A nucleic acid aptamer of a glial fibrillary acidic protein and use thereof

By screening for high-affinity nucleic acid aptamers and combining them with colorimetric or fluorescence analysis, the cost and portability issues of GFAP detection in plasma have been resolved, enabling efficient and accurate early diagnosis of Alzheimer's disease.

CN118006619BActive Publication Date: 2026-06-23THE 900TH HOSPITAL OF THE CHINESE PEOPLES LIBERATION ARMY JOINT LOGISTICS SUPPORT FORCE

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
THE 900TH HOSPITAL OF THE CHINESE PEOPLES LIBERATION ARMY JOINT LOGISTICS SUPPORT FORCE
Filing Date
2024-01-31
Publication Date
2026-06-23

AI Technical Summary

Technical Problem

Existing technologies are difficult to use in a low-cost and portable manner to detect glial fibrillary acidic protein (GFAP) in plasma, which limits the widespread application of early diagnosis and prediction of Alzheimer's disease.

Method used

The exponential enrichment ligand systematic evolution technique (SELEX) was used to screen for nucleic acid aptamers with high affinity and specificity for GFAP, and detection probes were formed through chemical modification. These probes were then combined with colorimetric or fluorescence analysis to achieve rapid detection of GFAP.

Benefits of technology

It provides a highly sensitive, specific, and accurate GFAP detection method, reduces detection costs, is easy to promote, and improves the accuracy of early diagnosis of Alzheimer's disease.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118006619B_ABST
    Figure CN118006619B_ABST
Patent Text Reader

Abstract

The present application relates to a nucleic acid aptamer of glial fibrillary acidic protein and application thereof, and the nucleotide sequence of the nucleic acid aptamer is shown as SEQ ID NO. 1. The glial fibrillary acidic protein aptamer provided by the present application has good affinity and specificity to glial fibrillary acidic protein, and can be applied in a method for detecting glial fibrillary acidic protein or a corresponding kit, and specifically can be made into a recognition probe, used as a detection reagent and the like for detection of glial fibrillary acidic protein and improvement of early diagnosis rate of Alzheimer's disease in combination with other indexes. The glial fibrillary acidic protein aptamer provided by the present application has high sensitivity, specificity and accuracy for detection of glial fibrillary acidic protein.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, and in particular relates to a nucleic acid aptamer for a gelatinous acidic protein and its application. Background Technology

[0002] Alzheimer's disease (AD) is a neurodegenerative disease of the central nervous system that occurs in old age and pre-old age, characterized by progressive cognitive impairment and behavioral disturbances. AD is one of the most common types of dementia and a leading cause of death in the elderly, placing a significant economic burden on families and society. The period between pathological changes and the onset of clinical symptoms in AD is quite long. In the preclinical stage, patients may have normal cognitive function, but pathological changes have already occurred, sometimes as early as 20 years before the appearance of clinical symptoms. Therefore, identifying biomarkers for early diagnosis and intervention in the preclinical stage of AD is of great significance.

[0003] Numerous studies have demonstrated that glial fibrillary acidic protein (GFAP) reflects the process of glial cell activation, significantly increasing even in the preclinical stage of Alzheimer's disease (AD). It can accurately identify different clinical stages of AD and differentiate between AD dementia and non-AD dementia, and can be used to predict AD clinical progression, making it a potential new biomarker for early diagnosis and disease prediction. However, due to the low levels of GFAP in plasma, it is difficult to detect using enzyme-linked immunosorbent assays (ELISA) and chemiluminescence immunoassays. Currently, clinical testing often employs ultrasensitive single-molecule immunoassay array technology. However, the high cost per test and reliance on expensive equipment limit its widespread application in primary hospitals. Therefore, further exploration of lower-cost, portable, and easily implemented detection methods is needed.

[0004] Aptamers are oligonucleotide sequences screened in vitro using Systematic Elution of Ligands by Exponential Enrichment (SELEX) technology. They are capable of binding to specific targets, including small molecules, proteins, and even whole cells. Aptamers possess antibody-like binding and recognition functions and are known as "chemical antibodies." Furthermore, aptamers offer many significant advantages over antibodies, including ease of synthesis, ease of chemical modification, good stability, low toxicity, low immunogenicity, and rapid tissue penetration. In recent years, rapid analytical methods based on aptamers have shown great potential in the detection of various target proteins. An increasing number of aptamers for AD biomarkers have been successfully screened; currently reported examples include Tau protein, amyloid-β, and BACE1. This patent is the first to apply magnetic beads to screen GFAP aptamers, and it is hoped that a GFAP detection method based on aptamers can be established in the future. Summary of the Invention

[0005] (I) Technical Problem to be Solved In view of the above-mentioned shortcomings and deficiencies of the prior art, the present invention provides a method for screening nucleic acid aptamers for glial fibrillary acidic protein. The nucleic acid aptamer has a strong affinity and specificity for glial fibrillary acidic protein and can be used for efficient detection of glial fibrillary acidic protein.

