Sodium alginate / functional DNA composite adsorption material, and preparation method and application thereof

Abstract

The application belongs to the technical field of seawater uranium extraction composite biomaterials, and particularly relates to a sodium alginate / function DNA composite adsorption material and a preparation method and application thereof. The sodium alginate / function DNA composite adsorption material can be applied to efficient and specific extraction of uranium (UO 2+ ) elements from seawater, and the material has multiple characteristics such as environmental friendliness, high stability, high selectivity and reusability.

Description

Technical Field

[0001] This invention belongs to the field of seawater uranium extraction composite biomaterials technology, specifically relating to a sodium alginate / functional DNA composite adsorbent material, its preparation method, and its application. Background Technology

[0002] In recent years, global energy demand has been growing steadily, and nuclear energy has advantages such as high efficiency, environmental friendliness, and inexhaustible resources. Uranium, as an important resource for nuclear power, has attracted increasing attention from researchers. Currently, uranium extraction mainly comes from terrestrial uranium ore. However, terrestrial mineral resources are becoming increasingly scarce, ore prices are rising, and production scale cannot be expanded, leading to increasingly high costs for uranium products. In addition, the extraction of metals from mineral resources causes environmental impacts such as water pollution and depletion, soil degradation, and air pollution. It is estimated that seawater contains 4.5 billion tons of uranium, thousands of times more than terrestrial resources (Yuan YH, Yu QH, Wen J et al. Ultrafast and Highly Selective Uranium Extraction from Seawater by Hydrogel-like Spidroin-based Protein Fiber[J]. Angew Chem Int Edit, 2019, 58: 11785-11790.). Therefore, the extraction and utilization of uranium resources from seawater has attracted much attention from researchers worldwide. Compared with mineral resources, uranium in seawater is mainly produced by uranyl ions (UO2). 2+ UO3 exists in the form of [unclear - possibly a specific substance or form], and its enrichment and separation process is energy-efficient and environmentally friendly, possessing significant resource and environmental advantages. However, UO3 in seawater... 2+ However, the concentration is extremely low (≈3ppb). In addition, the harsh marine environment, a large number of competing interfering ions, and severe biofouling are all key factors that restrict the smooth progress of seawater uranium extraction. Therefore, the development of economical, efficient, and green seawater uranium extraction materials has become a research hotspot for researchers and scientific workers around the world.

[0003] The binding of DNA-based biomacromolecules to metal ions has been a long-standing fundamental research topic. The development and preparation strategies of DNA-based ion detectors and ion adsorption materials have received considerable attention (Tang JP, Yao C, Gu Zet al. Super-Soft and Super-Elastic DNARobot with Magnetically Driven Navigational Locomotion for Cell Delivery in Confined Space[J]. Angew Chem Int Edit, 2020, 59: 2490-2495.). Furthermore, due to the potential applications of DNA in medicine and materials science, the application of DNA-based ion adsorption materials in the selective extraction of uranium from seawater has become possible. Functional DNA refers to nucleic acid sequences with specific functions, such as the ability to specifically bind to ligands or catalytic activity (Xu Wentao, Yang Min, Zhu Longjiao, et al. The connotation and extension of the concept of functional nucleic acids[J]. Progress in Biotechnology, 2021, 11(4): 446.). In addition, functional DNA is easy to chemically modify and functionalize, has low cost, reproducible synthesis, and is environmentally friendly. Therefore, specific biomolecular recognition based on DNA structure and properties is expected to become a breakthrough in the precise extraction of uranium from seawater. However, the strength of pure DNA materials is currently only 20-30 Pa (Tao Qing, Bian Xiaojun, Zhang Tong, et al. Preparation and application of DNA hydrogels. Chinese Journal of Biotechnology, 2021, 37(9):3162-3178), and it has defects such as small adsorption capacity and poor stability. Therefore, it is necessary to improve and modify it to enhance its performance as an adsorption material. Summary of the Invention

[0004] To overcome the limitations of DNA-based biomaterials as adsorbents, this invention proposes a sodium alginate / functional DNA composite adsorbent material, its preparation method, and its application in the targeted, specific, and highly efficient adsorption of UO in seawater. 2+ Applications in [the field].

[0005] To achieve the above objectives, the present invention adopts the following technical solution:

[0006] A method for preparing a sodium alginate / functional DNA composite adsorbent material, wherein activated functional DNA is combined with sodium alginate to form a composite material, wherein the functional DNA is 80 nt in length and contains -NH2 at the 5' end; the molar mass ratio of functional DNA to sodium alginate is 1:500-1:5000.

