Molecular markers associated with wheat kernel traits and uses thereof

By detecting molecular markers of wheat grain traits, especially TaGW2-6B-KASP primers, the selection of wheat grain traits was assisted, solving the problem of balancing grain weight and protein content in wheat breeding and realizing the breeding of high-yield and high-quality wheat.

CN117947204BActive Publication Date: 2026-07-21CHINA AGRI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
CHINA AGRI UNIV
Filing Date
2024-01-26
Publication Date
2026-07-21

AI Technical Summary

Technical Problem

How to balance the improvement of grain weight and grain protein content in wheat breeding is a challenge that current technologies struggle to simultaneously enhance both traits.

Method used

This study provides substances for detecting molecular markers of wheat grain traits. By detecting the homozygosity of specific nucleotide sites in the wheat genome, it helps to select high-yielding and high-quality wheat. PCR amplification is performed using TaGW2-6B-KASP primers and fluorescent substances to detect genotypes related to wheat grain traits.

Benefits of technology

This method enables the simultaneous improvement of grain yield and protein content in wheat breeding, providing an efficient molecular breeding approach that can screen for wheat varieties with high yield and high protein content.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117947204B_ABST
    Figure CN117947204B_ABST
Patent Text Reader

Abstract

The application discloses a molecular marker related to wheat kernel traits and application thereof. The molecular marker related to wheat kernel traits disclosed by the application is a nucleotide corresponding to the 23th nucleotide of SEQ ID No. 1 in the sequence listing in the wheat genome, which is G or A. Experiments prove that the 1000-grain weight, kernel area, kernel circumference and kernel width of the homozygous wheat with the molecular marker site A are all significantly higher than those of the homozygous wheat with the molecular marker site G, and the grain protein content of the homozygous wheat with the molecular marker site A in the backcross population is also significantly higher than that of the homozygous wheat with the molecular marker site G. It is shown that the molecular marker of the application is related to the wheat kernel yield and grain protein content, and can be used for screening wheat with high kernel yield and high grain protein content, and has important potential application value in wheat yield and quality breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to molecular markers related to wheat grain traits and their applications in the field of biotechnology. Background Technology

[0002] Common wheat is a widely cultivated food crop, providing calories and protein for the global population. Yield and quality are two important goals in wheat breeding, with grain weight and grain protein content being two key related factors. In current research and practice on wheat genetic improvement, molecular marker-assisted selection technology has been widely applied to improve several key traits, including but not limited to yield performance optimization, quality improvement, and disease resistance enhancement, which has significant value in advancing the precision and efficiency of wheat breeding.

[0003] Grain weight and grain protein content are typically negatively correlated, and balancing high yield and high quality has always been a major challenge in crop breeding. Therefore, identifying molecular markers that simultaneously increase grain weight and protein content is of great significance in providing a molecular basis for high-yield and high-quality breeding. Summary of the Invention

[0004] The technical problem to be solved by this invention is how to breed wheat with excellent grain yield traits and high grain protein content.

[0005] To solve the above-mentioned technical problems, the present invention first provides the application of substances that detect molecular markers of wheat grain traits in the detection or auxiliary detection of wheat grain yield traits;

[0006] The molecular marker for wheat grain traits is the nucleotide in the wheat genome corresponding to position 23 of SEQ ID No. 1 in the sequence listing, which is either G or A.

[0007] In the above applications, the substance used to detect molecular markers of wheat grain traits can be a primer named TaGW2-6B-KASP or a set of reagents for detecting the molecular markers of wheat grain traits.

[0008] The TaGW2-6B-KASP consists of three single-stranded DNAs, namely positions 22-44 of SEQ ID No. 2, positions 22-44 of SEQ ID No. 3, and the three single-stranded DNAs shown in SEQ ID No. 4, or consists of the three single-stranded DNAs shown in SEQ ID No. 2, SEQ ID No. 3, and SEQ ID No. 4.

[0009] In the above applications, the kit may include the TaGW2-6B-KASP (composed of three single-stranded DNAs shown in SEQ ID No. 2, SEQ ID No. 3 and SEQ ID No. 4 in the sequence listing).

[0010] The kit may also include fluorescent substances (such as FAM, HEX) or reagents containing fluorescent substances (such as HiGeno2×ProbeMix A, a product of Beijing Jiacheng Biotechnology Co., Ltd.).

[0011] The complete reagent kit may consist of TaGW2-6B-KASP and a fluorescent substance, or it may consist of TaGW2-6B-KASP and the reagent containing the fluorescent substance.

[0012] In the above applications, the wheat grain yield traits can be reflected in grain weight, grain area, grain perimeter, grain length and / or grain width;

[0013] The grain yield of homozygous wheat with nucleotide A at position 23 of SEQ ID No. 1 in the genome is greater than or candidate greater than that of homozygous wheat with nucleotide G at position 23 of SEQ ID No. 1 in the genome.