[0006] Accordingly, the present invention also provides a method for screening nucleic acid aptamers of glial fibrillary acidic proteins.

[0007] Accordingly, the present invention also provides a nucleic acid aptamer for glial fibrillary acidic protein as a detection reagent for the detection of glial fibrillary acidic protein and in combination with other indicators to improve the early diagnosis rate of Alzheimer's disease.

[0008] That is, the present invention also provides the application of the nucleic acid aptamer in the preparation of products for detecting glial fibrillary acidic protein and in the establishment of a method for detecting glial fibrillary acidic protein.

[0009] (II) Technical Solution

[0010] To achieve the above objectives, the main technical solutions adopted by the present invention include:

[0011] In a first aspect, the present invention provides a nucleic acid aptamer for a glial fibrillary acidic protein, the nucleotide sequence of which is: 5'-TTCAGCACTCCACGCATAGCTCAGTCAGGGGGGCTGCTCGGGATTGCGGATACGGACCTATGCGTGCTACCGTGAA-3' (as shown in SEQ ID NO.1), wherein the orientation of the nucleotide sequence is 5'-3'.

[0012] The nucleic acid aptamer of the aforementioned gel fibrous acidic protein is chemically modified at its 5' or 3' end with a fluorescent group, thiol group, amino group, biotin, digoxigenin, or polyethylene glycol.

[0013] The nucleic acid aptamer of the aforementioned gelatinous fibrous acidic protein, at 25°C, [Na] + ]=137mM, [Mg 2+ Under the condition of 0.85 mM, the spatial structures of the nucleic acid aptamers are as follows:

[0014] .

[0015] Secondly, the present invention provides a method for screening nucleic acid aptamers of the above-mentioned glial fibrillary acidic protein, which includes the following steps:

[0016] S1 designed upstream and downstream primers and synthesized the corresponding random library;

[0017] S2 anti-target protein was coupled with carboxyl magnetic beads to prepare anti-sieve magnetic beads;

[0018] Target proteins were coupled with carboxyl magnetic beads to prepare positive sieve magnetic beads.

[0019] S3 uses a random library as the initial library and performs 8 to 20 rounds of screening to obtain the nucleic acid aptamers;

[0020] The first round involves positive sieving of magnetic beads using only the initial library;

[0021] For the second and subsequent rounds of screening, the single-stranded secondary library obtained from the previous round of screening is first incubated with the reverse screening protein to complete the reverse screening; then it is incubated with the target protein to complete the forward screening.

[0022] Thirdly, the present invention also provides the application of the nucleic acid aptamer in the preparation of reagents, kits or sensors for detecting glial fibrillary acidic proteins.

[0023] The application of the described nucleic acid aptamer in the preparation of probes for detecting acidic proteins in glial fibrils.

[0024] The probe is formed by modifying the 5' end of the nucleic acid aptamer with a fluorescent group or by modifying it with a thiol group.

[0025] The application of the described nucleic acid aptamer in establishing a detection method for glial fibrillary acidic protein.

[0026] The detection method is a rapid colorimetric detection method. To establish this method, a thiol group can be modified at the 5' end of the nucleic acid aptamer. Then, the thiol-modified nucleic acid aptamer is coupled with gold nanoparticles to catalyze the color development of TMB.

[0027] The detection method can also be fluorescence analysis.

[0028] A fluorescent group was modified at the 5' end of the nucleic acid aptamer to establish a fluorescence analysis method.

[0029] The fluorescent group is a FAM group.

[0030] (III) Beneficial Effects

[0031] The nucleic acid aptamer for glial fibrillary acidic protein provided by this invention fills a gap in the field of nucleic acid aptamers for glial fibrillary acidic protein. It has good affinity and specificity for glial fibrillary acidic protein. It can be used in methods or corresponding kits for detecting glial fibrillary acidic protein. Specifically, it can be made into a molecular probe, used as a detection reagent, etc. for the detection of glial fibrillary acidic protein and combined with other indicators to improve the early diagnosis rate of Alzheimer's disease.

