A nicotinamide mononucleotide adenyltransferase mutant and use thereof
Patent Information
- Application Number
- CN202410142855.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-02-01
- Publication Date
- 2026-09-18
- Estimated Expiration
- 2044-02-01
AI Technical Summary
[0007]为了解决上述的烟酰胺单核苷酸腺苷转移酶的催化效率低的技术问题,本发明提供了一种烟酰胺单核苷酸腺苷转移酶突变体及其应用
(1)本发明将烟酰胺单核苷酸腺苷转移酶的氨基酸序列进行了以下位点单点突变或组合突变得到:(1)第97位丝氨酸S突变为丙氨酸A;(2)第10位谷氨酰胺Q突变为丙氨酸A;(3)第119位苯丙氨酸F突变为色氨酸W。本发明提供的烟酰胺单核苷酸腺苷转移酶突变体活性、催化效率均较野生型都有显著的提高。
Smart Images

Figure CN117946998B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic engineering technology, and in particular to a nicotinamide mononucleotide adenosine transferase mutant and its applications. Background Technology
[0002] Nicotinamide adenine dinucleotide (NAD) is an important coenzyme and a crucial molecule in all living cells. Its phosphorylated and reduced forms (NADP, NADH, and NADPH) can accept and supply hydrides in living organisms, act as electron carriers, participate in various enzymatic redox reactions, play this important role in cellular metabolism and energy production, and serve as a substrate for NAD-dependent signal transduction.
[0003] L-Glufosinate (L-PPT) is a widely used broad-spectrum non-selective herbicide worldwide, characterized by its broad range of action, low toxicity, high efficiency, and good environmental compatibility. High-efficiency production of L-PPT can be achieved by exogenously adding NAD, which gradually participates in the reaction through a multi-enzyme cascade catalysis of PPO.
[0004] There are chemical and biological methods for synthesizing NAD. Chemical synthesis has several drawbacks, such as: cumbersome processes, long reaction cycles, complex purification procedures, low product purification rates, and low yields. Furthermore, chemical processes involve numerous silica gel column and chromatographic column procedures, which are time-consuming and limit its industrial applications.
[0005] The biosynthesis of NAD includes yeast fermentation and enzymatic synthesis. Chinese patent application CN112322511A discloses that Huzhou Yisheng Biotechnology Co., Ltd. obtained a vigorous, high-yielding NAD-producing mutant strain using UV mutagenesis, starting with an NAD-producing yeast strain. This mutant strain was inoculated into 50 mL of optimized fermentation medium with added exogenous substrates (inosine 3 g / L, nicotinamide Nm 6 g / L) and cultured at 30°C and 220 rpm for 3 days. Fermentation was then stopped, ultimately yielding a fermentation broth containing 40.65 g (kg DCW) of NAD. However, yeast cell fermentation has the following drawbacks: yeast grows slowly, and the long fermentation cycle leads to low production efficiency; moreover, NAD is mainly found in the mitochondria of yeast cells, and the production of NAD by yeast cell fermentation requires cell wall disruption and purification. Commonly used cell wall disruption methods include temperature difference method (heat treatment method) and high pressure homogenization method. Temperature difference method has unsatisfactory cell wall disruption effect, and high pressure homogenization method is not suitable for large-scale industrial production. The commonly used purification method is column elution, but the elution process is cumbersome and time-consuming, which is not conducive to industrial production, and the NAD purity and yield are low.
[0006] Therefore, in vitro enzymatic synthesis has become a commonly used method for preparing NAD. However, the insufficient catalytic efficiency of nicotinamide mononucleotide adenosyltransferase (NMN) currently hinders its industrial application in NAD production. Providing a highly efficient NMN mononucleotide adenosyltransferase is of great significance for increasing NAD yield, reducing enzyme dosage, lowering NAD production costs, and enabling the widespread industrial application of NAD in various redox reactions. Summary of the Invention
[0007] To address the aforementioned technical problem of low catalytic efficiency of nicotinamide mononucleotide adenosyltransferase, this invention provides a nicotinamide mononucleotide adenosyltransferase mutant and its applications. This invention obtains the nicotinamide mononucleotide adenosyltransferase by performing single-point or combined mutations at the following sites in its amino acid sequence: (1) serine at position 97 (S) is mutated to alanine (A); (2) glutamine at position 10 (Q) is mutated to alanine (A); and (3) phenylalanine at position 119 (F) is mutated to tryptophan (W). This yields a nicotinamide mononucleotide adenosyltransferase mutant with high catalytic efficiency.