[0014] The grain weight of homozygous wheat whose genome corresponds to nucleotide A at position 23 of SEQ ID No. 1 in the sequence listing is greater than or can be greater than the grain weight of homozygous wheat whose genome corresponds to nucleotide G at position 23 of SEQ ID No. 1 in the sequence listing;

[0015] The grain area of ​​homozygous wheat whose nucleotide at position 23 of SEQ ID No. 1 in the genome is A is greater than or candidate greater than the grain area of ​​homozygous wheat whose nucleotide at position 23 of SEQ ID No. 1 in the genome is G.

[0016] The grain perimeter of homozygous wheat whose genome corresponds to nucleotide A at position 23 of SEQ ID No. 1 in the sequence listing is greater than or candidate to be greater than the grain perimeter of homozygous wheat whose genome corresponds to nucleotide G at position 23 of SEQ ID No. 1 in the sequence listing;

[0017] The grain length of homozygous wheat whose genome corresponds to nucleotide A at position 23 of SEQ ID No. 1 in the sequence listing is greater than or can be greater than the grain length of homozygous wheat whose genome corresponds to nucleotide G at position 23 of SEQ ID No. 1 in the sequence listing;

[0018] The grain width of homozygous wheat whose nucleotide at position 23 of SEQ ID No. 1 in the genome is A is greater than or can be greater than the grain width of homozygous wheat whose nucleotide at position 23 of SEQ ID No. 1 in the genome is G.

[0019] This invention also provides a method for detecting or assisting in the detection of wheat grain yield traits, wherein the wheat grain yield traits can be reflected in grain weight, grain area, grain perimeter, grain length, or grain width, and the method includes detecting molecular markers of the wheat grain traits, and determining the wheat grain yield traits according to the following method:

[0020] The grain yield of homozygous wheat with nucleotide A at position 23 of SEQ ID No. 1 in the genome is greater than or candidate greater than that of homozygous wheat with nucleotide G at position 23 of SEQ ID No. 1 in the genome.

[0021] The grain weight of homozygous wheat whose genome corresponds to nucleotide A at position 23 of SEQ ID No. 1 in the sequence listing is greater than or can be greater than the grain weight of homozygous wheat whose genome corresponds to nucleotide G at position 23 of SEQ ID No. 1 in the sequence listing;

[0022] The grain area of ​​homozygous wheat whose nucleotide at position 23 of SEQ ID No. 1 in the genome is A is greater than or candidate greater than the grain area of ​​homozygous wheat whose nucleotide at position 23 of SEQ ID No. 1 in the genome is G.

[0023] The grain perimeter of homozygous wheat whose genome corresponds to nucleotide A at position 23 of SEQ ID No. 1 in the sequence listing is greater than or candidate to be greater than the grain perimeter of homozygous wheat whose genome corresponds to nucleotide G at position 23 of SEQ ID No. 1 in the sequence listing;

[0024] The grain length of homozygous wheat whose genome corresponds to nucleotide A at position 23 of SEQ ID No. 1 in the sequence listing is greater than or can be greater than the grain length of homozygous wheat whose genome corresponds to nucleotide G at position 23 of SEQ ID No. 1 in the sequence listing;

[0025] The grain width of homozygous wheat whose nucleotide at position 23 of SEQ ID No. 1 in the genome is A is greater than or can be greater than the grain width of homozygous wheat whose nucleotide at position 23 of SEQ ID No. 1 in the genome is G.

[0026] In the above method, the detection of the molecular markers of wheat grain traits can be performed using the substance for detecting molecular markers of wheat grain traits.

[0027] In the above method, the detection of the molecular markers of wheat grain traits using the complete set of reagents may include: performing PCR amplification of wheat genomic DNA using the three single-stranded DNAs shown in SEQ ID No. 2, SEQ ID No. 3, and SEQ ID No. 4 in a reaction system containing HiGeno2×ProbeMix A (Beijing Jiacheng Biotechnology Co., Ltd.), obtaining amplification products, detecting the fluorescence signal of the amplification products, and determining the nucleotide in the wheat genome corresponding to position 23 of SEQ ID No. 1 in the sequence listing: the nucleotide in the wheat genome of the system emitting FAM fluorescence signal corresponding to position 23 of SEQ ID No. 1 in the sequence listing is G, and the nucleotide in the wheat genome of the system emitting HEX fluorescence signal corresponding to position 23 of SEQ ID No. 1 in the sequence listing is A.