[0032] The collagen fibrous acidic protein aptamer provided by this invention can be artificially synthesized, has low cost, short production cycle, and is easy to chemically modify.

[0033] The screening method provided by this invention is simple and the screened library has a high retention rate.

[0034] The aptamer for detecting glial fibrillary acidic proteins provided by this invention has high sensitivity, specificity and accuracy. Attached Figure Description

[0035] Figure 1 This is a graph showing the retention rate results of each round of the library as measured in Example 3 of the present invention;

[0036] Figure 2 This is a graph showing the changes in the ability of the secondary library obtained from rounds 3, 5, 7, 9, and 11 of screening in Example 4 of the present invention to detect the GFAP protein.

[0037] Figure 3 In Example 4 of this invention, the response values ​​of nine candidate sequences to GFAP protein were measured;

[0038] Figure 4 For Example 6 of this invention, the response value and kd value of the aptamer from Example 1 to the GFAP protein were measured for characterization.

[0039] Figure 5 Simulated diagram of the secondary structure of the aptamer in Example 1

[0040] Figure 6 The graph shows the results of determining the specificity of the aptamer from Example 1 for GFAP protein in Example 8; Detailed Implementation

[0041] The present invention will now be described in detail with reference to the accompanying drawings and embodiments:

[0042] To better explain and facilitate understanding of the present invention, specific embodiments are described in detail below. To further understand the above technical solutions, exemplary embodiments of the present invention will be described in more detail below. While exemplary embodiments of the present invention are shown below, it should be understood that the present invention can be implemented in various forms and should not be limited to the embodiments set forth herein. Rather, these embodiments are provided to enable a clearer and more thorough understanding of the present invention and to fully convey the scope of the invention to those skilled in the art.

[0043] Example 1

[0044] This embodiment provides a nucleic acid aptamer for a gliadin acidic protein, with the following nucleotide sequence, all oriented 5'-3'.

[0045] SEQ ID NO.1:

[0046] TTCAGCACTCCACGCATAGCTCAGTCAGGGGGGCTGCTCGGGATTGCGGATACGGACCTATGCGTGCTACCGTGAA

[0047] This sequence is labeled: GFAP-01

[0048] This embodiment also provides a probe for detecting nucleic acid aptamers of glial fibrillary acidic proteins, which is: GFAP-01 modified with a fluorescent group or modified with a thiol group;

[0049] Example 2

[0050] This embodiment provides a method for screening nucleic acid aptamers as described in Example 1, which is as follows:

[0051] S1 Synthesis: Random Single-Stranded DNA (ssDNA) Library and Primers

[0052] Random single-stranded DNA (ssDNA) library: 5'-TTCAGCACTCCACGCATAGC-N(36)-CCTATGCGTGCTACCGTGAA-3', where N(36) represents 36 random nucleotides. This library was synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0053] Forward primer (Lib76S1-FAM): 5'-FAM-TTCAGCACTCCACGCATAGC-3',

[0054] Reverse primer (Lib76A2-polyA): 5'-ployA(19A)-Spacer 18-TTCACGGTAGCACGCATAGG-3',

[0055] ① In the reverse primer, 19A represents a polyA tail composed of 19 adenosine nucleotides (A);

[0056] ②“Spacer 18” indicates the 18-atom inter-arm of hexaethylene glycol;

[0057] The primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The primers were prepared into 100 μM stock solutions using PBS buffer (0.1 g / L calcium chloride, 0.2 g / L potassium chloride, 0.2 g / L potassium dihydrogen phosphate, 0.1 g / L magnesium chloride hexahydrate, 8 g / L sodium chloride, 2.8915 g / L disodium hydrogen phosphate dodecahydrate; pH 7.4, 25℃) and stored at -20℃ for later use.

[0058] S2 Carboxyl Magnetic Bead Screening Method

[0059] S2.1 Magnetic Bead Activation:

[0060] Take 50 μL of carboxylated magnetic beads and wash them four times with 200 μL of ultrapure water. Take 50 μL of 0.1 M N-hydroxysuccinimide (NHS) aqueous solution and 50 μL of 0.4 M 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) aqueous solution, thaw them at 4 °C and mix them well. Quickly add them to the magnetic beads and incubate them on a shaker for 20 min. After activation, use a magnet to pick up the magnetic beads, remove the supernatant, and wash them with 200 μL of ultrapure water.

