Use of Lactobacillus rhamnosus nucleotides in the preparation of anti-lipogenesis compositions
By inhibiting lipogenesis through specific oligodeoxynucleotide fragments of Lactobacillus rhamnosus GM-020, the gap in probiotic regulation of lipogenesis has been filled, achieving a safe and effective anti-obesity effect.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- GENMONT BIOTECH
- Filing Date
- 2024-04-12
- Publication Date
- 2026-05-26
AI Technical Summary
In the existing technology, there is a lack of clear evidence on the regulatory role of probiotic CpG-ODNs in lipogenesis, and there is a lack of effective and safe prevention and improvement strategies for obesity caused by high-fat diets.
Specific oligodeoxynucleotide fragments from Lactobacillus rhamnosus GM-020, such as TTAGGG, TTTCGTTT, and TCAAGCTTGA, were isolated and validated to inhibit adipogenesis by reducing the expression of the adipogenesis gene FAS in adipocytes.
It significantly inhibits fat production, providing a safe and effective strategy for preventing and improving obesity caused by a high-fat diet, with few side effects.
Smart Images

Figure BDA0004789038730000061 
Figure HDA0004789038740000011 
Figure HDA0004789038740000021
Abstract
Description
Technical Field
[0001] This invention relates to nucleotides from Lactobacillus rhamnosus (also known as Lacticaseibacillus rhamnosus) for anti-lipogenesis, particularly by inhibiting the formation of oil droplets in adipocytes. Background Technology
[0002] Recent studies have confirmed that the efficacy of Lactobacillus rhamnosus (L. rhamnosus) is related to the regulation of lipogenesis. Consuming fermented milk containing L. rhamnosus GG can enhance the anti-obesity benefits of calcium ions, inhibit adipose tissue formation, and increase the efficiency of fat oxidation in muscles. L. rhamnosus 86 can also inhibit adipocyte differentiation and fat production, and improve obesity caused by a high-fat diet. However, the regulatory mechanisms by which L. rhamnosus participates in lipid-lowering and anti-obesity functions still require further clarification. Excessive fat accumulation is caused by the dysregulation of two mechanisms, including (1) excessive lipogenesis; and (2) impaired fatty acid oxidation and lipogenesis. Among them, reports indicate that genes such as FAS (gene name of Fatty acid synthase), ACC (gene name of acetyl coenzyme A carboxylase), SREBP1 (gene name of sterolregulatory element-binding transcription factor), and SCD1 (gene name of stearoylcoenzyme A desaturase 1) are lipogenesis-related genes, and the active expression of their genes and proteins will promote lipogenesis.
[0003] Certain oligodeoxynucleotide (ODN) fragments in the full genome sequences of bacteria possess immunomodulatory physiological functions. For example, Bouladux et al. found that the copy numbers of TTAGGG and TCAGCTTGA in *Lactobacillus paracasei* are higher than those in pathogenic bacteria or *Escherichia coli*, and ODNs synthesized using these sequences can inhibit the activation of dendritic cells in the intestinal lamina propria. The TTTCGTTT sequence exhibited by *L. rhamnosus* GG has an immune stimulation function, promoting B cell proliferation and Th1 immune responses. However, in a mouse model of arthritis, the short ODN fragment with the sequence CCTCAAGCTTGAGGGG can inhibit the inflammatory response and significantly improve the severe symptoms caused by arthritis. However, there are no reports indicating whether probiotic CpG-ODNs participate in the regulation of adipogenesis.
[0004] Therefore, identifying probiotic oligodeoxynucleotide fragments with lipogenesis-regulating effects is the problem that this invention aims to solve. Summary of the Invention
[0005] In view of this, after years of research, the inventors of this case have finally successfully isolated a probiotic oligodeoxynucleotide fragment that has the effect of inhibiting fat production. This probiotic is Lactobacillus rhamnosus, and its oligodeoxynucleotide fragment has the effect of inhibiting fat production, providing a novel and safe prevention and improvement strategy for improving obesity caused by a high-fat diet.
[0006] To achieve the above objectives, the present invention provides a nucleotide with anti-lipogenesis effect, the nucleotide sequence of which is SEQ ID NO:1.
[0007] The present invention also provides a nucleotide with anti-lipogenesis effect, the nucleotide sequence of which is SEQ ID NO:5.