[0028] The PCR amplification reaction system can be as follows: 4 μl of 2×KASP mix (i.e., HiGeno2×ProbeMix A, a product of Beijing Jiacheng Biotechnology Co., Ltd.), 2 μl of genomic DNA (80-100 ng / μl), 0.1 μl of primers (the three single-stranded DNAs shown in SEQ ID No.2, SEQ ID No.3 and SEQ ID No.4, 100 μM), and 2 μl of ddH2O.

[0029] The substance used to detect molecular markers of wheat grain traits is also within the scope of protection of this invention.

[0030] The molecular markers for wheat grain traits mentioned above are also within the scope of protection of this invention.

[0031] This invention also provides any of the following applications:

[0032] Application of the molecular markers for wheat grain traits described in X1) in wheat breeding;

[0033] X2) The application of the molecular markers for wheat grain traits in the detection or auxiliary detection of wheat grain yield traits;

[0034] X3) Application of the substances used to detect molecular markers of wheat grain traits in wheat breeding;

[0035] X4) The application of the substance for detecting molecular markers of wheat grain traits in the preparation of wheat breeding products;

[0036] X5) The application of the substance for detecting molecular markers of wheat grain traits in the preparation of products for detecting or assisting in the detection of wheat grain yield traits;

[0037] The application of the detection or auxiliary detection method for wheat grain yield traits described in X6) in wheat breeding;

[0038] X7) The application of detecting substances in the wheat genome corresponding to nucleotide 23 of SEQ ID No. 1 in the sequence listing in the selection of wheat with excellent grain yield traits;

[0039] X8) The application of detecting substances in the wheat genome corresponding to nucleotide 23 of SEQ ID No. 1 in the sequence listing in the preparation and breeding of wheat products with excellent grain yield traits;

[0040] X9) The application of substances that detect the molecular markers of wheat grain traits in the detection or auxiliary detection of wheat grain protein content;

[0041] The application of the molecular markers of wheat grain traits described in X10 in the detection or auxiliary detection of wheat grain protein content;

[0042] X11) The application of the substance for detecting molecular markers of wheat grain traits in the preparation of products for detecting or assisting in the detection of wheat grain protein content;

[0043] The application of X12) detection of substances in the wheat genome corresponding to nucleotide 23 of SEQ ID No. 1 in the sequence listing in the breeding of wheat with high grain protein content;

[0044] X13) The application of detecting the substance in the wheat genome corresponding to nucleotide 23 of SEQ ID No. 1 in the sequence listing in the preparation of wheat products with high grain protein content.

[0045] The present invention also provides any of the following methods:

[0046] Y1) Wheat breeding method, including: detecting the nucleotide corresponding to the 23rd position of SEQ ID No.1 in the wheat genome, and selecting homozygous or heterozygous wheat with the nucleotide corresponding to the 23rd position of SEQ ID No.1 in the wheat genome as A as the parent for breeding;

[0047] Y2) A method for breeding wheat with excellent grain yield traits, including: selecting homozygous wheat whose genome corresponds to nucleotide A at position 23 of SEQ ID No. 1 in the sequence listing during the wheat breeding process, thereby obtaining wheat with excellent grain yield traits;

[0048] Y3) A method for breeding wheat with high grain protein content, including: selecting homozygous wheat whose genome corresponds to nucleotide A at position 23 of SEQ ID No. 1 in the sequence listing during the wheat breeding process, thus obtaining wheat with high grain protein content;

[0049] Y4) A method for breeding wheat with excellent grain yield traits and high grain protein content, including: selecting homozygous wheat whose genome corresponds to nucleotide A at position 23 of SEQ ID No. 1 in the sequence listing during the wheat breeding process, that is, obtaining wheat with excellent grain yield traits and high grain protein content.

[0050] In this invention, the grain area refers to the maximum coverage area of ​​the wheat grain's vertical projection onto a horizontal plane. In this paper, the grain area is obtained using image analysis technology from the Hangzhou Wanshen Company's SC-A type grain size analysis system. The grain perimeter refers to the perimeter of the wheat grain's vertical projection onto a horizontal plane. In this paper, the grain perimeter is obtained using image analysis technology from the Hangzhou Wanshen Company's SC-A type grain size analysis system. Grain weight, such as thousand-grain weight or hundred-grain weight.

[0051] In this invention, the wheat can be mutant 564 or its offspring. The wheat can also be Nongda 3753, Nongda 981, Gaoyou 5218, or Heshiluan 02-1, or their offspring.