[0061] Among them, the conjugation of S2.2 backscreen protein (MB-BSA) by EDC (Sigma, catalog number: E6383) and NHS (Sigma, catalog number: 56480) is as follows:

[0062] Take 10 μL of bovine serum albumin (BSA) (concentration 5 mg / mL), add 90 μL of NaAc solution (pH 4.0), mix well, add to activated magnetic beads, and incubate on a shaker for 60 min. After coupling, use a magnet to hook the magnetic beads, discard the supernatant, add 100 μL of 1M ethanolamine (pH 8.5), and incubate on a shaker for 10 min. Use a magnet to hook the magnetic beads, discard the supernatant, wash four times with 200 μL DPBS, and store at 4℃ for later use. MB-BSA is used as a reverse screening target.

[0063] Among them, 1M ethanolamine (Sigma, catalog number: 411000)

[0064] Conjugation of S2.3 positive screening protein (MB-GFAP):

[0065] Take 10 μL of GFAP protein (purchased from Suzhou Nearshore Protein Technology Co., Ltd., concentration 1 mg / ml), add 40 μL of NaAc (pH 4.0) solution and mix well. Add the mixture to the activated magnetic beads that have been washed once with ultrapure water and incubate on a shaker for 60 min. After coupling, remove the magnetic beads with a magnet, discard the supernatant, add 100 μL of 1M ethanolamine (pH 8.5), and incubate on a shaker for 10 min. Remove the magnetic beads with a magnet, discard the supernatant, wash four times with 200 μL of DPBS, and store at 4℃ for later use. MB-GFAP is used as a positive screening target.

[0066] If the magnetic beads clump together during incubation, they need to be shaken occasionally.

[0067] S2.4 Screening: Using a random library as the initial library, 11 rounds of screening are conducted.

[0068] The first round of screening uses only positive screening magnetic beads on a randomized library (after renaturation treatment before selection). Subsequent rounds of screening involve sequential reverse and positive screening. After each round of screening, the library is amplified by PCR and then prepared into single-stranded DNA to form a secondary library. This secondary library, after renaturation treatment, serves as the starting library for the next round of screening.

[0069] The denaturation and annealing process is as follows: Take out 1 OD of the starting library, add 280 μL of PBS, dilute to 5 μM, denature at 95°C for 10 minutes in a PCR instrument, incubate in an ice-water bath for 5 minutes, and store at room temperature.

[0070] The specific concentrations prepared during the initial library renaturation treatment at each screening are shown in Table 1.

[0071] Table 1 shows the concentration of the initial library preparation for each round of screening.

[0072] Filtering documents Configuration method concentration Round 1 Initial library + 280 μL PBS 5μM Round 2 Starting library 127μL 500nM Round 3 Starting library (73 μL) + 27 μL PBS 500nM Round 4 Starting library (48 μL) + 52 μL PBS 500nM Round 5 Starting library (42 μL) + 58 μL PBS 500nM Round 6 Starting library (65 μL) + 35 μL PBS 500nM Round 7 Starting library 100μL 500nM Round 8 Starting library (63 μL) + 37 μL PBS 500nM Round 9 Starting library (100 μL) 233nM Round 10 Starting library (100 μL) 352nM Round 11 Starting library (100 μL) 250nM

[0073] The secondary libraries obtained from rounds 1-11 of screening, after undergoing commutativity processing, are respectively designated as pool1, pool2, pool3, pool4, pool5, pool6, pool7, pool8, pool9, pool10, and pool11.

[0074] Each round of screening includes sequential reverse screening and forward screening:

[0075] The reverse screening method is as follows: the starting library is added to MB-BSA, slowly mixed by pipetting, and incubated on a shaker for 60 min; magnetic beads are hooked with a magnet, and the supernatant is labeled as pool-. The magnetic beads are rinsed 4 times with 200 μL DPBS, and the supernatants from the 4 rinses are labeled as wash1-, wash2-, wash3-, and wash4-, respectively; 200 μL DPBS is added to the magnetic beads again, and the mixture is boiled in a water bath for 10 min. The supernatant from the magnetic beads is labeled as elution-.