[0008] The specific technical solution of this invention is as follows: In a first aspect, the present invention provides a nicotinamide mononucleotide adenosine transferase mutant.
[0009] The nicotinamide mononucleotide adenosine transferase mutant provided by the present invention is obtained by single-point mutation or combination mutation at the following sites of the nicotinamide mononucleotide adenosine transferase with the amino acid sequence shown in SEQ ID NO.1: (1) the serine S at position 97 is mutated to alanine A; (2) the glutamine Q at position 10 is mutated to alanine A; (3) the phenylalanine F at position 119 is mutated to tryptophan W.
[0010] This invention obtained nicotinamide mononucleotide adenosyltransferase by performing single-point or combined mutations at the following sites in its amino acid sequence: (1) serine at position 97 (S) was mutated to alanine (A); (2) glutamine at position 10 (Q) was mutated to alanine (A); and (3) phenylalanine at position 119 (F) was mutated to tryptophan (W). The nicotinamide mononucleotide adenosyltransferase mutant provided by this invention exhibits significantly improved activity and catalytic efficiency compared to the wild type.
[0011] Nicotinamide mononucleotide adenosyltransferase (NMNAT) is derived from Methanococcus japonicus, and its amino acid sequence is shown in SEQ ID NO.1 and its nucleotide sequence is shown in SEQ ID NO.2.
[0012] Secondly, the present invention provides the encoding gene of the above-mentioned nicotinamide mononucleotide adenosine transferase mutant.
[0013] Based on the nicotinamide mononucleotide adenosine transferase mutant provided by this invention, the gene encoding the leucine dehydrogenase mutant should still fall within the protection scope of this invention.
[0014] As a preferred embodiment of the above-mentioned gene encoding technology of the present invention, the nucleotide sequence of the gene encoding is shown in SEQ ID NO.4.
[0015] Thirdly, the present invention provides a recombinant expression vector carrying the gene encoding the above-mentioned nicotinamide mononucleotide adenosine transferase mutant.
[0016] A recombinant expression vector is a DNA molecule used to introduce a foreign gene into a host cell for expression. Based on the nicotinamide mononucleotide adenosyltransferase mutant nucleotide sequence provided by the present invention, the recombinant expression vector can be constructed by linking the nicotinamide mononucleotide adenosyltransferase mutant nucleotide sequence of the present invention to various vectors using conventional methods in the art. Various conventional vectors in the art, such as various plasmids, bacteriophages, or viral vectors, linked to the nicotinamide mononucleotide adenosyltransferase mutant nucleotide sequence of the present invention, should all fall within the scope of protection of the present invention.
[0017] Further preferably, the recombinant expression vector is a plasmid, bacteriophage, or viral vector.
[0018] Fourthly, the present invention provides a host cell carrying the above-mentioned nicotinamide mononucleotide adenosine transferase mutant encoding gene or recombinant expression vector.
[0019] Fifthly, the present invention provides the application of the above-mentioned nicotinamide mononucleotide adenosyltransferase mutant in the preparation of nicotinamide adenine dinucleotide.
[0020] Further preferably, the method of application includes the following steps: (1) The nicotinamide mononucleotide adenosine transferase mutant was covalently cross-linked onto a carrier with glutaraldehyde to obtain an immobilized enzyme; (2) Nicotinamide mononucleotide and adenosine triphosphate were used as substrates and the immobilized enzyme obtained in step (1) was used as a catalyst to catalyze the preparation of nicotinamide adenine dinucleotide.
[0021] In a sixth aspect, the present invention provides the application of the above-mentioned nicotinamide mononucleotide adenosyltransferase mutant in the preparation of L-glufosinate.
[0022] Further preferably, the method of application is as follows: using L-glufosinate precursor 2-carbonyl-4-[hydroxy(methyl)phosphono]butyric acid (PPO) as substrate and ammonium formate as co-substrate, and using a multi-enzyme system as catalyst to prepare L-glufosinate, wherein the multi-enzyme system includes glutamate dehydrogenase, formate dehydrogenase, nicotinamide adenine dinucleotide kinase, and the above-mentioned nicotinamide mononucleotide adenosine transferase mutant.