[0052] Experiments have shown that in the offspring population of Nongda 3753 and mutant 564, the thousand-grain weight, grain area, grain perimeter, and grain width of homozygous wheat with the TaGW2-6B_M genotype (wheat grain trait molecular marker locus A) were significantly higher than those of homozygous wheat with the TaGW2-6B_W genotype (wheat grain trait molecular marker locus G). In a backcross population using Nongda 981, Gaoyou 5218, and Shilu 02-1 as recurrent parents and mutant 564 as the donor parent, except for grain length in the Shilu 02-1 background, the thousand-grain weight, grain area, grain perimeter, grain length, and grain width of the TaGW2-6B_M genotype were significantly higher than those of the TaGW2-6B_W genotype in all backgrounds. Furthermore, the grain protein content of the TaGW2-6B_M genotype was also significantly higher than that of the TaGW2-6B_W genotype. This indicates that the molecular markers for wheat grain traits of the present invention are related to wheat grain yield and grain protein content, and can be used to screen wheat with high grain yield and high grain protein content, which has important potential application value in wheat yield and quality breeding.

[0053] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way. Attached Figure Description

[0054] Figure 1The image shows the genotyping results of a portion of the F2 population using TaGW2-6B-KASP. The top left corner shows the homozygous TaGW2-6B_M genotype, the bottom right corner shows the homozygous TaGW2-6B_W genotype, and the center corner shows the heterozygous TaGW2-6B_WM genotype.

[0055] Figure 2 Statistical analysis of grain traits of TaGW2-6B_W and TaGW2-6B_M in different populations under multiple environments was conducted. E1: Shangzhuang, Beijing, 2017-2018; E2: Shangzhuang, Beijing, 2018-2019; E3: Linfen, Shanxi, 2018-2019; BLUP: best linear unbiased estimate under E2 and E3 environments; TGW: thousand-grain weight; GA: grain area; GC: grain perimeter; GL: grain length; GW: grain width; GPC: grain protein content. The significance level was determined using Student's t-test, with *P<0.05, **P<0.01, and ***P<0.001.

[0056] Figure 3 This study compared the grain traits of homozygous genotypes TaGW2-6B_W and TaGW2-6B_M. MN was a mutant of 564 / Nongda 981, BC3F2; MG was a mutant of 564 / Gaoyou 5218, BC3F2; and MS was a mutant of 564 / Shiluan 02-1, BC4F2. TGW was the thousand-grain weight; GA was the grain area; GC was the grain perimeter; GL was the grain length; GW was the grain width; and GPC was the grain protein content. Significance was determined using Student's t-test, with *P < 0.05, **P < 0.01, and ***P < 0.001. Detailed Implementation

[0057] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials, reagents, instruments, etc., used in the following examples are all commercially available. All quantitative experiments in the following examples are performed in at least three replicates. Unless otherwise specified, in the following examples, the first position of each nucleotide sequence in the sequence listing is the 5′ terminal nucleotide of the corresponding DNA / RNA, and the last position is the 3′ terminal nucleotide of the corresponding DNA / RNA.

[0058] The Nongda 3753 (ND3753) and its EMS-induced mutant 564 (M564) in the following examples are described in the article "Chan Bi et al., Dosage effect of anthocyanin biosynthesis in purple-grained wheat (Triticum aestivum L., Euhytica (2023) 219:55)". The public can obtain this biological material from the applicant. This biological material is only used to repeat the relevant experiments of the present invention and cannot be used for other purposes.

[0059] The Nongda 981 (ND981) mentioned in the following embodiments is described in the article "Shaozhe Wen et al., A Major Quantitative Trait LociCluster Controlling Three Components of Yield and Plant Height Identified on Chromosome 4B of Common Wheat, Frontiers in Plant Science, January 2022, Volume 12, Article 799520". This biological material is available to the public from the applicant and is only used for repeating the relevant experiments of this invention and cannot be used for other purposes.

[0060] The Gaoyou 5218 and Shilu 02-1 mentioned in the following examples are both described in the article "Jin Xinxin et al., Effects of Genotype and Environment on Wheat Yield, Quality and Nitrogen Efficiency, Acta Agronomica Sinica 2019, 45(4):635-644". The public can obtain the biological material from the applicant. The biological material is only used to repeat the relevant experiments of the present invention and cannot be used for other purposes.

[0061] Thousand grain weight (TGW), grain area (GA), grain circle (GC), grain length (GL), and grain width (GW) were measured using the SC-A type grain size analysis system from Hangzhou Wanshen Company. Grain protein content (GPC) was determined using a Perten DA7200 near-infrared grain analyzer.

[0062] Example 1: Correlation analysis between molecular markers of wheat grain traits and wheat grain phenotypes

[0063] This embodiment uses 199 F2 single plants constructed from Nongda 3753 and its EMS-induced mutant 564, as well as its derived F2 plants. 2:3 Using family pedigrees as data, this study explored the genetic basis for the larger grain size and higher grain protein content of mutant 564. QTL analysis revealed an environmentally stable QTL on chromosome 6B controlling thousand-grain weight, grain width, grain area, and grain perimeter. This confidence interval contained a gene, TaGW2, encoding a ring-type E3 ubiquitin ligase; therefore, TaGW2-6B was cloned and sequenced. Sequence alignment revealed a G / ASNP in exon 7 of the coding region of this gene between the two parents, causing premature termination of protein translation in mutant 564. This SNP was designated as a molecular marker for wheat grain traits. KASP primers were designed based on this molecular marker for detection, and genotyping analysis in the parental populations revealed that this molecular marker was associated with thousand-grain weight and grain width.