[0076] The positive sieving method is as follows: add pool- to MB-GFAP, mix slowly with a pipette, and incubate on a shaker for 60 min; use a magnet to pick up the magnetic beads and discard the supernatant; add 200 μL DPBS and wash 4 times, using a magnet to pick up the magnetic beads, and record the supernatant from the 4 washes as wash1+, wash2+, wash3+, and wash4+ respectively; add 200 μL DPBS to the magnetic beads again, boil in a water bath for 10 min, use a magnet to pick up the magnetic beads, and record the supernatant as elution+;

[0077] The method for preparing the secondary library is as follows:

[0078] ePCR amplification preparation of double strands: The elution+ library, after reverse and forward screening, was added to 2 mL of PCR mix and mixed well. Then, 8 mL of ePCR droplet generation oil was added, vortexed, and allowed to stand for 3 min. If no layering was observed, the emulsion was evenly added to 8×12 PCR tubes, 100 μL per well, for PCR amplification. The ePCR droplet generation oil was purchased from Aptamy Biotechnology Co., Ltd. (Catalog No.: EPO100). The PCR amplification program was: 95℃ for 3 min, 95℃ for 1 min, 60℃ for 1 min, 72℃ for 1 min, 30 cycles, 72℃ for 5 min, and 4℃ forever.

[0079] The PCR mix formulation is shown in Table 2:

[0080] Table 2: PCRmix formulations

[0081] reagents Total volume 1000μl ddH2O 866μL 10×pfμenzyme bμffer 100μL dNTPmix(10mM) 20μL Lib76S1-FAM (100μM) 5μL Lib76A2-polyA (100μM) 5μL Pfu enzyme 4μL (20U)

[0082] PCR product concentration: Collect the PCR product and aliquot it into two 15mL centrifuge tubes. Add 8mL of n-butanol to each tube, vortex to mix, centrifuge at 7500rpm for 10min, discard the upper n-butanol, and recover the lower dsDNA product.

[0083] Preparation of FAM-labeled single-stranded DNA (long and short chain method): Concentrated PCR products were added to an equal volume of 2×TBE / urea denaturing buffer (Anhui Angpu Tuomai Biotechnology Co., Ltd., catalog number: TLB-5). The mixture was denatured at 100℃ for 10 min in a PCR instrument. All samples were then subjected to urea-denaturing polyacrylamide gel electrophoresis at 300V until bromophenol blue reached the bottom of the gel, separating the single-stranded DNA with PolyA from the FAM-labeled single-stranded DNA. The formulation of the 7M urea-denaturing polyacrylamide gel is shown in Table 3.

[0084] Table 3: Formulation of Modified Polyacrylamide Gel

[0085]

[0086]

[0087] Recovery of FAM-labeled strands: Remove the PAGE gel onto a plastic film. Under UV light, a single target band of FAM-labeled ssDNA can be observed. Cut off the fluorescent band with a clean blade and place it into a 0.5 mL centrifuge tube. Transfer the tube to a 1.5 mL centrifuge tube and centrifuge at 12000 rpm for 2 min. Add 1 mL of DPBS to the 1.5 mL centrifuge tube, boil in water for 60 min, centrifuge at 12000 rpm for 2 min, and transfer the supernatant to a 15 mL centrifuge tube. Take another 1 mL of the supernatant... Add DPBS buffer to the gel fragments, repeat boiling and centrifugation once, and transfer all supernatant to the same 15mL centrifuge tube; add 5 volumes of n-butanol to the 15mL centrifuge tube to concentrate the single-stranded DNA, invert and mix well, centrifuge at 7500g for 5min; the solution will separate into layers, remove the upper layer and recover the lower layer; then load it into a 3.5KD micro-nucleic acid dialysis device, dialyze overnight in PBS at 4℃, and determine the nucleic acid concentration using a NanoDrop-2000c ultra-micro spectrophotometer to obtain the secondary library.

[0088] After 11 rounds of screening, the nucleic acid aptamer of Example 1 was obtained through sequencing in this embodiment.

[0089] Example 3

[0090] This embodiment provides a method for determining the enrichment level of a library in the screening method of Embodiment 1, the steps of which are as follows:

[0091] Thaw the qPCR mix at low temperature (4–20℃) and centrifuge at 5000 rpm for 30 seconds. Take an eight-tube qPCR array and add 28 μL of qPCR mix to each well. Add 2 μL each of the washing and elution samples from both the positive and reverse screening (Elution and Wash 1–4 samples) to the qPCR mix. Leave one tube as a blank control with 2 μL of PBS. Begin quantitative real-time PCR (qPCR) detection. The program is as follows: 95℃ for 2 min; 95℃ for 0.5 min, 60℃ for 0.5 min, 72℃ for 0.5 min, 25 cycles.

[0092] Standard curves were plotted using initial libraries of different concentrations, and the library retention rate for each round was calculated based on the qPCR results of this embodiment. The results are as follows: Figure 1 As shown.

[0093] Figure 1 This represents the retention rate of the secondary library binding to the GFAP protein in each round of screening, after 11 rounds. Figure 1 It can be seen that the retention rate of positive screening gradually increases, and after the 9th round, the retention rate tends to saturate. After two more rounds, the screening is terminated.