[0023] Compared with the prior art, the present invention has the following technical effects: (1) The present invention obtained the nicotinamide mononucleotide adenosyltransferase by performing single-point mutations or combination mutations at the following sites in the amino acid sequence: (1) the serine S at position 97 was mutated to alanine A; (2) the glutamine Q at position 10 was mutated to alanine A; and (3) the phenylalanine F at position 119 was mutated to tryptophan W. The nicotinamide mononucleotide adenosyltransferase mutant provided by the present invention has significantly improved activity and catalytic efficiency compared with the wild type.
[0024] (2) The nicotinamide mononucleotide adenosine transferase mutant provided by the present invention can catalyze the generation of nicotinamide mononucleotide NMN (160mM-500mM) into nicotinamide adenine dinucleotide NAD. It has good substrate tolerance, high catalytic efficiency, and short reaction time, which saves costs for the biosynthesis of nicotinamide adenine dinucleotide and improves the market competitiveness of the product.
[0025] (3) The present invention immobilizes the nicotinamide mononucleotide mutant, which improves the stability of the enzyme and effectively avoids the influence of high concentrations of NMN and ATP on the enzyme; it can realize the enzyme's multiple recycling and reuse, improves the enzyme's utilization efficiency, and reduces the enzyme's utilization cost; the enzyme can be strongly bound to the carrier and is not easy to separate, and the immobilized enzyme is easy to separate from the reaction system, avoiding the problem of the enzyme detaching from the carrier and introducing new impurities into the reaction system, simplifying the product purification process and improving the purity of the product.
[0026] (4) The high concentration of NAD generated by this invention can fully meet the problem of insufficient coenzyme in the process of multi-enzyme catalytic asymmetric reduction amination of PPO to generate L-glufosinate. Attached Figure Description
[0027] Figure 1 This is a schematic diagram of the reaction catalyzed by nicotinamide mononucleotide adenosine transferase to generate NAD from substrates NMN and ATP-Na2. Detailed Implementation
[0028] The present invention will be further described below with reference to embodiments. Those skilled in the art will be able to implement the present invention based on these descriptions. Furthermore, the embodiments of the present invention described below are generally only some, not all, of the embodiments of the present invention. Therefore, all other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort should fall within the scope of protection of the present invention.
[0029] The reaction formula for the production of NAD from substrates NMN and ATP-Na2 catalyzed by nicotinamide mononucleotide adenosyltransferase is as follows: Figure 1 As shown.
[0030] In this embodiment of the invention, the reagents used in upstream genetic engineering were as follows: Phanta Super-Fidelity DNA Polymerase was purchased from Nanjing Novizan Biotechnology Co., Ltd.; Dpn I was purchased from Thermo Scientific. The Plasmid Miniprep Kit and PCR Clean-up Kit were purchased from AxyPrep; the ClonExpressII One Step Cloning Kit was purchased from Nanjing Novizan Biotechnology Co., Ltd. E.coli BL21 (DE3) was purchased from Shanghai Xuguan Biotechnology Development Co., Ltd.; DNA markers, low molecular weight standard proteins, protein gels, etc., were purchased from Beijing Gen Star Co., Ltd.; recombinant plasmid construction, primer synthesis, and sequence sequencing were performed by Hangzhou Qingke Zixi Biotechnology Co., Ltd. D-amino acid dehydrogenase was produced by Hunan Fulaige Biotechnology Co., Ltd., and other commonly used reagents were purchased from Sinopharm Chemical Reagent Co., Ltd. Refer to the product instructions for the usage of the above reagents.
[0031] Example 1: Construction of a genetically engineered bacterium carrying nicotinamide mononucleotide adenosine transferase Methanococcus japonicus (from Janus) Methanococcus jannaschii The gene sequence (NCBI accession number WP-010870045) was codon-optimized and sent to Sangon Biotech (Shanghai) Co., Ltd. for whole-genome synthesis, and cloned into the recombinant expression plasmid pET-28a(+). The codon-optimized NADH kinase gene sequence is shown in SEQ ID No. 2. To verify the correctness of the synthesized amino acid sequence, resequencing is required.