[0007] The functional DNA is:

[0008] 39E: 5′-NH2-TCACGTCCATCTCTGCAGTCGGGTAGTTAAACCGA CCTTCAGACATAGTGAGT-3′;

[0009] 39Sd: 5′-ACTCACTATAGGAAGAGATGGACGTGA-3′.

[0010] To elaborate further,

[0011] Step 1: Add the group activator and stabilizer to the sodium alginate solution, let it stand at room temperature for 1-2 hours, and set aside for use;

[0012] Step 2: Add the activated functional DNA solution to the mixture solution described in Step 1 to allow the functional DNA to bind to the alginate matrix, thereby obtaining sodium alginate / functional DNA composite adsorbent material.

[0013] The stabilizers are N-hydroxysuccinimide (NHS) and 4-dimethylaminopyridine (DMAP).

[0014] The activator is 1-ethyl-(3-dimethylaminopropyl)carbodiimide (EDC), dicyclohexylcarbodiimide (DCC), or dicyclohexylcarbodiimide (DIC);

[0015] The molar mass ratio between the stabilizer and the group activator is 1:1 to 1:2.

[0016] Sodium alginate / functional DNA composite adsorbent material was pumped into the cross-linking solution using a uniform-speed injector to form sodium alginate / functional DNA composite gel microspheres; the obtained sodium alginate / functional DNA composite gel microspheres were soaked in the cross-linking solution overnight, and then washed to obtain sodium alginate / functional DNA composite gel microspheres.

[0017] The sodium alginate solution has a viscosity of 50 mPa·s. The sodium alginate is prepared with water to a concentration of 2% and is ready for use.

[0018] The crosslinking solution is calcium chloride, magnesium chloride, or aluminum chloride; the adsorbent material is pumped into the crosslinking solution at a rate of 30 ml / min using a uniform injector.

[0019] A sodium alginate / functional DNA composite adsorbent material, prepared according to the method described above, comprises spheres approximately 2 mm in diameter, with a smooth, rounded surface in a moist state. After freeze-drying, the surface of the spheres exhibits regular honeycomb-like depressions.

[0020] An application of the aforementioned sodium alginate / functional DNA composite adsorbent material, specifically its application in uranium extraction from water.

[0021] The beneficial effects of this invention

[0022] This invention uses a functional DNA-containing composite adsorbent as the target material for uranium extraction from seawater. In this composite material, the functional DNA bio-based material and sodium alginate are covalently bonded, resulting in a stable structure. This exhibits the advantage of having multiple specific binding sites for uranyl ions, and also demonstrates good acid and alkali resistance, is environmentally friendly and pollution-free, enabling the extraction of UO3 from seawater in complex environments such as natural seawater. 2+ Highly efficient and selective adsorption. Specific advantages are as follows:

[0023] (1) The sodium alginate / functional DNA composite adsorbent material of the present invention is composed of UO 2+ It is composed of a functional DNA strand with specific selectivity and sodium alginate, a natural polymer with good biocompatibility. The functional DNA imparts excellent UO2 content to this composition. 2+ Selectivity, suitable for the specific and efficient adsorption of UO in aqueous solutions. 2+ This reduces the probability of non-specific adsorption; at the same time, the excellent water solubility and multiple ion binding sites of sodium alginate effectively improve the adsorption performance and strength of the composite material, and improve the shortcomings of pure DNA material such as low adsorption capacity and poor strength.

[0024] (2) The sodium alginate / functional DNA composite adsorbent material described in this invention has good stability and good adsorption performance under different pH conditions and different temperatures. This enhances the convenience of the sodium alginate / functional DNA composite adsorbent material in practical applications and improves the disadvantage of poor stability of pure DNA adsorbent material in practical use.

[0025] (3) The functional DNA fixation method in this invention is chemical bonding, which is structurally stable, does not fall off, and can be recycled.

[0026] (4) Compared with other existing uranium adsorbent preparation methods, the preparation of sodium alginate / functional DNA composite adsorbent material by this invention is simple, the reaction conditions are mild, the process is safe, and no specific reaction device is required.

[0027] (5) Compared with other existing uranium adsorbent materials, the sodium alginate / functional DNA composite adsorbent material prepared by this invention has stronger resistance to V ions and a selectivity for uranyl ions of 35.67 times.