[0094] Example 4

[0095] This embodiment provides a method for detecting the binding affinity of a secondary library to GFAP target proteins using flow cytometry.

[0096] This embodiment examines the changes in the GFAP protein recognition ability of the secondary libraries obtained from rounds 3, 5, 7, 9, and 11 of screening in Example 2. The specific detection steps are as follows:

[0097] Step 1: Preparation of magnetic bead-coupled protein detection solution: Take 18 μl of nickel magnetic beads, wash twice with 72 μl of ultrapure water, add 6 μl of GFAP (300 μg / ml) to the washed magnetic beads, and react at room temperature for 40 min; after coupling is completed, remove the supernatant and wash the magnetic beads 4 times.

[0098] Step 2, Reaction: Divide the magnetic beads conjugated with GFAP protein in Step 1 into 6 tubes. Add 20 μL (500 nM) of the secondary libraries obtained from rounds 3, 5, 7, 9, and 11 of screening to each tube, respectively. Denature at 95°C for 10 min, then anneal in ice water for 5 min. Incubate on a shaker at room temperature for 60 min. After the reaction, suspend the magnetic beads with a magnet, wash twice with 200 μL DPBS, and resuspend in 500 μL PBS. Use the remaining tube as a control. Analyze the results using flow cytometry. Figure 2 The results are shown in the figure below;

[0099] Figure 2 middle,

[0100] MB+GFAP represents the results obtained using the control magnetic bead detection solution;

[0101] MB+GFAP+Round 3, MB+GFAP+Round 5, MB+GFAP+Round 7, MB+GFAP+Round 9, and MB+GFAP+Round 11 represent the results of the secondary libraries obtained from the GFAP magnetic bead-coupled protein screening in the corresponding rounds 3, 5, 7, 9, and 11, respectively.

[0102] from Figure 2 It can be seen that the affinity of GFAP magnetic bead-coupled protein to the secondary libraries obtained in rounds 3, 5, 7, 9, and 11 of screening gradually increases, meeting the sequencing requirements.

[0103] For high-throughput sequencing, libraries 4, 5, 6, 8, and 11 were analyzed for concentration using a NanoDrop 2000c ultra-micro spectrophotometer. The samples were diluted to 500 nM (20 μL) and sent to Anhui Angpu Tuomai Biotechnology Co., Ltd. for high-throughput sequencing. After sequencing, homology analysis was performed, and nine sequences were selected and synthesized by Shanghai Sangon Biotech Co., Ltd. Surface plasmon resonance (SPR) was used to detect the binding affinity of each sequence to GFAP. The aptamer with the highest binding affinity was selected for further determination of the dissociation constant of the GFAP protein.

[0104] The random sequences in the middle of the nucleotide sequences of the nine sequences are as follows:

[0105] GFAP-01:TCAGTCAGGGGGGCTGCTCGGGATTGCGGATACGGA

[0106] GFAP-02: TGGGGCCTGGGTGTTGGGGTTTGGGGTGTGTGTGTG

[0107] GFAP-04:TCGGTCTGGGGATGGGGTTTGGCGGTTGGGGTAGAG

[0108] GFAP-07:CATGTGGGGTTTTGGGGTCTGGGGCCTGGGTGATCTT

[0109] GFAP-09:GAACGTGGGGCCTGGGCGTTGGGGTTTGGGGGTCT

[0110] GFAP-10:TCACCGAGGATTGCCCAGGTCTGCTGCCGGTCTCTA

[0111] GFAP-12: CGCACGGTGGTTTGGTTGGACTGGTCAGTGCTTTTT

[0112] GFAP-16: TACTGGTGGGGTTTGGGAGTTGGGGTCTGGGGTTAT

[0113] GFAP-19: CGTCGTGGCGGTTTGGGGTTGGGGTCTGGGGTTAGA;

[0114] Example 5

[0115] In this embodiment, surface plasmon resonance (SPR) was used to detect the binding of the nine nucleic acid sequences screened in Example 4 to the GFAP protein.

[0116] This embodiment detected changes in the GFAP protein recognition ability of nine nucleic acid sequences through screening. The specific detection steps are as follows:

[0117] The DNA sequence was dissolved in DPBS and diluted to 2 μM.

[0118] S1. Chip surface treatment: Clean the chip with a 50mM NaOH + SDS mixed solution at a flow rate of 30μl / min, with each injection lasting 150s, for a total of 3 times; then clean the chip with a 50mM NaOH aqueous solution at a flow rate of 30μl / min, with each injection lasting 150s, for a total of 3 times.