[0064] 1. Materials and Methods

[0065] 1.1 Experimental Materials

[0066] The purple-grained wheat variety Nongda 3753 possesses excellent processing and nutritional qualities. To overcome the limitations imposed by grain color during its promotion, an EMS mutation breeding strategy was employed, selecting the red-grained strain 564 (M564) from the offspring. Subsequent studies revealed that, in addition to grain color, mutant 564 also exhibited larger grain size and higher protein content.

[0067] Using Nongda 3753 and its mutant 564 (M564), a system containing 199 F2 single plants and F2 single plants was constructed. 2:3 Separated population (F) 2:3 A segregating population refers to a population formed by the self-pollination of each F2 plant within the F2 generation. F2 individual plants were sown in Shangzhuang, Beijing in the autumn of 2017-2018, and the resulting F3 populations... 2:3 The family line was planted in Shangzhuang, Beijing and Linfen, Shanxi in 2018-2019.

[0068] The F2 population was sown with a plant spacing of 6cm and a row spacing of 30cm. 2:3 Families were designed using a completely randomized block design with three replicates. Each family was planted in one row, 1m long and 0.3m apart, with 20 seeds sown per row. The F2 population was harvested as individual plants. 2:3 The pedigrees were harvested by row, threshed, dried, and then subjected to phenotypic examination.

[0069] 1.2 Design and Detection of SNP-Labeled Primers

[0070] Based on molecular markers of wheat grain traits, the KASP primer TaGW2-6B-KASP was designed, and the primer sequence is as follows:

[0071] TaGW2-6B-KASP-F1:GAAGGTGACCAAGTTCATGCT TGATGGTTATGGAAGCGATTTGG (SEQ ID No. 2, the underlined part is the wheat genome specific recognition sequence, the bolded part is used to bind the fluorescent substance FAM;

[0072] TaGW2-6B-KASP-F2:GAAGGTCGGAGTCAACGGATT TGATGGTTATGGAAGCGATTTGA (SEQ ID No. 3, the underlined part is the wheat genome specific recognition sequence, the bold part is used to bind the fluorescent substance HEX;

[0073] TaGW2-6B-KASP-R: TCATTCAAGGGACATATAAGAACCA (SEQ ID No. 4).

[0074] The PCR reaction system using this KASP primer is as follows:

[0075]

[0076] Among them, 2×KASP mix: namely HiGeno2×ProbeMix A, a product of Beijing Jiacheng Biotechnology Co., Ltd.; primers are obtained by mixing TaGW2-6B-KASP-F1, TaGW2-6B-KASP-F2, and TaGW2-6B-KASP-R in ddH2O, wherein the molar ratio of TaGW2-6B-KASP-F1, TaGW2-6B-KASP-F2, and TaGW2-6B-KASP-R is 2:2:5.

[0077] The amplification procedure is as follows:

[0078]

[0079] 2. Correlation analysis between molecular markers and phenotypes of wheat grain traits

[0080] 2.1 Detection of molecular markers for wheat grain traits

[0081] Molecular markers of wheat grain traits were detected using KASP primers TaGW2-6B-KASP, specifically for F2 and F2. 2:3 Genotyping of the population yielded some results, such as... Figure 1 As shown. The PCR products of KASP primers, excluding the sequence recognizing the fluorescent substance, have the following partial sequences (where R represents A or G):

[0082] TGATGGTTATGGAAGCGATTTGRCGTTCAATTCAGGTAAAGTAAATGGTTCTTATATGTCCCTTGAATGA (SEQ ID No. 1).

[0083] Both Nongda 3753 and mutant 564 were homozygous at the molecular marker sites for wheat grain traits. Nongda 3753 had a marker of "G" at the wheat grain trait molecular marker site, while mutant 564 had a marker of "A" at the same site. The homozygous genotype identical to that of Nongda 3753 was designated as TaGW2-6B_W, the homozygous genotype identical to that of mutant 564 was designated as TaGW2-6B_M, and the heterozygous genotype was designated as TaGW2-6B_WM. The results showed that in the F2 generation, there were 62 plants with the TaGW2-6B_W genotype, 41 plants with the TaGW2-6B_M genotype, and 96 plants with the TaGW2-6B_WM genotype. 2:3 In the population (corresponding to the offspring of the F2 generation), there were 62 strains with the TaGW2-6B_W genotype, 41 strains with the TaGW2-6B_M genotype, and 96 strains with the TaGW2-6B_WM genotype.

