Bile-tolerant flavobacterium and use thereof

Abstract

The application discloses a cholephilic bacterium tolerating bile and an application thereof, and belongs to the technical field of cultivating bovine bezoar. The cholephilic bacterium tolerating bile is preserved in the China General Microbiological Culture Collection Center (CGMCC) on September 28, 2023, and has a preservation number of CGMCC No. 28576. The cholephilic bacterium is derived from a healthy calf anus swab, has excellent tolerance to bovine bile, high bovine bezoar conversion rate and high safety, and can be used for producing in-vivo cultivated bovine bezoar.

Description

Technical Field

[0001] This invention relates to the field of bezoar cultivation technology, specifically to a flavonoid strain tolerant to bile and its application. Background Technology

[0002] Bezoar is a dried gallstone found in the gallbladder, bile duct, or hepatic duct of cattle. It is a traditional and precious animal-derived medicinal material in my country and a component of many prescriptions. my country's bezoar production is low while the demand for medicinal use is high, resulting in a supply shortage for many years. To address this shortage, in the early 1970s, Lin Ruzhong and others conducted the first successful experiment of implanting bezoar cores into bovine gallbladders. In 1978, Cai Zhichao successfully cultivated artificial natural bezoar.

[0003] The production process of live-cultured bezoar simulates the formation process of natural bezoar, and the environment in which it forms is completely identical to that of natural bezoar. Therefore, the cultured bezoar produced is very similar to natural bezoar in terms of its main components, chemical structure, and pharmacological effects, and its efficacy is far greater than that of chemically synthesized artificial bezoar. The yield and quality of artificially cultured bezoar are related to many factors, but the selection of flavonoids is one of the most important factors.

[0004] In the cultivation of bezoar, the flavonoids used need to be able to survive and multiply in the gallbladder for a long time, be non-toxic to cattle, have a certain inflammatory effect, and possess a strong ability to produce β-glucuronidase and hydrolyze bile. Because bovine bile has broad-spectrum antibacterial properties, the growth of most bacteria (including some highly efficient flavonoid strains) is inhibited in bile, and they often struggle to survive long-term, severely affecting the conversion efficiency of bezoar and increasing the production cost of live bezoar cultivation. Therefore, screening for bile-tolerant, highly efficient bezoar-transforming strains is the key and the challenge in the live bezoar cultivation process. Summary of the Invention

[0005] In response to the aforementioned existing technologies, this invention screens out a flavonoid bacterium that is tolerant to bile and applies it to the in vivo culture of bezoar from cattle. The flavonoid bacterium of this invention is derived from anal swabs of healthy calves, exhibiting excellent tolerance to bovine bile, as well as high bezoar conversion rate and high safety, making it suitable for the production of in vivo cultured bezoar.

[0006] Specifically, the present invention relates to the following technical solutions:

[0007] In a first aspect, the present invention provides a flavin-inducing bacterium resistant to bile, said flavin-inducing bacterium being Escherichia coli; this strain was deposited on September 28, 2023, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 28576.

[0008] In a second aspect, the present invention provides a microbial agent containing the aforementioned flammogenic bacteria.

[0009] Preferably, in the bacterial agent, the flammogenic bacteria can exist in the form of cultured live bacteria or fermentation broth of live bacteria.

[0010] Preferably, the viable count of flammogenic bacteria in the bacterial agent is greater than or equal to 10. 9 CFU / mL.

[0011] A third aspect of the present invention provides the use of the above-mentioned bile-resistant flammogenic bacteria or flammogenic bacteria-containing agents in the production of bezoar.

[0012] In a fourth aspect, the present invention provides a method for cultivating artificial natural bezoar, comprising the step of injecting the aforementioned flavonoid bacteria into the bovine gallbladder.

[0013] Preferably, the number of viable flavonoids injected is greater than or equal to 5 × 10⁻⁶. 9 CFU.

[0014] The beneficial effects of this invention are:

[0015] (1) Most of the existing reported flavonoid strains were isolated from the bile of flavonoid cattle. However, since the incidence of gallstones in cattle is very low under natural conditions, the feasibility of isolating flavonoids from cattle bile is limited and difficult. This invention is the first to isolate flavonoid strains from anal swabs of healthy calves. The isolation process is simpler and more efficient, which broadens the sources of flavonoids and greatly improves the efficiency of discovering superior flavonoids.