[0008] The present invention further provides a composition having anti-lipogenesis efficacy, the composition comprising Lactobacillus rhamnosus GM-020 or a nucleotide fragment thereof as an active ingredient; wherein the Lactobacillus rhamnosus GM-020 has a registration number of BCRC910236 or CCTCC M203098, and the sequence of the nucleotide fragment comprises SEQ ID NO.1 or SEQ ID NO.5.
[0009] In one embodiment of the present invention, the composition is a pharmaceutical composition, a nutritional supplement, or a health food.
[0010] In one embodiment of the invention, the composition may further comprise a pharmaceutically acceptable carrier.
[0011] In one embodiment of the present invention, the composition is a solution, suspension, emulsion, powder, lozenge, pill, syrup, lozenge, tablet, chewing gum, syrup, or capsule.
[0012] In one embodiment of the present invention, the composition may further comprise an edible material, which includes water, liquid dairy products, milk, concentrated milk, yogurt, fermented milk, frozen yogurt, lactobacillus fermented beverages, milk powder, ice cream, cheese, curd, soy milk, fermented soy milk, vegetable and fruit juices, fruit juices, sports drinks, desserts, jellies, candies, baby food, health foods, animal feed, traditional Chinese medicine, or dietary supplements.
[0013] The present invention further provides the use of a nucleotide fragment of Lactobacillus rhamnosus GM-020 for preparing an anti-lipogenesis composition, wherein the composition comprises Lactobacillus rhamnosus GM-020 or a nucleotide fragment thereof as an active ingredient; the Lactobacillus rhamnosus GM-020 has a registration number of BCRC 910236 or CCTCCM203098, and the sequence of the nucleotide fragment comprises SEQ ID NO.1 or SEQ ID NO.5.
[0014] In one embodiment of the present invention, the anti-lipogenesis is to inhibit the formation of oil droplets in adipocytes.
[0015] In one embodiment of the present invention, the anti-lipogenesis is achieved by reducing the expression of the adipogenesis gene (FAS) in adipocytes, thereby inhibiting lipogenesis.
[0016] This patent evaluates the ability of specific oligodeoxynucleotide fragments from *Lactobacillus rhamnosus* GM-020 to inhibit lipogenesis, primarily selecting IM1:TTAGGG, IM2:TTTCGTTT, and IM3:TCAAGCTTGA as analytical targets. Further experimental testing was conducted on five ODN fragments with IM3 as the core sequence to assess their efficacy in inhibiting lipogenesis. The results showed that GM-020 possesses two specific oligodeoxynucleotide fragments that significantly inhibit lipogenesis. Because the composition provided by this invention uses probiotics or nucleotides as active ingredients, it has the advantage of low side effects, offering a novel and safe strategy for the prevention and improvement of obesity caused by a high-fat diet. Attached Figure Description
[0017] Figure 1 To provide a complete genome morphology, functional analysis, and species evolution analysis of GM-020.
[0018] Figure 2 IM3-1 and IM3-5 have the effect of inhibiting the formation of fatty oil droplets.
[0019] Figure 3 IM3-2, IM3-3, and IM3-4 do not have the effect of inhibiting the formation of fatty oil droplets.
[0020] Figure 4 IM3-1 and IM3-5 have the effect of inhibiting the expression of FAS gene. Detailed Implementation
[0021] All technical and scientific terms used in this specification, unless otherwise defined, shall have the meaning commonly understood by one of ordinary skill in the art.
[0022] The singular terms “a,” “an,” and “the” used in this specification and the claims, unless otherwise stated, may refer to more than one object.
[0023] The words "or," "and," and "and" used in this specification, unless otherwise stated, refer to "or / and." Furthermore, the terms "comprising" and "including" are not restrictive open-ended conjunctions. The foregoing paragraphs are for systematic reference only and should not be construed as limiting the subject of the invention.
[0024] The compositions provided by this invention can be prepared using techniques well known to those skilled in the art, by combining the active ingredient or composition provided herein with at least one pharmaceutically acceptable vehicle to form a dosage form suitable for the compositions of this invention. Such dosage forms include, but are not limited to, solutions, emulsions, suspensions, powders, lozenges, tablets, chewing gums, capsules, and other similar or applicable dosage forms.
[0025] The term "pharmaceutically acceptable" means that a substance or composition must be compatible with the other components of its pharmaceutical formulation and must not exacerbate the patient's symptoms.
[0026] The term "pharmaceutically acceptable carrier" includes one or more components selected from the following types: solvents, emulsifiers, suspending agents, disintegrants, binders, excipients, stabilizers, chelating agents, diluents, gelling agents, preservatives, lubricants, surfactants, and other similar or suitable carriers for this invention.