[0032] Example 2 Construction of a nicotinamide mononucleotide adenosyltransferase mutant library In the first round, the preserved bacterial culture was inoculated into test tubes for culture, and plasmids were extracted as templates for nicotinamide mononucleotide adenosine transferase site-directed mutagenesis PCR. Site-directed mutagenesis PCR was performed using F-S97A and R-S97A primers from Table 1. PCR products were transformed, plated, and the S97A mutant was obtained through screening and named S97A.
[0033] In the second round, site-directed mutagenesis PCR was performed using S97A as a template and F-Q10A and R-Q10A from Table 1 as primers. The PCR products were transformed, plated, and screened to obtain the S97A mutant and the Q10A mutant, which were named S97A-Q10A.
[0034] The third round of site-directed mutagenesis PCR was performed using S97A-Q10A as a template and F-F119W and R-F119W from Table 1 as primers. The PCR products were transformed, plated, and screened to obtain the S97A mutant, the Q10A mutant, and the F119W mutant, named S97A-Q10A-F119W. The nucleotide sequence of the mutant S97A-Q10A-F119W is shown in SEQ ID NO.4, and the amino acid sequence is shown in SEQ ID NO.3.
[0035] Table 1 Primer Sequences F-S97A TTCGACATCGTATACGCAGGTAATCCACTGGTACGT R-S97A GTATACGATGTCGAACGGCGGA F-Q10A TCATCATCGGTCGTTTCGCACCATTCCACAAAGGTCAC R-Q10A GAAACGACCGATGATGAAGCCAC F-F119W GGTTAAACGTCCGGAAATGTACAACCGCAAAGAATA R-F119W CATTTCCGGACGTTTAACCTCGTAACC The PCR system was as follows: 2×PhantaMax buffer: 25 μL; dNTPs: 1 μL; upstream primer: 2 μL; downstream primer: 2 μL; template: 1 μL; Phanta Super-Fidelity DNA polymerase: 1 μL; ddH₂O: 18 μL. The one-step cloning system consisted of: plasmid linearization purification product: 1 μL; NADH kinase amplification purification product: 1 μL. The plasmid linearization PCR reaction conditions were as follows: pre-denaturation at 95℃ for 5 min; denaturation at 95℃ for 15 s, annealing at 59℃ for 30 s, extension at 72℃ for 3 min, for a total of 30 cycles; final extension at 72℃ for 10 min; storage at 4℃. The NADH kinase amplification PCR reaction conditions were as follows: pre-denaturation at 95℃ for 5 min; denaturation at 95℃ for 15 s, annealing at 59℃ for 30 s, extension at 72℃ for 1 min 30 s, for a total of 30 cycles; final extension at 72℃ for 10 min; storage at 4℃. The one-step cloning reaction conditions were as follows: 37℃ for 30 min, then stored at 4℃. PCR results were verified by DNA agarose gel electrophoresis, showing a single amplification band, with the linearized plasmid band at approximately 3500 bp and the NADH kinase amplification band at approximately 1500 bp.
[0036] The PCR reaction system was as follows: 2×Phanta Max buffer: 25 μL; dNTPs: 1 μL; upstream primer: 2 μL; downstream primer: 2 μL; template: 1 μL; Phanta Super-Fidelity DNA polymerase: 1 μL; ddH2O: 18 μL.
[0037] PCR reaction conditions: pre-denaturation at 95℃ for 5 min; denaturation at 95℃ for 15 s, annealing at 59℃ for 30 s, extension at 72℃ for 5 min, for a total of 30 cycles; final extension at 72℃ for 10 min; store at 4℃.
[0038] The PCR results were verified by DNA agarose gel electrophoresis. The results showed that the amplification product was a single band with a size of about 5000 bp. The PCR product was then digested with DpnI enzyme to digest the template.
[0039] Example 3 Large-scale preparation of bacterial cells Because the conversion of β-nicotinamide mononucleotide to nicotinamide adenine dinucleotide requires a large amount of biocatalyst, large-scale preparation using bacterial cells is necessary. The specific preparation method is as follows: Single colonies of the preserved nicotinamide mononucleotide adenosyltransferase were inoculated into 10 mL of LB liquid medium containing 50 μg / mL ampicillin resistance and cultured at 37°C with shaking for 12 h. Then, a 2% inoculum was transferred to 50 mL of TB liquid medium also containing 50 μg / mL ampicillin resistance and cultured at 37°C with shaking until OD... 600 When the concentration reaches approximately 0.8, add IPTG to a final concentration of 0.1 mM and incubate with shaking at 24°C for 12 hours. After incubation, centrifuge the culture medium at 8000 rpm for 10 minutes, discard the supernatant, collect the bacterial cells, and store them at -20°C for later use.