[0016] (2) The flammogenic bacteria of the present invention have excellent resistance to bovine bile and produce β-glucuronidase with high activity. It is safe to use and can be used for the efficient production of bovine gallstones in live culture. Attached Figure Description

[0017] Figure 1 Gram staining of isolated bacteria.

[0018] Figure 2 : Bacteria isolated from MacConkey culture medium.

[0019] Figure 3 : Isolates on eosin methylene blue agar.

[0020] Figure 4 Gel electrophoresis of PCR amplification products of some strains; In the figure, M: DL 2000 DNA Marker; 1-13: the strains tested.

[0021] Figure 5 : β-glucuronidase activity in bile supernatant of each isolate group; In the figure, the control refers to 100% (pure) bile that has not been inoculated with flavonoids.

[0022] Figure 6 : Total protein content in bile supernatant of each isolate group; In the figure, the control refers to 100% (pure) bile that was not inoculated with flavonoids.

[0023] Figure 7 : Direct bilirubin content in bile supernatant of each isolate group; In the figure, the control refers to 100% (pure) bile that was not inoculated with flavonoids.

[0024] Figure 8 : Total bile acid content in bile supernatant of each isolate group; In the figure, the control refers to 100% (pure) bile that has not been inoculated with flavonoids. Detailed Implementation

[0025] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0026] As mentioned earlier, most existing flammogenic bacteria are isolated from the bile of flammogenic cattle. However, since the incidence of gallstones in cattle is very low under natural conditions, the feasibility of isolating flammogenic bacteria from cattle bile is limited and the task is quite difficult.

[0027] In view of this, the present invention innovatively isolates flavonoids from anal swabs of healthy calves, ultimately obtaining a strain of *Escherichia coli* B14 as the flavonoid. Compared with existing flavonoids, the flavonoid *Escherichia coli* B14 of the present invention has the following advantages:

[0028] (1) The sources of separation are more extensive.

[0029] (2) It has a strong ability to tolerate bile and can reproduce stably in the gallbladder environment for a long time.

[0030] (3) It produces high β-glucuronidase activity and has a strong ability to decompose direct bilirubin into free bilirubin, which can generate a large amount of β-glucuronidase in a short time, thus improving the production efficiency and quality of bezoar. Most existing bezoar cultivation methods require 2-3 years or even longer; however, by using the flavonoid bacteria of this invention, a large amount of high-quality bezoar can be harvested in one year.

[0031] To enable those skilled in the art to better understand the technical solutions of this application, the technical solutions of this application will be described in detail below with reference to specific embodiments. Unless otherwise specified, experimental conditions not detailed in the embodiments are generally based on conventional conditions or conditions recommended by the reagent company; reagents, consumables, etc., used in the following embodiments can be obtained commercially unless otherwise specified.

[0032] Example 1: Isolation, screening and identification of bile-tolerant flavonoids

[0033] 1. Bacterial isolation and culture

[0034] Anal swabs were collected from 350 healthy calves at a large-scale cattle farm and placed in 5 mL of LB liquid medium. The mixture was incubated at 37°C and 220 rpm with shaking for 12 hours. In a clean bench, a small amount of enrichment broth was inoculated onto ordinary agar medium using a triple-line method with an inoculation loop. Colony growth was observed. After incubation at 37°C for 24 hours, single colonies were picked, Gram-stained, and examined under a microscope. The Gram staining method is as follows:

[0035] (1) Smear preparation: First, mark a clean glass slide with a pen, add a small amount of physiological saline to the marked area, then use a sterile loop to pick up the colonies and mix them evenly with physiological saline to form a bacterial film. Drying and fixing: Hold one end of the glass slide with your hand or a glass slide and heat it over the outer flame of an alcohol lamp while shaking it.

[0036] (2) Primary staining: Add an appropriate amount of crystal violet staining solution to the smear, let it act for 1 minute and then pour it off. Tilt the slide and wash with water.