[0084] 2.2 Correlation analysis between molecular markers and phenotypes of wheat grain traits

[0085] The thousand-grain weight, grain area, grain perimeter, grain length, grain width, and grain protein content of wheat grains after maturity were measured. The results are shown in [Table / Reference]. Figure 2 Tables 1-6.

[0086] Among them, grain area refers to the maximum coverage area of ​​wheat grains projected vertically onto a horizontal plane. Grain perimeter refers to the perimeter of wheat grains projected vertically onto a horizontal plane.

[0087] Table 1. Results of thousand-grain weight (TGW, g) under different environments

[0088]

[0089] Table 1 shows the best linear unbiased estimates for BLUP in the 2018-2019 Beijing Shangzhuang and 2018-2019 Shanxi Linfen environments.

[0090] Table 2. Grain area (GA, mm) under different environments 2 )result

[0091]

[0092] In Table 2, BLUP represents the best linear unbiased estimates under the conditions of Shangzhuang, Beijing and Linfen, Shanxi in 2018-2019.

[0093] Table 3. Grain perimeter (GC, mm) under different environments

[0094]

[0095] In Table 3, BLUP represents the best linear unbiased estimates under the conditions of Shangzhuang, Beijing and Linfen, Shanxi in 2018-2019.

[0096] Table 4. Particle length (GL, mm) under different environments

[0097]

[0098] Table 4 shows the best linear unbiased estimates for BLUP in the 2018-2019 Beijing Shangzhuang and 2018-2019 Shanxi Linfen environments.

[0099] Table 5. Particle width (GW, mm) results under different environments

[0100]

[0101] Table 5 shows the best linear unbiased estimates for BLUP in the 2018-2019 Beijing Shangzhuang and 2018-2019 Shanxi Linfen environments.

[0102] Table 6. Grain protein content (GPC, %) under different environments

[0103]

[0104]

[0105] In Table 6, “—” indicates that the data is unavailable; in Table 6, BLUP represents the best linear unbiased estimate under the conditions of Shangzhuang, Beijing and Linfen, Shanxi in 2018-2019.

[0106] Phenotypic analysis under different environments revealed that the thousand-grain weight, grain area, grain perimeter, and grain width of TaGW2-6B_M genotype wheat were significantly higher than those of TaGW2-6B_W genotype wheat, with differences in thousand-grain weight ranging from 1.23 to 2.05 g and grain width from 0.05 to 0.12 mm. Similarly, the thousand-grain weight, grain area, grain perimeter, and grain width of TaGW2-6B_WM genotype wheat were also significantly higher. The grain traits of TaGW2-6B_WM and TaGW2-6B_M genotype wheat were almost identical, except that the grain area of ​​the F2 generation was significantly lower than that of the TaGW2-6B_M genotype wheat. This difference was observed in F2 generation wheat grown in Linfen, Shanxi. 2:3The grain width of the population and BLUP was significantly lower than that of the TaGW2-6B_M genotype wheat. Furthermore, there was no difference in grain protein content between the two genotypes in these populations. Figure 2 The results showed that the molecular markers for wheat grain traits of the present invention are related to wheat grain yield and can be used to screen wheat with high grain yield without reducing protein content. Furthermore, they can be used for molecular breeding of high-yield and high-quality wheat.

[0107] 2.3 Detection of molecular markers for wheat grain traits in other materials

[0108] In addition, TaGW2-6B-KASP was used to detect the TaGW2-6B-M genotype in 486 winter wheat varieties (lines), including 357 cultivars, 96 high-generation lines, 26 introduced varieties, and 7 local varieties. No materials with the same genotype as TaGW2-6B_M were found (Table 7). Furthermore, the TaGW2-6B gene, containing the molecular marker for wheat grain traits, was compared in the WheatUnion (http: / / wheat.cau.edu.cn / WheatUnion / ) and Wheat_SnpHub (http: / / wheat.cau.edu.cn / Wheat_SnpHub_Portal / snphub_NC22_zh_1 / ) (Wang et al. 2020; Wang et al. 2022) databases. Similarly, the TaGW2-6B_M genotype was not found in any tetraploid or hexaploid wheat in the databases. Therefore, TaGW2-6B_M is a novel, artificially created allelic variant that has not occurred in wheat evolution and breeding.