[0028] (6) Currently, the widely used uranium adsorbents are powder-based, which are difficult to recycle and reuse, and the residual adsorbents can cause secondary pollution to water bodies. The sodium alginate / functional DNA composite adsorbent material prepared in this invention is easy to recover, can be directly retrieved, and leaves no residual pollution. Attached Figure Description

[0029] Figure 1 The images show a morphological comparison under a fluorescence microscope of sodium alginate / functional DNA composite gel spheres obtained in Example 1 of this invention and blank sodium alginate gel spheres without functional DNA, after staining with GelRed dye. In the images, A shows the fluorescence comparison between the DNA-containing gel sphere (left) and the DNA-free gel sphere (right); B shows the fluorescence comparison between the DNA-containing gel sphere (left) and the DNA-free gel sphere (right).

[0030] Figure 2 Fourier transform infrared (FTIR) absorption spectra of sodium alginate / functional DNA composite gel microspheres obtained in Example 1 of this invention and blank sodium alginate gel microspheres without functional DNA.

[0031] Figure 3 The images shown are electron microscope (SEM) images of sodium alginate / functional DNA composite gel microspheres obtained in Example 1 of this invention; where A is the overall external morphology of the freeze-dried gel microspheres (including SEM of the external morphology of the DNA freeze-dried gel microspheres), and B is the internal morphology of the freeze-dried microspheres (including SEM of the internal structure of the DNA freeze-dried gel microspheres).

[0032] Figure 4 The sodium alginate / functional DNA composite gel microspheres obtained in step 6 of Example 1 of this invention were subjected to a UO2 concentration of 20 mg / L in 10 mL of water with initial pH values ​​of 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, and 10.0. 2+ Graphs showing adsorption capacity and removal rate data in an adsorption experiment conducted in aqueous solution;

[0033] Figure 5 The sodium alginate / functional DNA composite gel beads obtained in step 6 of Example 1 of this invention were prepared in 10 mL of UO2 with an initial pH of 4.0 and initial concentrations of 5 mg / L, 10 mg / L, 15 mg / L, and 20 mg / L. 2+ Graphs showing adsorption capacity and removal rate data in an adsorption experiment conducted in aqueous solution;

[0034] Figure 6 This is a comparison of the uranium-vanadium selectivity exhibited by the sodium alginate / functional DNA composite gel microspheres obtained in step 6 of Example 1 of the present invention in simulated seawater. Detailed Implementation

[0035] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.

[0036] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the materials, reagents, methods, and instruments used are all conventional materials, reagents, methods, and instruments in the art, and can be obtained commercially by those skilled in the art.

[0037] The terms “comprising,” “including,” “having,” “containing,” or any other variations thereof, as used in the following embodiments, are intended to cover a non-exclusive inclusion. For example, a composition, step, method, article, or apparatus that includes the listed elements is not necessarily limited to those elements, but may include other elements not expressly listed or elements inherent to such a composition, step, method, article, or apparatus.

[0038] When a quantity, concentration, or other value or parameter is expressed as a range, a preferred range, or a range defined by a series of upper and lower preferred values, this should be understood as specifically disclosing all ranges formed by any pair of any upper or preferred value with any lower or preferred value, regardless of whether the range is disclosed individually. For example, when the range “1 to 5” is disclosed, the described range should be interpreted as including ranges “1 to 4”, “1 to 3”, “1 to 2”, “1 to 2 and 4 to 5”, “1 to 3 and 5”, etc. When numerical ranges are described herein, unless otherwise stated, the range is intended to include its endpoints and all integers and fractions within that range. In this specification and claims, range definitions may be combined and / or interchanged, unless otherwise stated, these ranges include all subranges contained therein.

[0039] The indefinite articles “a” and “an” preceding an element or component of this invention do not impose any limitation on the quantity (i.e., number of times) of the element or component. Therefore, “an” or “a” should be interpreted as including one or at least one, and the singular form of an element or component also includes the plural form, unless the quantity clearly refers only to the singular form.

[0040] The preparation method of the sodium alginate / functional DNA composite adsorbent of the present invention will have a high adsorption capacity for UO 2+ A functional DNA strand with specific selectivity is combined with sodium alginate, a natural polymer with good biocompatibility, to form a UO (unique organic compound). 2+ Using sodium alginate as a carrier and a one-step blending method, sodium alginate / functional DNA composite adsorbents were synthesized for use in the removal of UO2 from seawater. 2+ Highly efficient and specific adsorption.