[0037] (3) Mordant: Add iodine solution for staining for 1 minute, pour out the iodine solution and then wash with water, gently shake off the water.

[0038] (4) Decolorization: Add 95% ethanol and wait 10-30 seconds, then wash with water.

[0039] (5) Counterstaining: Add a few drops of red dye solution for counterstaining. After 30 seconds, pour out the counterstain solution, wash with water, and dry.

[0040] (6) Microscopic examination: After the specimen smear has dried, add 1 to 2 drops of cedarwood oil to the bacterial film surface and examine it under an oil microscope, paying attention to the morphology of the bacteria.

[0041] Subsequently, based on the microscopic examination results, colonies suspected to be Escherichia coli were picked and inoculated onto MacConkey agar, and incubated at 37°C for 24 hours; single red colonies picked from MacConkey agar were inoculated onto eosin methylene blue agar and incubated overnight again, and the growth of the colonies was observed and recorded.

[0042] The results showed that single colonies suspected to be E. coli, after Gram staining, revealed short, pinkish bacilli of medium size with blunt ends under a microscope. Figure 1 On MacConkey agar, it forms round, pink colonies with a raised center, a smooth, moist surface, and neat edges. Figure 2 On eosin methylene blue agar, the colonies are large, round, purplish-black with a metallic sheen and neat edges. Figure 3 ).

[0043] 2. Bacterial identification

[0044] Black, metallic-looking colonies were picked from eosin methylene blue agar and labeled, then incubated in LB broth at 37°C and 220 rpm for 12 hours with shaking. A single isolated and purified colony was picked up with an inoculation loop and spread evenly into a biochemical identification tube. A blank control tube was prepared for each inoculated biochemical identification tube. After the procedure, all biochemical tubes were placed in sterile petri dishes, slightly tilted, and incubated at 37°C for 18–24 hours. The color changes in the biochemical tubes were observed and recorded.

[0045] Simultaneously, using the suspected bacterial culture as a template, conventional PCR amplification was performed using universal primers for 16S rDNA. The upstream sequence of the primers was CATTCCCTGGCAAGTGGATTATC (SEQ ID NO.1), and the downstream sequence was GGAATGGCCTTCTTGTCAATGG (SEQ ID NO.2). Subsequently, 5 μL of the PCR product was electrophoresed on a 1% agarose gel, and images were taken and analyzed using a gel imaging system. The PCR products were sequenced by a biotechnology company, and the results were compared with known sequences in GenBank.

[0046] The results of the biochemical identification of the strains are shown in Table 1. Some isolates conformed to the biochemical characteristics of *Escherichia coli*. PCR amplification and gel electrophoresis yielded the target band of approximately 1369 bp. Figure 4 Sequencing results, compared online with BLAST, showed that some isolated bacteria had a homology of more than 99% with Escherichia coli, thus confirming them as Escherichia coli.

[0047] Table 1: Biochemical characteristics of the isolates

[0048]

[0049] Note: (+) indicates positive; (-) indicates negative.

[0050] 3. Determination of bacterial concentration

[0051] (1) In a clean bench, the isolated bacteria were inoculated into LB liquid medium and cultured at 37°C and 220r / min for 12h with shaking. The culture was repeated 3 times.

[0052] (2) Centrifuge the Escherichia coli isolate at 3000 r / min for 5 min, wash with PBS 3 times, and then serially dilute the bacterial solution with sterile physiological saline.

[0053] (3) Take 100 μL of bacterial solution of different dilutions and spread it evenly on LB agar plates. Incubate at 37℃ for 12 h. Repeat each dilution 3 times.

[0054] (4) Take plates with colony counts between 30 and 300, calculate the mean, and the original bacterial concentration (CFU / mL) = mean colony count × dilution factor × 10.