[0109] Table 7. Distribution of TaGW2-6B_W and TaGW2-6B_M in wheat

[0110]

[0111] Example 2: Application of molecular markers for wheat grain traits in wheat breeding

[0112] Alleles (marker A for wheat grain traits) were introduced into three different wheat varieties (ND981, GY5218, and SL02-1) using marker-assisted backcrossing. ND981 is a large-grained variety with low grain protein content, while GY5218 and SL02-1 are large-grained and small-grained varieties with high grain protein content, respectively. The results showed that this allele significantly increased both thousand-grain weight and grain protein content under all three background conditions. The specific procedures are as follows:

[0113] Three backcross populations were constructed using Nongda 981, Gaoyou 5218, and Shilu 02-1 as recurrent parents and mutant 564 as the donor parent. These included two BC3F2 populations (recurrent parents: Nongda 981 and Gaoyou 5218) and one BC4F2 population (recurrent parent: Shilu 02-1) to assess the genetic effect of this allele under different backgrounds. In this process, KASP primers were used in each BCF1 population to select plants with the allele type of mutant 564. The BC3F2 population was planted in Handan, Hebei Province in 2021-2022, and the BC4F2 population was planted in Shangzhuang, Beijing in 2022-2023. Both BC3F2 and BC4F2 populations were sown at a plant spacing of 6 cm and a row spacing of 30 cm. Both BC3F2 and BC4F2 populations were harvested individually, threshed, dried, and then subjected to phenotypic evaluation.

[0114] In each of the three populations, two homozygous genotypes were isolated using TaGW2-6B-KASP: the TaGW2-6B_W genotype and the TaGW2-6B_M genotype (Example 1). The number of plants with both genotypes was greater than 18 in each population, and the grain differences between the two genotypes were significant. The grains of the TaGW2-6B_M genotype were significantly wider than those of the TaGW2-6B_W genotype. Measurements of thousand-grain weight, grain area, grain perimeter, grain length, and grain width also showed that, except for grain length in the Shilu 02-1 background, these grain traits of the TaGW2-6B_M genotype were significantly higher than those of the TaGW2-6B_W genotype in all backgrounds. Specifically, the average grain width and thousand-grain weight were 0.07-0.14 mm and 1.49-3.00 g higher, respectively. Furthermore, unlike the mutant 564 / Nongda 3753 derived population, the TaGW2-6B_M genotype showed significantly higher grain protein content than the TaGW2-6B_W genotype in these populations, with differences ranging from 0.43% to 0.78%. Figure 3 These results indicate that molecular markers for wheat grain traits can be used in breeding to improve grain weight and grain protein content, and have important potential application value in wheat yield and quality breeding.

[0115] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. Any of the following applications: X1) Application of substances that detect molecular markers of wheat grain traits in the detection or auxiliary detection of wheat grain yield traits; X2) Application of substances that detect molecular markers of wheat grain traits in the preparation of products for detecting or assisting in the detection of wheat grain yield traits; X3) Application of substances that detect molecular markers of wheat grain traits in the breeding of wheat with excellent grain yield traits; X4) Application of substances that detect molecular markers of wheat grain traits in the preparation and breeding of wheat products with excellent grain yield traits; The molecular marker for wheat grain traits is shown in SEQ ID No. 1, and the nucleotide at position 23 of SEQ ID No. 1 is G or A; When the wheat is a offspring obtained by using Nongda 3753 EMS-induced mutant 564 as the parent and Nongda 3753, Nongda 981 or Gaoyou 5218 as another parent, the wheat grain yield traits are grain weight, grain area, grain perimeter, grain length and / or grain width. When the wheat is the offspring obtained by using mutant 564, which is generated by EMS mutagenesis of Nongda 3753, as the parent and Shilu 02-1 as the other parent, the wheat grain yield traits are grain weight, grain area, grain perimeter and / or grain width. The grain yield of wheat with nucleotide A at position 23 of SEQ ID No. 1 is greater than or can be greater than the grain yield of wheat with nucleotide G at position 23 of SEQ ID No. 1; The grain weight of wheat with nucleotide A at position 23 of SEQ ID No. 1 is greater than or can be greater than the grain weight of wheat with nucleotide G at position 23 of SEQ ID No. 1; The grain area of ​​wheat with nucleotide A at position 23 of SEQ ID No. 1 is greater than or can be greater than the grain area of ​​wheat with nucleotide G at position 23 of SEQ ID No. 1; The grain circumference of wheat whose nucleotide at position 23 of SEQ ID No. 1 is A is greater than or can be greater than the grain circumference of wheat whose nucleotide at position 23 of SEQ ID No. 1 is G; The grain length of wheat with nucleotide A at position 23 of SEQ ID No. 1 is greater than or candidate to be greater than the grain length of wheat with nucleotide G at position 23 of SEQ ID No. 1; The grain width of wheat whose nucleotide at position 23 of SEQ ID No. 1 is A is greater than or can be greater than the grain width of wheat whose nucleotide at position 23 of SEQ ID No. 1 is G.