[0041] The stabilizers and group activators used in the following examples were purchased from Shanghai Maclean Biotechnology Co., Ltd.

[0042] Example 1

[0043] A method for preparing sodium alginate / functional DNA composite gel microspheres 1 (DNA:sodium alginate = 1:1000 (molar mass ratio) includes the following steps:

[0044] Step 1: Dissolve 50 OD of DNA strand in 200 μL of deionized water in a 2 ml centrifuge tube. After mixing thoroughly, incubate at room temperature for 10 minutes, then incubate in a 94°C water bath for 5 minutes. After removal, slowly cool to room temperature to obtain the activated UO2. 2+ A functional DNA strand with specific selectivity;

[0045] The DNA strand sequence is

[0046] 39E: 5′-NH2TCACGTCCATCTCTGCAGTCGGGTAGTTAAACCGA CCTTCAGACATAGTGAGT-3′;

[0047] 39Sd:5′-ACTCACTATAGGAAGAGATGGACGTGA-3′;

[0048] Step 2: Dissolve 2 mg of sodium alginate with a viscosity of 50 mPa·s in 1 ml of deionized water in a 2 ml centrifuge tube, shake and stir at room temperature for 3 hours to completely dissolve and mix the sodium alginate, and obtain a sodium alginate solution with a mass concentration of 2%.

[0049] Step 3: Add 0.48g of EDC and 1.32g of NHS to the sodium alginate solution obtained in Step 2, let stand at room temperature for 1 hour, and activate the -COO- using EDC. - And form a mixture therewith, using NHS to stabilize the mixture formed by alginic acid and EDC;

[0050] Step 4: Add the activated DNA solution from Step 1 (after cooling) to the mixture solution from Step 3, so that the -NH2 on the functional DNA reacts with the activated -COO on the alginate. - Combined, -CO-NH- bonds are formed to obtain sodium alginate / functional DNA composite adsorbent material;

[0051] Step 5: Aspirate the sodium alginate / functional DNA composite adsorbent material into a 5ml syringe, and use a constant-speed injector to pump the adsorbent material in the syringe into a 2% calcium chloride crosslinking solution. The pumping speed of the constant-speed injector is 30ml / min, forming sodium alginate / functional DNA composite gel beads.

[0052] Step 6: After soaking the collected sodium alginate / functional DNA composite gel beads from Step 5 in the cross-linking solution for 24 hours, repeatedly wash with ultrapure water to remove uncross-linked Ca. 2+ Ions were collected, and finally the collected spheres were collected to obtain the final product sodium alginate / functional DNA composite gel spheres 1.

[0053] The sodium alginate blank microspheres were prepared by dissolving 10 mg of sodium alginate in 5 mL of deionized water, and then pumping the resulting gel into a crosslinking agent with a mass concentration of 2% calcium chloride at a constant speed of 30 mL / min using a uniform injector, which was then cured for 24 hours.

[0054] Comparison images of sodium alginate / functional DNA composite gel beads 1 and blank beads containing only sodium alginate obtained above, observed under a fluorescence microscope after staining with GelRed (see above). Figure 1-3 ).

[0055] Depend on Figure 1 As can be seen, the blank spheres containing only sodium alginate show almost no fluorescence, while the sodium alginate / functional DNA composite gel spheres show bright fluorescence and are uniform, which intuitively shows that the functional DNA is uniformly dispersed in the sodium alginate gel.

[0056] Depend on Figure 2 The FTIR characterization data comparison shows that the sodium alginate / functional DNA composite gel spheres exhibit characteristic peaks at 1142 and 1220, attributed to PO and P=O, respectively. The blank sodium alginate spheres do not contain these characteristic peaks, indicating that the functional DNA was successfully introduced into the sodium alginate gel spheres. Furthermore, the absorption peak at 3435 in the sodium alginate / functional DNA composite gel spheres shows a blue shift compared to 3371 in the blank sodium alginate spheres, and is relatively broader, indicating that this is a coincidence absorption peak of -OH and the NH in the formed -CO-NH-. The absorption peak at 1632 is a coincidence vibration absorption peak of C=O, C=C, and C=N in -CO-NH-. The absorption peak at 1405 is a vibration absorption peak of CN in -CO-NH- and the nitrogen-containing ring vibration of the bases in the functional DNA. These analyses confirm that the functional DNA is indeed bound to the sodium alginate gel spheres via -CO-NH- bonds.