[0055] 4. Domestication of bile-resistant Escherichia coli

[0056] The bacterial acclimatization was conducted strictly according to aseptic techniques to prevent contamination by other microorganisms during the process. Simultaneously, the purity of the bacteria was continuously checked during acclimatization to prevent the introduction of contaminating microorganisms. The specific acclimatization steps were as follows: 250 μL of fresh, sterile ox bile and 4750 μL of liquid LB medium (i.e., 5% bile broth culture medium) were added to 10 mL test tubes, shaken well, and then a single colony was picked up using an inoculation loop and inoculated into the above medium. The tubes were incubated at 37°C in a water-jacketed electric thermostatic incubator for 12 hours. All test tubes, broth, and pipette tips required for the experiment were autoclaved at 121°C for 30 minutes.

[0057] Repeat the above steps, using the low-concentration bile broth culture medium from the previous step. Gradually increase the bile concentration in the bile broth culture medium: 5%–10%–20%–30%–40%–50%–60%–70%–80%–90%–100%. The bacterial strain acclimatization is complete, and five bile-tolerant Escherichia coli strains (E. coli B1, B5, B7, B11, and B14) are selected.

[0058] 5. Microbial strain testing

[0059] 5.1 Gram staining test

[0060] The staining method is as follows: prepare bacterial smears → dry → fix; primary stain with crystal violet for 1-2 min, wash with water; mordant with iodine solution for 1-2 min, wash with water; add fuchsin ethanol solution for 50-60 s, wash with water → air dry → examine under an oil immersion microscope.

[0061] No contaminating bacteria were found; after staining, the bacteria appeared as single, light red, short rod-shaped organisms.

[0062] 5.2 Plate inoculation method

[0063] The bacterial strain was inoculated onto agar plates and MacConkey agar plates in a clean bench and incubated at 37°C for 24 hours. The colonies on both plates were found to be the same type of colony.

[0064] The results showed that the test bacteria grew in the two culture media in accordance with the growth characteristics of Escherichia coli.

[0065] 5.3 Biochemical identification of domesticated Escherichia coli

[0066] Bacterial biochemical identification experiments are used to determine whether the test bacteria have undergone functional changes after bile domestication.

[0067] The results showed that the test bacteria acclimated to bile conformed to the biochemical characteristics of Escherichia coli.

[0068] 6. Determination of total protein, direct bilirubin, total bile acids, and β-glucuronidase

[0069] The five bile-tolerant Escherichia coli strains (E. coli B1, B5, B7, B11, and B14) selected above were inoculated onto MacConkey agar and incubated at 37°C for 24 h. Single colonies of uniform size were carefully selected and inoculated into 5 mL of bovine bile to ensure equal initial bacterial concentration. The culture was then incubated at 37°C and 220 rpm with shaking for 12 h, followed by centrifugation to separate the supernatant. 100% (pure) bile without flavonoids served as a control.

[0070] The β-glucuronidase activity, direct bilirubin content, total protein content, and total bile acid content in the supernatant were determined using a β-glucuronidase assay kit (catalog number: A053-2-1, colorimetric method), a direct bilirubin (DBIL) assay kit (C019-1-1, chemical oxidation method), a protein quantification kit (A045-2, Coomassie brilliant blue method), and a total bile acid (TBA) assay kit (E003-2-1, microplate method). All the above kits were purchased from Nanjing Jiancheng Engineering Biology Institute.

[0071] like Figure 5-8 As shown, the results indicated that, compared with the control, the activity of β-glucuronidase in bile was significantly increased in the E. coli B14 inoculation group (P < 0.05), and was higher than that in other inoculation groups; while the contents of direct bilirubin, total protein and total bile acids were significantly decreased (P < 0.05).

[0072] Because *E. coli* utilizes proteins in bile and makes the bile acidic, a decrease in protein content indirectly reflects the growth activity of *E. coli* in bile. The formation of bezoar requires the enzymatic conversion of bound bilirubin into free bilirubin, i.e., direct bilirubin to indirect bilirubin. Therefore, the ability of flavonoids to convert direct bilirubin to indirect bilirubin is an important indicator for evaluating flavonoids. During *E. coli* proliferation, the β-glucuronidase released by *E. coli* catalyzes the conversion of water-soluble direct bilirubin to water-insoluble indirect bilirubin. After bile centrifugation, the direct bilirubin content in the supernatant decreases. Furthermore, bile acids in bile inhibit the conversion of direct bilirubin to indirect bilirubin, while *E. coli* consumes bile acids during proliferation, promoting the conversion of direct bilirubin to indirect bilirubin, thus increasing the probability of bezoar formation.