[0040] Engineered bacterial cells co-expressing glutamate dehydrogenase, formate dehydrogenase, and nicotinamide adenine dinucleotide kinase were also prepared using the above method.
[0041] Example 4: Determination of the activity of wild-type and mutant nicotinamide mononucleotide adenosyltransferase The activity of wild-type nicotinamide mononucleotide adenosyltransferase was determined as follows: (1) Prepare the substrate solution: The final concentration of the substrate solution system is 200mM NMN, 300mM ATP-Na2, and 300mM MgCl2. Adjust the pH of the substrate solution system to 7.5 with ammonia water, and make up the volume with 200mM PB buffer.
[0042] (2) Preparation of whole cell solution: Weigh a certain mass of the bacterial cells placed in a -20℃ freezer, and resuspend the bacterial cells in 200mM PB buffer to obtain a whole cell suspension with a final bacterial cell concentration of 10g / L.
[0043] (3) Reaction system and conditions: Take 500 μL of substrate solution into a 2 mL EP tube, and add 500 μL of 10 g / L parent strain whole cells (wild type) NMNAT-pet28a(+) and react at 37℃ and 600 rpm for 10 min.
[0044] (4) Termination of reaction: Take 100µL of sample into a 1.5mL EP tube containing 5µL of 6M HCl to terminate the reaction, and then centrifuge at 12000rpm for 2min to collect the supernatant.
[0045] (5) Sample preparation: Take the supernatant and dilute it 200 times, then remove impurities from the diluted sample using a 0.22µm filter.
[0046] (6) NAD concentration was determined by HPLC: Liquid chromatography method: UV wavelength 260nm, column temperature 40℃, retention time 10min; mobile phase is 50mM PB: pure methanol = 94:6 (V:V).
[0047] (7) Definition of enzyme activity unit: Under the above reaction conditions, the amount of enzyme required to catalyze the production of 1 μmol NAD from NMN and ATP per minute is defined as one enzyme activity unit (U).
[0048] (8) Specific enzyme activity (U / mg): The number of enzyme activities contained in each milligram of wet bacterial cells. The steps and methods for determining the enzyme activity of nicotinamide mononucleotide adenosine transferase mutants are the same as those for determining the enzyme activity of wild-type mutants.
[0049] The comparative experiment on the relative activities of nicotinamide mononucleotide adenosine transferase parents (wild type) and mutants showed that the mutant enzyme activity was significantly increased. The relative enzyme activity of the S97A mutant was increased by 223%, the Q10A mutant by 180%, and the F119W mutant by 120%. The relative enzyme activity of mutants obtained after single-point mutation was increased by 67%-123%. The relative enzyme activity of the S97A-Q10A mutant was increased by 320%, the Q10A-F119W mutant by 234%, and the S97A-F119W mutant by 220%. The relative enzyme activity of two-point superimposed mutations was increased by 120%-320%. The enzyme activity of the three-point superimposed mutation (mutant S97A-Q10A-F119W) was increased by 633%.
[0050] Example 5: Application of mutant S97A-Q10A-F119W in the catalytic preparation of NAD from 160mM NMN. The molar concentration ratios of the various substances in the 10 mL reaction system were as follows: NMN:ATP-Na2:MgCl2 = 1:1.5:1.5, with a final NMN concentration of 160 mM, a final ATP-Na2 concentration of 240 mM, and a final MgCl2 concentration of 240 mM. The substrate solution was adjusted to pH 7-8 with ammonia. The bacterial cells were resuspended in 200 mM pH 7.5 PB buffer, and 5 mL of 20 g / L resuspended cells were added. The reaction system was carried out on a metal bath at 40℃ and 600 rpm. A 100 μL sample was taken every 30 min. For sample processing, 5 μL of 6 M HCl was added to terminate the reaction. The mixture was centrifuged at 12000 rpm for 2 min, and the supernatant was collected and diluted with ultrapure water. After dilution, the solution was filtered through a 0.22 μm aqueous filter membrane. HPLC was used to detect the consumption of the substrate NMN and the formation of the product NAD.