[0057] Depend on Figure 3 Electron microscopy (SEM) images show that the globules retained their complete spherical shape and smooth surface after freeze-drying. The interior exhibits a layered, porous structure, which is also beneficial for UO 2+ Adsorption on gel microspheres.

[0058] Example 2

[0059] A method for preparing sodium alginate / functional DNA composite gel microspheres 2 (DNA: sodium alginate = 1:5000) includes the following steps:

[0060] Step 1: Dissolve 10D of DNA strand in 200ul of deionized water in a 2ml centrifuge tube. After mixing thoroughly, incubate at room temperature for 10 minutes, then incubate in a 94℃ water bath for 5 minutes. After removal, slowly cool to room temperature to obtain the activated UO2. 2+ A functional DNA strand with specific selectivity;

[0061] Step 2: Dissolve 2 mg of sodium alginate with a viscosity of 50 mPa·s in 1 ml of deionized water in a 2 ml centrifuge tube, shake and stir at room temperature for 4 hours to completely dissolve and mix the sodium alginate, and obtain a sodium alginate solution with a mass concentration of 2%.

[0062] Step 3: Add 0.48g of EDC and 1.32g of NHS to the sodium alginate solution obtained in Step 2, let stand at room temperature for 1 hour, and activate the -COO- using EDC. - And form a mixture therewith, using NHS to stabilize the mixture formed by alginic acid and EDC;

[0063] Step 4: Add the activated DNA solution from Step 1 (after cooling) to the mixture solution from Step 3, so that the -NH2 on the functional DNA reacts with the activated -COO on the alginate. - Combined, -CO-NH- bonds are formed to obtain sodium alginate / functional DNA composite adsorbent material;

[0064] Step 5: Aspirate the sodium alginate / functional DNA composite adsorbent material into a 5ml syringe, and use a constant-speed injector to pump the adsorbent material in the syringe into a 2% calcium chloride crosslinking solution. The pumping speed of the constant-speed injector is 30ml / min, forming sodium alginate / functional DNA composite gel beads.

[0065] Step 6: After soaking the collected sodium alginate / functional DNA composite gel beads from Step 5 in the cross-linking solution for 24 hours, repeatedly wash with ultrapure water to remove uncross-linked Ca. 2+ Ions were collected, and finally the collected spheres were collected to obtain the final product sodium alginate / functional DNA composite gel spheres 2.

[0066] Example 3

[0067] A method for preparing sodium alginate / functional DNA composite gel microspheres 3 (DNA: sodium alginate = 1:500) includes the following steps:

[0068] Step 1: Dissolve 50 OD of DNA strand in 200 μL of deionized water in a 2 ml centrifuge tube. After mixing thoroughly, incubate at room temperature for 10 minutes, then incubate in a 94°C water bath for 5 minutes. After removal, slowly cool to room temperature to obtain the activated UO2. 2+ A functional DNA strand with specific selectivity;

[0069] Step 2: Dissolve 1 mg of sodium alginate with a viscosity of 50 mPa·s in 1 ml of deionized water in a 2 ml centrifuge tube, and shake and stir at room temperature for 3 to 4 hours to completely dissolve and mix the sodium alginate, so as to obtain a sodium alginate solution with a mass concentration of 2%.

[0070] Step 3: Add 0.48g of EDC and 1.32g of NHS to the sodium alginate solution obtained in Step 2, let stand at room temperature for 1 hour, and activate the -COO- using EDC. - And form a mixture therewith, using NHS to stabilize the mixture formed by alginic acid and EDC;

[0071] Step 4: Add the activated DNA solution from Step 1 (after cooling) to the mixture solution from Step 3, so that the -NH2 on the functional DNA reacts with the activated -COO on the alginate. - Combined, -CO-NH- bonds are formed to obtain sodium alginate / functional DNA composite adsorbent material;

[0072] Step 5: Aspirate the sodium alginate / functional DNA composite adsorbent material into a 5ml syringe, and use a constant-speed injector to pump the adsorbent material in the syringe into a 2% calcium chloride crosslinking solution. The pumping speed of the constant-speed injector is 30ml / min, forming sodium alginate / functional DNA composite gel beads.

[0073] Step 6: After soaking the collected sodium alginate / functional DNA composite gel beads from Step 5 in the cross-linking solution for 24 hours, repeatedly wash with ultrapure water to remove uncross-linked Ca. 2+ Ions were collected, and finally the collected spheres were collected to obtain the final product sodium alginate / functional DNA composite gel spheres 3.

