpine spores ( Mortierella alpina ), Unnamed Species ( Mortierella sp. ) and Cephalosporium ( Mortierella capitata ).

5. The compound microbial agent according to claim 4, characterized in that, The concentration of the *Cyclocarya ovalis* was 2-3 × 10⁻⁶. 7 / g of compound microbial agent, wherein the concentrations of *Morchella spp.*, *Morchella alpineensis*, *Morchella unidentified*, and *Cephalospora* are 2~10×10⁻⁶. 6 / g compound microbial agent.

6. The method for preparing the compound microbial agent according to claim 4 or 5, characterized in that, Includes the following steps: The *Typha orientalis* F4 strain and *Morchella* strain were mixed and cultured on a large scale to obtain a mixed bacterial solution; The mixed bacterial solution was inoculated into a fermentation substrate for fermentation culture to obtain a compound bacterial agent; The ratio of viable bacteria counts when inoculating *Typhae ovalis* F4, *Metroxylum bungeanum*, *Metroxylum alpineum*, *Metroxylum unnamed* and *Cephalospora* is 2-5:1:1:1:1; By weight, the fermentation substrate comprises 1000 parts wheat straw, 80-120 parts woody peat, 180-220 parts soybean meal, 1.67-2.00 parts potassium chloride, 0.96-1.10 parts potassium dihydrogen phosphate, and 6-12 parts humic acid; the moisture content of the fermentation substrate is 35%-45%.

7. The preparation method according to claim 6, characterized in that, The expanded culture involves mixing *Thiopyroxon ovalis* F4 and *Morchella* strains and inoculating the mixture onto a culture medium, wherein the ratio of *Thiopyroxon ovalis* F4 to the culture medium is 10:

1. 7 ~10 9 CFU / mL culture medium.

8. The preparation method according to claim 6, characterized in that, The ratio of the mixed bacterial solution to the fermentation substrate is 10 mL: 100 g; the concentration of the mixed bacterial solution is 10. 9 CFU / mL culture medium.

9. The preparation method according to claim 6, characterized in that, The expansion culture was carried out at a temperature of 25°C and a rotation speed of 180 rpm for 5 days; the fermentation culture was carried out at a temperature of 20-28°C for 7 days.

10. The use of the compound microbial agent according to claim 4 or 5, or the compound microbial agent prepared by the preparation method according to any one of claims 6 to 9, in any one or more of the following: (1) Increase the nitrogen and available phosphorus content in the soil; (2) Increase the species abundance of beneficial bacteria in the soil; (3) Promotes plant growth and increases crop yield; (4) Improve plant disease resistance and stress resistance.

Citation Information

Patent Citations

  • Gongronellabutleri NL-15 fungus capable of efficiently eroding limestone and application thereof

    CN103087926A

  • Bacterial strain of Mortierella elongate and application thereof

    CN107760610A

  • Mortierella cepitata, microbial inoculum containing mortierella cepitata as well as preparation method and application of microbial inoculum

    CN110747133A

  • A strain of *Morchella alpineensis* 0901, its applications, and fungal agents.

    CN110819539B

  • A strain of Pteris grisea F27, a fungal agent and its application in agriculture

    CN115873721B