[0051] The variant enzyme S97A-Q10A-F119W generated 159 mM NAD after 2 hours of reaction, achieving a molar conversion of 99% to NMN, while the wild-type enzyme generated 147.47 mM NAD after 4 hours of reaction, achieving a molar conversion of 92% to NMN.
[0052] Example 6: Application of mutant S97A-Q10A-F119W in the catalytic preparation of NAD from 300mM NMN The molar concentration ratios of the various substances in the 10 mL reaction system were as follows: NMN:ATP-Na2:MgCl2 = 1:1.5:1.5, with a final concentration of 300 mM for NMN, 450 mM for ATP-Na2, and 450 mM for MgCl2. The substrate solution was adjusted to pH 7-8 with ammonia. The bacterial cells were resuspended in 200 mM pH 7.5 PB buffer, and 5 mL of 20 g / L resuspended cells were added. The reaction system was carried out in a metal bath at 40℃ and 600 rpm. A 100 μL sample was taken every 30 min. For sample processing, 5 μL of 6 M HCl was added to terminate the reaction. The sample was centrifuged at 12000 rpm for 2 min, and the supernatant was collected and diluted with ultrapure water. After dilution, the sample was filtered through a 0.22 μm aqueous filter. HPLC was used to detect the consumption of the substrate NMN and the formation of the product NAD.
[0053] The mutant enzyme S97A-Q10A-F119W produced 256 mM NAD after 2 hours of reaction, with a molar conversion rate of 86% for NMN; while the wild-type enzyme produced 187 mM NAD after 4 hours of reaction, with a molar conversion rate of 62% for NMN.
[0054] Example 7: Application of mutant enzyme S97A-Q10A-F119W in the catalytic preparation of NAD from 500mM NMN. The molar concentration ratios of the various substances in the 10 mL reaction system were as follows: NMN:ATP-Na2:MgCl2 = 1:1.5:1.5, with a final NMN concentration of 500 mM, a final ATP-Na2 concentration of 750 mM, and a final MgCl2 concentration of 750 mM. The substrate solution was adjusted to pH 7-8 with ammonia. The bacterial cells were resuspended in 200 mM pH 7.5 PB buffer, and 5 mL of 20 g / L resuspended cells were added. The reaction system was carried out on a metal bath at 40 °C and 600 rpm. 100 μL samples were taken every 30 min. For sample processing, 5 μL of 6 M HCl was added to terminate the reaction. The mixture was centrifuged at 12000 rpm for 2 min, and the supernatant was collected and diluted with ultrapure water. After dilution, the mixture was filtered through a 0.22 μm aqueous filter membrane. HPLC was used to detect the consumption of the substrate NMN and the formation of the product NAD.
[0055] The mutant enzyme S97A-Q10A-F119W generates 390 mM NAD after 2 hours of reaction, with a molar conversion rate of 78% for NMN; while the wild-type enzyme generates 220 mM NAD after 4 hours of reaction, with a molar conversion rate of 62% for NMN.
[0056] Example 8 Preparation of an immobilized nicotinamide mononucleotide adenosine transferase mutant S97A-Q10A-F119W The preparation process of the immobilized nicotinamide mononucleotide adenosine transferase mutant NMNAT-Q10A / S97A includes the following steps: Step 1: Soak microcrystalline cellulose in a 2% (w / w) glutaraldehyde solution for 1 hour to obtain an activated solution; filter the activated solution through a 5µm filter to obtain activated microcrystalline cellulose. Step 2: Wash the activated microcrystalline cellulose with 500 mL of 0.2 mol / L sodium dihydrogen phosphate. After washing, mix the activated microcrystalline cellulose with the crude enzyme solution of mutant S97A-Q10A-F119W, making the mass ratio of microcrystalline cellulose to crude enzyme 5:1 to obtain a mixed system. Mix the mixed system with 0.2 mol / L sodium dihydrogen phosphate solution at a volume ratio of 1:1 to obtain an immobilized system. Adjust the pH of the immobilized system to 8.0 using 1 mol / L potassium hydroxide solution. Incubate the immobilized system at 10℃ and 100 rpm for 4 hours to obtain an immobilized system. Filter the immobilized system through a 5 µm filter to obtain the crude enzyme product of immobilized mutant S97A-Q10A-F119W.