[0119] S2, GFAP protein conjugation: The chip was activated using an activation mixture at a flow rate of 10 μl / min; channel 4 was activated for 600 s. The GFAP protein was then diluted to 25 μg / ml with a 10 mM sodium acetate aqueous solution (pH 3.6) and injected into channel 4 for 760 s. The conjugated amount of GFAP protein was 30 Ru. Secondary chip activation and conjugation: The chip was activated using an activation mixture at a flow rate of 10 μl / min; channel 4 was activated for 600 s. The GFAP protein was then diluted to 50 μg / ml with a 1:1 mixture of 10 mM sodium acetate (pH 3.6) and 10 mM sodium acetate (pH 4.0) and injected into channel 4 for 900 s. The conjugated amount of GFAP protein was 300 Ru. After the injection, channel 4 was blocked with pH 8.5 ethanolamine hydrochloride at a flow rate of 10 μl / min for 10 min.

[0120] S3. Control channel treatment: Inject the chip with the activation mixed solution at a flow rate of 10 μl / min; activate 3 channels for 600 s. After activation, inject pH 8.5 ethanolamine hydrochloric acid to seal 3 channels at a flow rate of 10 μl / min for 600 s.

[0121] S4. Detection: Using a surface plasmon resonance spectrometer (GE Healthcare, model: Biacore T200), set the kinetic detection parameters. Dilute the DNA sequence to 2 μM with buffer and inject it sequentially through channels 3 and 4 at a flow rate of 25 μl / min for 150 s. The dissociation flow rate was 25 μl / min for 150 s. Each sequence sample was regenerated with 1 M NaCl at a flow rate of 25 μl / min for 60 s. After regeneration, the sample was stabilized for 60 s.

[0122] The detection results in this embodiment are as follows: Figure 3 As shown, Figure 3 Channel 1 represents the binding value of GFAP protein to DNA sequence under steady state. Channel 3 represents the response value of aptamers to GFAP target proteins, and Channel 1 represents the blank response value. Figure 3The GFAP-01 sequence of the selected Example 1 showed a high response value to the GFAP protein.

[0123] Example 6

[0124] This embodiment provides surface plasmon resonance (SPR) detection of the dissociation constants of the nucleic acid aptamer sequence and GFAP protein described in Example 1.

[0125] Nucleic acid aptamer solutions with different concentration gradients: Take the nucleic acid aptamer from Example 1 and dilute it with PBS to final concentrations of 4 μM, 2 μM, 1 μM, 0.5 μM, 0.25 μM, 0.125 μM, 0.0625 μM, 0.03125 μM, 0.015625 μM, 0.0078125 μM, 0.00390625 μM, and 0 μM.

[0126] Activation solution: an equal volume mixture of 0.4M EDC aqueous solution and 0.1M NHS aqueous solution.

[0127] S1. Chip surface treatment: Clean the chip with a 50mM NaOH+SDS mixed aqueous solution at a flow rate of 30μl / min, with each injection lasting 2min, for a total of 3 times; clean the chip with a 50mM NaOH aqueous solution at a flow rate of 30μl / min, with each injection lasting 2min, for a total of 3 times.

[0128] S2, GFAP protein coupling: Activate the chip using an activation mixture at a flow rate of 10 μl / min; activate channel 4 for 600 s. Dilute the GFAP protein to 20 μg / ml with a 1:1 mixture of 10 mM sodium acetate solution (pH 3.6) and 10 mM sodium acetate solution (pH 4.0) and inject it into channel 4 at a flow rate of 10 μl / min for 2000 s. The GFAP protein coupling amount is 200 Ru. After injection, dilute the GFAP protein to 50 μg / ml with a 1:1 mixture of 10 mM sodium acetate solution (pH 3.6) and 10 mM sodium acetate solution (pH 4.0) and inject it into channel 4 at a flow rate of 10 μl / min for 750 s. The GFAP protein conjugation amount was 1566 Ru. After the injection, four channels were blocked with pH 8.5 ethanolamine hydrochloric acid at a flow rate of 10 μl / min for 10 min.

[0129] S3. Control channel treatment: Inject the chip with the activation mixed solution at a flow rate of 10 μl / min; activate 3 channels for 600 s. After activation, inject pH 8.5 ethanolamine hydrochloric acid to seal 3 channels at a flow rate of 10 μl / min for 600 s.