2. Any of the following applications: X1) Application of substances that detect molecular markers of wheat grain traits in the detection or auxiliary detection of wheat grain protein content; X2) Application of substances that detect molecular markers of wheat grain traits in the preparation of products for detecting or assisting in the detection of wheat grain protein content; X3) Application of substances that detect molecular markers of wheat grain traits in the breeding of wheat with high grain protein content; X4) Application of substances that detect molecular markers of wheat grain traits in the preparation of wheat products with high grain protein content; The molecular marker for wheat grain traits is shown in SEQ ID No. 1, and the nucleotide at position 23 of SEQ ID No. 1 is G or A; The wheat in question is a offspring obtained by using mutant 564, generated by EMS mutagenesis of Nongda 3753, as the parent and Shilu 02-1, Nongda 981, or Gaoyou 5218 as the other parent. The grain protein content of wheat with nucleotide A at position 23 of SEQ ID No. 1 is higher than that of wheat with nucleotide G at position 23 of SEQ ID No.

1.

3. The application according to claim 1 or 2, characterized in that: The substance used to detect molecular markers of wheat grain traits is named [insert name here]. TaGW2-6B-KASP Primers or a complete set of reagents for detecting the molecular markers of the wheat grain traits; The TaGW2-6B-KASP It consists of three single-stranded DNA molecules, namely, positions 22-44 of SEQ ID No. 2, positions 22-44 of SEQ ID No. 3, and the three single-stranded DNA molecules shown in SEQ ID No. 4, or the three single-stranded DNA molecules shown in SEQ ID No. 2, SEQ ID No. 3, and SEQ ID No.

4.

4. The application according to claim 3, characterized in that: The complete set of reagents includes the one named as follows. TaGW2-6B- KASP Primers.

5. A method for detecting or assisting in the detection of wheat grain yield traits, characterized in that: The method includes detecting the molecular markers for wheat grain traits as described in claim 1, and determining wheat grain yield traits according to the following method: When the wheat is a offspring obtained by using Nongda 3753 EMS-induced mutant 564 as the parent and Nongda 3753, Nongda 981 or Gaoyou 5218 as another parent, the wheat grain yield traits are grain weight, grain area, grain perimeter, grain length and / or grain width. When the wheat is the offspring obtained by using mutant 564, which is generated by EMS mutagenesis of Nongda 3753, as the parent and Shilu 02-1 as the other parent, the wheat grain yield traits are grain weight, grain area, grain perimeter and / or grain width. The grain yield of wheat with nucleotide A at position 23 of SEQ ID No. 1 is greater than or can be greater than the grain yield of wheat with nucleotide G at position 23 of SEQ ID No. 1; The grain weight of wheat with nucleotide A at position 23 of SEQ ID No. 1 is greater than or can be greater than the grain weight of wheat with nucleotide G at position 23 of SEQ ID No. 1; The grain area of ​​wheat with nucleotide A at position 23 of SEQ ID No. 1 is greater than or can be greater than the grain area of ​​wheat with nucleotide G at position 23 of SEQ ID No. 1; The grain circumference of wheat whose nucleotide at position 23 of SEQ ID No. 1 is A is greater than or can be greater than the grain circumference of wheat whose nucleotide at position 23 of SEQ ID No. 1 is G; The grain length of wheat with nucleotide A at position 23 of SEQ ID No. 1 is greater than or candidate to be greater than the grain length of wheat with nucleotide G at position 23 of SEQ ID No. 1; The grain width of wheat whose nucleotide at position 23 of SEQ ID No. 1 is A is greater than or can be greater than the grain width of wheat whose nucleotide at position 23 of SEQ ID No. 1 is G.

6. The method according to claim 5, characterized in that: The substance for detecting molecular markers of wheat grain traits as described in claim 3 or 4 is used to detect the molecular markers of wheat grain traits as described in claim 1.

7. Any of the following methods: Y1) Methods for breeding wheat with excellent grain yield traits, including: In the process of wheat breeding, wheat with nucleotide A at position 23 of SEQ ID No. 1 is selected to obtain wheat with excellent grain yield traits. When the wheat is a progeny obtained by using mutant 564 generated by EMS mutagenesis of Nongda 3753 as the parent and Nongda 3753, Nongda 981 or Gaoyou 5218 as another parent, the grain yield traits are grain weight, grain area, grain perimeter, grain length and / or grain width. When the wheat is a progeny obtained by using mutant 564 generated by EMS mutagenesis of Nongda 3753 as the parent and Shilu 02-1 as another parent, the grain yield traits are grain weight, grain area, grain perimeter and / or grain width. Y2) A method for breeding wheat with high grain protein content, including: selecting wheat with nucleotide A at position 23 of SEQ ID No. 1 during the wheat breeding process, thereby obtaining wheat with high grain protein content; wherein the wheat is the offspring obtained by using mutant 564 generated by EMS mutagenesis of Nongda 3753 as parent and Shilu 02-1, Nongda 981 or Gaoyou 5218 as another parent.