[0057] Step 3: The immobilized nicotinamide mononucleotide adenosine transferase mutant S97A-Q10A-F119W crude enzyme product was washed with 500 mL of 0.2 mol / L sodium dihydrogen phosphate solution. After washing, it was shaken at 150 rpm for 50 min with 500 mL of 0.2 M sodium dihydrogen phosphate solution containing 0.5 mol / L NaCl. After shaking, it was filtered through a 5 μm filter. After filtration, it was washed again with 0.2 mol / L sodium dihydrogen phosphate. After washing, it was dried to obtain the immobilized nicotinamide mononucleotide adenosine transferase mutant S97A-Q10A-F119W.
[0058] Example 9 Enzyme activity assay of immobilized nicotinamide mononucleotide adenosine transferase mutant S97A-Q10A-F119W The enzyme activity assay of the immobilized nicotinamide mononucleotide adenosine transferase mutant S97A-Q10A-F119W was performed according to the following steps: (1) The reaction system (10 mL) was determined as follows: 200 mM NMN, 300 mM ATP, 300 mM MgCl2, 200 mM PB sodium salt buffer at pH 7.5, and 10 g of immobilized enzyme GD-X.
[0059] (2) After preparing the above reaction system, gently shake to mix, react at 40℃ and 600rpm, and take a sample after 30min. Control the conversion rate of NMN at 10%-20%.
[0060] (4) Add 5 μL of 6M HCl to the sample to terminate the reaction. Take the supernatant and dilute it with ultrapure water at a certain ratio of 400 times. Then filter it with a filter membrane.
[0061] (5) Liquid chromatography method: QSC18, 5 μm, 4.6×250 mm, column temperature set at 40℃, mobile phase 50mM K2PO4:methanol=94:6 (v:v), flow rate set at 1mL / min, UV detection wavelength 260nm, retention time 10min.
[0062] (6) After each reaction, the reaction solution was filtered through a 5μm filter screen, and the immobilized enzyme was collected again for the next reaction. A total of 30 catalytic reactions were carried out. The enzyme activity was measured after each catalytic reaction, and the highest enzyme activity was defined as 100%. The relative enzyme activity of the immobilized enzyme GD-X after 10 repeated reactions was >95%, and the relative enzyme activity after 30 repeated reactions was >80%.
[0063] Example 10: Application of immobilized nicotinamide mononucleotide adenosine transferase mutant S97A-Q10A-F119W in the catalytic preparation of NAD from NMN. The reaction system was set to 10 mL, with a final concentration of NMN (300 mM), ATP-Na2 (450 mM), and MgCl2 (450 mM). 10 g of immobilized enzyme GD-X was added, and the reaction was carried out in a water bath at 40℃ and 600 rpm for 30 min, 60 min, 90 min, 120 min, and 180 min. The reaction was terminated by adding 5 μL of 6M HCl, and the supernatant was retained after centrifugation. The supernatant was diluted 400-fold with ultrapure water and filtered through a 0.22 μm aqueous filter. HPLC analysis was used to verify the consumption of NMN and the formation of NAD.
[0064] The control group consisted of the free nicotinamide mononucleotide adenosine transferase mutant NMNAT-S97A / Q10A. A certain concentration of crude enzyme solution was added to a 10 mL reaction system to make the final concentration 10 g / L. Other reaction conditions and sample processing methods were the same as described above.
[0065] The results showed that the immobilized enzyme generated 240 mM NAD after 30 min of reaction, with a molar conversion rate of NMN reaching 80%. After 2 hours of reaction, it generated 264 mM NAD, with a molar conversion rate of NMN reaching 88%. Therefore, it can be concluded that enzyme immobilization can improve catalytic efficiency to a certain extent.
[0066] Example 11 Application of nicotinamide mononucleotide adenosine transferase mutant S97A-Q10A-F119W in the catalytic preparation of L-glufosinate from PPO. The reaction system consisted of 10 mL of exogenous ATP, which was added to achieve a molar concentration of 10 mM. A certain volume of NAD reaction liquid was added to achieve a final NAD concentration of 5 mM. Whole cells were added to achieve final concentrations of 10 g / L, 20 g / L, 30 g / L, and 40 g / L, respectively. The reaction conditions were 35 °C and the rotation speed was set to 600 rpm.
[0067] Sampling: Take 100 μL of sample every 2 hours; Sample processing: Add 5 μL of 6M HCl to terminate the reaction, centrifuge at 12000 rpm for 2 min, collect the supernatant, dilute with ultrapure water, filter with a 0.22 μm aqueous filter membrane after dilution, and detect the consumption of substrate PPO by HPLC.