[0130] S4. Detection: Using a surface plasmon resonance spectrometer (GE Healthcare, model: Biacore T200), the kinetic detection parameters were set. The DNA sequence was serially diluted with buffer and injected sequentially through channels 3 and 4 at a flow rate of 30 μl / min for 3 min. The dissociation flow rate was 30 μl / min for 3 min. Each sequence sample was regenerated with 2M NaCl at a flow rate of 30 μl / min for 75 s. After regeneration, the sample was stabilized for 90 s.

[0131] The experimentally measured KD value was 621.4 nM, such as Figure 4 As shown.

[0132] Example 7

[0133] This embodiment provides a simulation of the secondary structure of the aptamer in Example 1. The spatial structure of the aptamer is simulated using the `unfold` method, and the results are as follows: Figure 5 As shown.

[0134] At 25℃, [Na + ]=137mM, [Mg 2+ Under the condition that ] = 0.85mM, the spatial structure of the folded aptamer is simulated, such as Figure 5 As shown, the aptamer has a stable stem-ring structure, which is structurally stable.

[0135] Example 8

[0136] This embodiment provides a method for the specific detection of GFAP protein using aptamers, the steps of which are as follows:

[0137] Step 1: Preparation of aptamer solution: Take the nucleic acid aptamer from Example 1 and pass it through PBS buffer (NaCl 137mM, KCl 2.67mM, Na2HPO4 10mM, KH2PO4 2mM).

[0138] Dilute to a concentration of 5 μM to obtain an aptamer solution;

[0139] Step 2: Preparation of magnetic bead-coupled protein detection solution: Take 20 μl of nickel magnetic beads and wash with 80 μl of ultrapure water for 4 minutes.

[0140] Then, divide the tubes into four equal parts and add 10 μl each of GFAP, Aβ, Tau, and Ng to the cleaned magnetic beads.

[0141] Then, allow the reaction to proceed at room temperature for 40 minutes. After coupling is complete, remove the supernatant and wash the magnetic beads four times.

[0142] Step 3, Reaction: Divide the conjugated proteins into two tubes each, resulting in a total of eight tubes. Add 5 μM and 20 μL of the sequenced protein (selected after sequencing) to four tubes and incubate at room temperature for 60 min. After the reaction, wash each tube twice with DPBS and resuspend in 500 μL PBS. Resuspend the remaining four tubes directly in 500 μL PBS as control magnetic beads. Finally, take 3 μL of the control magnetic beads and resuspend them directly in 500 μL PBS as blank magnetic beads.

[0143] Figure 6 middle,

[0144] MB represents the results obtained using blank magnetic bead detection solution.

[0145] MB+GFAP, MB+Aβ, MB+Tau, and MB+Ng represent the results obtained using the control magnetic bead detection solution.

[0146] Resulting image;

[0147] MB+GFAP+apt, MB+Aβ+apt, MB+Tau+apt, and MB+Ng+apt represent aptamers and...

[0148] The binding patterns of different proteins.

[0149] from Figure 6 From this, it can be concluded that the nucleic acid aptamer obtained in Example 1 can recognize GFAP and has a

[0150] It has a certain affinity for GFAP and no affinity for other proteins, which proves that the nucleic acid aptamer of the present invention has a strong specific binding ability to GFAP.

[0151] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A nucleic acid aptamer for a gelatinous acidic protein, characterized in that: Its nucleotide sequence is: 5'-TTCAGCACTCCACGCATAGCTCAGTCAGGGGGGCTGCTCGGGATTGCGGATACGGACCTATGCGTGCTACCGTGAA-3'.

2. The nucleic acid aptamer for gliadin acidic protein according to claim 1, characterized in that: At 25℃, [Na + ]=137mM, [Mg 2+ Under the condition of 0.85mM, the spatial structures of the nucleic acid aptamers are as follows: 。 3. The nucleic acid aptamer for gliadin acidic protein according to claim 1, characterized in that: The 5' or 3' end of the nucleic acid aptamer is chemically modified with a fluorescent group, thiol group, amino group, biotin, digoxigenin, or polyethylene glycol.

4. The use of the nucleic acid aptamer as described in any one of claims 1-3 in the preparation of reagents, kits, or sensors for detecting glial fibrillary acidic proteins.

5. The use of the nucleic acid aptamer as described in any one of claims 1-3 in the preparation of a probe for detecting glial fibrillary acidic protein.

6. The application as described in claim 5, characterized in that: The probe is formed by modifying the 5' end of the nucleic acid aptamer with a fluorescent group or by modifying it with a thiol group.