[0074] Example 4

[0075] A method for preparing sodium alginate / functional DNA composite gel microspheres 4 (DNA: sodium alginate = 1:750) includes the following steps:

[0076] Step 1: Dissolve 50 OD of DNA strand in 200 μL of deionized water in a 2 ml centrifuge tube. After mixing thoroughly, incubate at room temperature for 10 minutes, then incubate in a 94°C water bath for 5 minutes. After removal, slowly cool to room temperature to obtain the activated UO2. 2+ A functional DNA strand with specific selectivity;

[0077] Step 2: Dissolve 1.5 mg of sodium alginate with a viscosity of 50 mPa·s in 1 ml of deionized water in a 2 ml centrifuge tube, and shake and stir at room temperature for 3 to 4 hours to completely dissolve and mix the sodium alginate, to obtain a sodium alginate solution with a mass concentration of 2%.

[0078] Step 3: Add 0.48g of EDC and 1.32g of NHS to the sodium alginate solution obtained in Step 2, let stand at room temperature for 1 hour, and activate the -COO- using EDC. - And form a mixture therewith, using NHS to stabilize the mixture formed by alginic acid and EDC;

[0079] Step 4: Add the activated DNA solution from Step 1 (after cooling) to the mixture solution from Step 3, so that the -NH2 on the functional DNA reacts with the activated -COO on the alginate. - Combined, -CO-NH- bonds are formed to obtain sodium alginate / functional DNA composite adsorbent material;

[0080] Step 5: Aspirate the sodium alginate / functional DNA composite adsorbent material into a 5ml syringe, and use a constant-speed injector to pump the adsorbent material in the syringe into a 2% calcium chloride crosslinking solution. The pumping speed of the constant-speed injector is 30ml / min, forming sodium alginate / functional DNA composite gel beads.

[0081] Step 6: After soaking the collected sodium alginate / functional DNA composite gel beads from Step 5 in the cross-linking solution for 24 hours, repeatedly wash with ultrapure water to remove uncross-linked Ca. 2+ Ions were collected, and finally the collected spheres were collected to obtain the final product sodium alginate / functional DNA composite gel spheres 4.

[0082] Example 5

[0083] A method for preparing sodium alginate / functional DNA composite gel microspheres 5 (EDC:NHS = 1:2, DNA:sodium alginate = 1:1000) includes the following steps:

[0084] Step 1: Dissolve 50 OD of DNA strand in 200 μL of deionized water in a 2 ml centrifuge tube. After mixing thoroughly, incubate at room temperature for 10 minutes, then incubate in a 94°C water bath for 5 minutes. After removal, slowly cool to room temperature to obtain the activated UO2. 2+ A functional DNA strand with specific selectivity;

[0085] Step 2: Dissolve 2 mg of sodium alginate with a viscosity of 50 mPa·s in 1 ml of deionized water in a 2 ml centrifuge tube, and shake and stir at room temperature for 3 to 4 hours to completely dissolve and mix the sodium alginate, so as to obtain a sodium alginate solution with a mass concentration of 2%.

[0086] Step 3: Add 0.48g of EDC and 0.66g of NHS to the sodium alginate solution obtained in Step 2, let stand at room temperature for 1 hour, and activate the -COO- using EDC. - And form a mixture therewith, using NHS to stabilize the mixture formed by alginic acid and EDC;

[0087] Step 4: Add the activated DNA solution from Step 1 (after cooling) to the mixture solution from Step 3, so that the -NH2 on the functional DNA reacts with the activated -COO on the alginate. - Combined, -CO-NH- bonds are formed to obtain sodium alginate / functional DNA composite adsorbent material;

[0088] Step 5: Aspirate the sodium alginate / functional DNA composite adsorbent material into a 5ml syringe, and use a constant-speed injector to pump the adsorbent material in the syringe into a 2% calcium chloride crosslinking solution. The pumping speed of the constant-speed injector is 30ml / min, forming sodium alginate / functional DNA composite gel beads.

[0089] Step 6: After soaking the collected sodium alginate / functional DNA composite gel beads from Step 5 in the cross-linking solution for 24 hours, repeatedly wash with ultrapure water to remove uncross-linked Ca. 2+ Ions were collected, and finally the collected spheres were collected to obtain the final product, sodium alginate / functional DNA composite gel spheres 5.