[0068] PPO concentration detection: A unitary C18 column (5 μm, 100 A, 4.6 mm × 250 mm) was used. The mobile phase was 50 mM ammonium dihydrogen phosphate solution: acetonitrile = 88:12 (ammonium dihydrogen phosphate solution: 5.75 g of ammonium dihydrogen phosphate was dissolved in 800 mL of ultrapure water, 1.0 g of tetrabutylammonium hydroxide was added, the pH was adjusted to 3.8 with phosphoric acid, and the volume was brought to 1 L). The flow rate was 1 mL / min, the column temperature was 40 ˚C, and the detection wavelength was 232 nm.
[0069] The results showed that increasing the cell concentration in the reaction system could enhance the catalytic ability of cells to PPO. 30 g / L and 40 g / L whole cells could convert about 80% of PPO at the 4th hour, while 20 g / L whole cells could convert 70% of PPO, and 10 g / L whole cells could convert 35% of PPO at the 4th hour.
[0070] Unless otherwise specified, the raw materials and equipment used in this invention are all commonly used in the field; unless otherwise specified, the methods used in this invention are all conventional methods in the field.
[0071] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Any simple modifications, alterations, and equivalent transformations made to the above embodiments based on the technical essence of the present invention shall still fall within the protection scope of the present invention.
Claims
1. A nicotinamide mononucleotide adenosyltransferase mutant, characterized in that: It is obtained by mutating the following sites of nicotinamide mononucleotide adenosyltransferase with the amino acid sequence shown in SEQ ID NO.1: The serine S at position 97 is mutated to alanine A. The glutamine Q at position 10 is mutated to alanine A; The glutamine Q at position 10 is mutated to alanine A, and at the same time, the serine S at position 97 is mutated to alanine A. At position 10, glutamine Q is mutated to alanine A, and at position 119, phenylalanine F is mutated to tryptophan W; The serine at position 97 (S) is mutated to alanine (A), and at the same time, the phenylalanine at position 119 (F) is mutated to tryptophan (W). At position 10, glutamine Q is mutated to alanine A, and at the same time, serine S at position 97 is mutated to alanine A, and phenylalanine F at position 119 is mutated to tryptophan W.
2. The encoding gene of the nicotinamide mononucleotide adenosine transferase mutant as described in claim 1.
3. The encoding gene as described in claim 2, characterized in that: The nucleotide sequence is shown in SEQ ID NO.
4.
4. A recombinant expression vector carrying the encoding gene as described in claim 2.
5. The recombinant expression vector as described in claim 4, characterized in that: The recombinant expression vector is a plasmid, bacteriophage, or viral vector.
6. A host cell carrying the coding gene of claim 2 or the recombinant expression vector of claim 5.
7. The use of the nicotinamide mononucleotide adenosyltransferase mutant as described in claim 1 in the preparation of nicotinamide adenine dinucleotide.
8. The application as described in claim 7, characterized in that: The method of application includes the following steps: (1) The nicotinamide mononucleotide adenosine transferase mutant was covalently cross-linked onto a carrier with glutaraldehyde to obtain an immobilized enzyme; (2) Nicotinamide mononucleotide and adenosine triphosphate were used as substrates and the immobilized enzyme obtained in step (1) was used as a catalyst to catalyze the preparation of nicotinamide adenine dinucleotide.
9. The application of the nicotinamide mononucleotide adenosyltransferase mutant as described in claim 1 in the preparation of L-glufosinate.
10. The application as described in claim 9, characterized in that: The method of application is as follows: L-glufosinate is prepared by using 2-carbonyl-4-[hydroxy(methyl)phosphono]butyric acid (PPO), the precursor of L-glufosinate, as a substrate and ammonium formate as a co-substrate, and a multi-enzyme system as a catalyst. The multi-enzyme system includes glutamate dehydrogenase, formate dehydrogenase, nicotinamide adenine dinucleotide kinase, and the nicotinamide mononucleotide adenosine transferase mutant of claim 1.
Citation Information
Patent Citations
Saccharomyces cerevisiae for producing coenzyme I
CN112322511A
Nicotinamide mononucleotide adenylyltransferase (Nmnat) mutant as well as coding gene and application thereof
CN103710321A