[0073] The above results demonstrate that the E. coli B14 strain exhibits the highest β-glucuronidase activity, indicating its strongest ability to convert direct bilirubin to indirect bilirubin. Therefore, this invention selects the E. coli B14 strain as a flavonoid and has deposited it in a bio-preservation repository. The preservation information is as follows:

[0074] The strain E. coli B14 is classified as Escherichia coli, with accession number CGMCC No. 28576, and the deposit date is September 28, 2023. The depository institution is the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

[0075] Example 2: Pathogenicity test of E. coli B14 in mice

[0076] Twenty healthy mice of similar weight were randomly divided into two groups: an infection challenge group and a control group, with ten mice in each group. The bacterial suspension concentration was adjusted to 1.0 × 10⁻⁶. 9 CFU / mL, take 1 mL of bacterial suspension and put it into a 1.5 mL centrifuge tube, centrifuge at 4000 r / min for 5 min, discard the supernatant, and prepare a suspension with 1 mL of sterile physiological saline. Each mouse in the challenge group was injected intraperitoneally with 0.5 mL of bacterial suspension, and the control group was injected with an equal volume of physiological saline. The diet, mental state, body temperature and survival of the mice were continuously observed and recorded. The experimental period was 14 days.

[0077] The results showed that all mice in both the challenge and control groups survived during the experimental period, with no significant changes in diet, mental state, or body temperature. These results indicate that the flavonoid E. coli B14 strain of this invention is non-pathogenic and safe for clinical use.

[0078] Example 3: Application of flavonoid E. coli B14 in the cultivation of bezoar

[0079] Select healthy fattening beef cattle weighing 150-250kg. Perform cholecystotomy using a surgical method. Use three tissue forceps or small hemostatic forceps to clamp the incision edge of the gallbladder at equal intervals, fully opening the incision. Then, the surgeon inserts a bezoar bed with one end facing the gallbladder neck into the gallbladder cavity, ensuring that the bezoar bed completely passes through the intercostal incision and enters the deep part of the gallbladder. The depth of insertion into the gallbladder should be to the body of the gallbladder. Then, fix the end of the fixation suture tied to the tail end of the bezoar bed to the gallbladder wall inside the gallbladder incision with a single suture, ensuring that the suture does not penetrate the gallbladder wall. After inserting the bezoar bed, suture the gallbladder incision.

[0080] Draw 5 mL of solution with a concentration of 2×10 9 A CFU / mL solution of E. coli B14, a flavonoid bacterium, was injected into the bezoar bed through the gallbladder wall using an injection needle. Postoperative care should be strengthened, and the diet, defecation, and urination of the bezoar-implanted cattle should be closely monitored to promote a rapid recovery to normal eating and growth.

[0081] After feeding the cattle with cultured bezoar for one year, the same surgical method was used to obtain cultured bezoar from the gallbladder. The obtained bezoar was dried and weighed, and the yield of cultured bezoar for each cow was recorded. Then, the appearance characteristics of the cultured bezoar, such as color, texture, and uniformity, were evaluated according to the Chinese Pharmacopoeia (2020 edition). Finally, the content of the main components such as bilirubin in the cultured bezoar was determined.

[0082] The results showed that the experimental cattle produced an average of 16.8g of bezoar per head per year. The cultivated bezoar was light in weight, with a golden to yellowish-brown surface and a glossy appearance. The bilirubin content was higher than 35%, which met the standards for high-quality bezoar.

[0083] The above description is merely a preferred embodiment of this application and is not intended to limit this application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the protection scope of this application.

Claims

1. A flavonoid bacterium tolerant to bile, characterized in that, The flammatories mentioned are Escherichia coli (Escherichia coli) Escherichia coli )B14, with accession number CGMCC No.28576.

2. An agent containing the flavonoid bacteria of claim 1, characterized in that, The viable count of flavogenic bacteria in the bacterial agent is greater than or equal to 10. 9 CFU / mL.

Images