[0090] Example 6

[0091] A method for preparing sodium alginate / functional DNA composite gel microspheres 6 (EDC:NHS = 2:1, DNA:sodium alginate = 1:1000) includes the following steps:

[0092] Step 1: Dissolve 50 OD of DNA strand in 200 μL of deionized water in a 2 ml centrifuge tube. After mixing thoroughly, incubate at room temperature for 10 minutes, then incubate in a 94°C water bath for 5 minutes. After removal, slowly cool to room temperature to obtain the activated UO2. 2+ A functional DNA strand with specific selectivity;

[0093] Step 2: Dissolve 2 mg of sodium alginate with a viscosity of 50 mPa·s in 1 ml of deionized water in a 2 ml centrifuge tube, and shake and stir at room temperature for 3 to 4 hours to completely dissolve and mix the sodium alginate, so as to obtain a sodium alginate solution with a mass concentration of 2%.

[0094] Step 3: Add 1.92g of EDC and 1.32g of NHS to the sodium alginate solution obtained in Step 2, let stand at room temperature for 1 hour, and activate the -COO- using EDC. - And form a mixture therewith, using NHS to stabilize the mixture formed by alginic acid and EDC;

[0095] Step 4: Add the activated DNA solution from Step 1 (after cooling) to the mixture solution from Step 3, so that the -NH2 on the functional DNA reacts with the activated -COO on the alginate. - Combined, -CO-NH- bonds are formed to obtain sodium alginate / functional DNA composite adsorbent material;

[0096] Step 5: Aspirate the sodium alginate / functional DNA composite adsorbent material into a 5ml syringe, and use a constant-speed injector to pump the adsorbent material in the syringe into a 2% calcium chloride crosslinking solution. The pumping speed of the constant-speed injector is 30ml / min, forming sodium alginate / functional DNA composite gel beads.

[0097] Step 6: After soaking the collected sodium alginate / functional DNA composite gel beads from Step 5 in the cross-linking solution for 24 hours, repeatedly wash with ultrapure water to remove uncross-linked Ca. 2+ Ions were collected, and finally the collected spheres were collected to obtain the final product sodium alginate / functional DNA composite gel spheres 6.

[0098] Adsorption experiment:

[0099] Using a certain concentration of UO 2+ The aqueous solution was used for adsorption experiments with the sodium alginate / functional DNA composite gel microspheres prepared in Example 1. The specific steps are as follows:

[0100] 1) The sodium alginate / functional DNA composite gel microspheres prepared in Example 1 were added to 10 mL of UO4 solution with a concentration of 20 mg / L and initial pH values ​​of 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, and 10.0. 2+ In an aqueous solution, the solution was subjected to adsorption in a shaker at a rotation speed of 24 rpm / min for 8 hours. After standing for a short time, the adsorbed solution was filtered through a 0.22 μm aqueous filter membrane, and the remaining uranium concentration in the solution was analyzed by inductively coupled plasma mass spectrometry (ICP-MS) (see [link to relevant documentation]). Figure 4 ), and calculate UO according to the following formula. 2+ Removal rate (η%) and adsorption capacity (Qe):

[0101]

[0102]

[0103] Where: Qe represents the sodium alginate / functional DNA composite gel microspheres paired with UO 2+ The adsorption content (η%) of sodium alginate / functional DNA composite gel microspheres on UO 2+ Removal rate; C0 is UO 2+ The initial concentration is expressed in mg / L; Ct represents UO. 2+ The concentration after adsorption is complete is expressed in mg / L; V is the volume of the adsorption solution in mL; and m is the mass of the sodium alginate / functional DNA composite gel microspheres used.

[0104] Depend on Figure 4 It is evident that within the pH range of 2-10, both adsorption capacity and removal rate reach their maximum at pH 4, indicating that this material is more suitable for functioning in acidic environments. However, at pH 7-8, which is close to the actual pH level of seawater, the adsorption capacity and removal rate of the adsorbent do not decrease significantly, suggesting that it also has some value in practical seawater applications.

[0105] 2) The sodium alginate / functional DNA composite gel microspheres prepared in Example 1 were added to 10 mL of UO4 solution with an initial pH of 4.0 and initial concentrations of 5 mg / L, 10 mg / L, 15 mg / L, and 20 mg / L. 2+ In an aqueous solution, the solution was subjected to adsorption in a shaker at a rotation speed of 24 rpm / min for 8 hours. After standing for a short time, the adsorbed solution was filtered through a 0.22 μm aqueous filter membrane, and the remaining uranium concentration in the solution was analyzed by inductively coupled plasma mass spectrometry (ICP-MS) (see [link to relevant documentation]). Figure 5 ). And calculate UO according to the following formulas (1) and (2). 2+ Removal rate (η%) and adsorption capacity (Qe).

[0106] Depend on Figure 5 It is evident that the adsorption capacity of this adsorbent gradually increases under different mother liquor concentrations. However, the removal rate is highest when the mother liquor concentration is 5, indicating that it is more effective in low-concentration uranium solutions. This aligns with actual seawater applications and further demonstrates its potential application value in real seawater.

[0107] Selective experiment

[0108] The sodium alginate / functional DNA composite gel microspheres prepared in Example 1 were added to 20 mL of simulated seawater solution containing different ions, and the solution was subjected to adsorption for 8 days at a shaking speed of 24 rpm / min. After standing for a short time, the adsorbed solution was filtered through a 0.22 μm aqueous filter membrane, and the remaining uranium concentration in the solution was analyzed by inductively coupled plasma mass spectrometry (ICP-MS) (see [link to relevant documentation]). Figure 6And calculate UO according to formula (1). 2+ Adsorption capacity (Qe).

[0109] Depend on Figure 6 It is evident that when this adsorbent is used in simulated seawater, it exhibits the highest adsorption capacity for uranyl ions under the interference of other ions in valence modulation. However, due to the low ion concentration in the simulated seawater, its overall adsorption capacity is relatively low. Regarding the selectivity of other seawater uranium extraction materials for uranyl and vanadium ions, the sodium alginate / functional DNA composite gel microspheres prepared in this invention show a selectivity of 35.67 for uranyl ions compared to vanadium ions. This further demonstrates its potential application value in real seawater.

[0110] The embodiments of the present invention have been described above in conjunction with the accompanying drawings. However, the present invention is not limited to the above embodiments. Any changes, modifications, substitutions, or simplifications made under the spirit and principle of the technical solution of the present invention are included within the protection scope of the present invention.

Claims

1. A method for preparing a sodium alginate / functional DNA composite gel microsphere adsorbent material, characterized in that: Step 1: Add the group activator and stabilizer to the sodium alginate solution, let it stand at room temperature for 1-2 hours, and set aside for use; Step 2: Add the activated functional DNA solution to the mixture solution prepared in Step 1 so that the functional DNA binds to the alginate matrix to obtain sodium alginate / functional DNA composite adsorbent material; The functional DNA is 80 nt in length and contains -NH2 at the 5' end; the molar ratio of functional DNA to sodium alginate is 1:500-1:5000. The functional DNA is: 39 E: 5′-NH2-TCACGTCCATCTCTGCAGTCGGGTAGTTAAACCGACCTTCAGACATAGTGAGT -3′; 39 Sd: 5′- ACTCACTATAGGAAGAGATGGACGTGA -3′; The stabilizers are N-hydroxysuccinimide (NHS) and 4-dimethylaminopyridine (DMAP). The activator is 1-ethyl-(3-dimethylaminopropyl)carbodiimide (EDC), dicyclohexylcarbodiimide (DCC), or dicyclohexylcarbodiimide (DIC). The molar mass ratio between the stabilizer and the group activator is 1:1 to 1:

2. Step 3: The sodium alginate / functional DNA composite adsorbent material was pumped into the cross-linking solution using a uniform speed injector and soaked overnight, and then washed to obtain sodium alginate / functional DNA composite gel beads.

2. The method for preparing the sodium alginate / functional DNA composite gel microsphere adsorbent material according to claim 1, characterized in that: The sodium alginate solution has a viscosity of 50 mPa·s. The sodium alginate is prepared with water to a concentration of 2% and is ready for use.

3. The method for preparing the sodium alginate / functional DNA composite gel microsphere adsorption material according to claim 1, characterized in that: The crosslinking solution is calcium chloride; the adsorbent material is pumped into the crosslinking solution at a rate of 30 ml / min using a uniform injection device.

4. A sodium alginate / functional DNA composite gel microsphere adsorbent material prepared by the preparation method of claim 1.

5. The application of the sodium alginate / functional DNA composite gel microsphere adsorption material according to claim 4, characterized in that: Application of the sodium alginate / functional DNA composite gel microsphere adsorption material in uranium extraction from water.

Images