[0027] In the aforementioned composition, one or more commonly used dissolving agents, buffers, colorants, flavoring agents, etc., in the field of pharmaceutical preparations may also be added as needed.
[0028] The term "medical composition" refers to a solid or liquid composition that is in a form, concentration and purity suitable for administration to a patient and, after administration, can induce a desired physiological change; the medical composition is sterile and / or non-pyrogenic.
[0029] Unless otherwise specified, all materials used in this invention are commercially available and readily available. The *Lactobacillus rhamnosus* strain GM-020 used in the embodiments of this invention is deposited at the Bioresource Conservation and Research Center of the Food Industry Research and Development Institute in Taiwan, with accession number BCRC 910236, and at the China Center for Type Culture Collection (CCTCC), with accession number CCTCM203098.
[0030] Example 1: Whole genome sequencing of GM-020
[0031] Probiotic strain culture and sequencing: 0.1 ml to 10 ml of MRS broth was used to activate the second-generation strain from 1 ml of overnight cultured lactic acid bacteria. The growth curve was observed. Once the strain reached (OD600 0.8), 3 ml of the bacterial solution was washed twice with filtered sterile water (13000 rpm, 1 min). The bacterial cells were then retained for Genomic DNA extraction. Using QIAGEN... DNA was extracted using a Blood & Tissue Kit (QIAGEN; Cat. No. 69504). After confirming the quality of the genomic DNA using a Qubitfluorometer, nanophotometer, and agarose gel, it was then subjected to whole-genome DNA sequencing by Kangjian Company. The obtained DNA was simultaneously sequenced using an Illumina Hiseq 2000 next-generation sequencer and an Oxford Nanopore GridION third-generation sequencer.
[0032] Preprocessing of assembled sequences: Before sequence assembly, FASTX-Toolkit and MinIONQC tools were used to filter out low-quality noise from the ordered data. The Quality Value was 20, which means the per-based error rate was 1 / 100.
[0033] Sequencing data assembly and correction: Nucleic acid sequences from filtered, high-quality next-generation sequencing short fragments were combined with third-generation sequencing data using the published tool MaSuRCA v3.3.1 in a hybrid assembly manner to form longer, continuous sequences. Bridging sequences were constructed using sequence alignment with third-generation sequencing data to confirm the sequential relationships between contigs. Furthermore, Pilon was used for variant detection and genome assembly improvement. Based on Nanopore long reads as reference sequences, after alignment with short reads, sequence detection and correction were performed for single-base differences and small gaps in each read, reducing false positives.
[0034] Species evolution analysis, sequenced gene annotation, and functional pathway analysis: Multiple sequence alignment of the collected subtype bacterial sequences with the sequence to be identified after sequencing and assembly provides crucial evidence for molecular evolutionary analysis, evolutionary analysis, and etymology tracing, enabling rapid and accurate bacterial species identification using next-generation sequencing platforms. The genome is annotated using multiple tools. Prokka predicts genes across the entire prokaryotic genome, including protein-coding and non-coding regions. Plasflow is used for plasmid identification. PHASTER is used to screen for phage regions in the genome. Bagel4 and CARD predict genes related to bacteriocin production and potential resistance regions, respectively. Protein-coding regions are segments that may translate into functional proteins; functional classification is performed using eggNOG, combined with the Cluster of Orthologous Genes (COG) from protein databases for annotation and classification.
[0035] Analysis of the complete genome, genetic information, and phylogenetic tree data confirmed that GM-020 is *Lactobacillus rhamnosus*, with a gene size of 3,037,161 bp. Figure 1 To provide a complete genome morphology, functional analysis, and species evolution analysis of GM-020.
[0036] Further analysis revealed the frequency of IM1:TTAGGG, IM2:TTTCGTTT, and IM3:TCAAGCTTGA in the GM-020 gene, and compared it with that of three previously published Lactobacillus rhamnosus strains (4B15, DSM14870, and BPL5).
[0037] The results are summarized in Table 1. The frequency of GM-020 in IM1, IM2 and IM3 is higher than that of the other three Lactobacillus rhamnosus strains (4B15, DSM14870 and BPL5), which may be the reason why GM-020 has special functions.
[0038] Table 1. Frequency of IM1, IM2, and IM3 sequences expressed in the whole genome of different strains of *Lactobacillus rhamnosus*.
[0039]
[0040] Further experiments were conducted on adipocytes using five segments of the IM3 sequence from GM-020. Although they had the same IM3 core sequence, their front and rear ends showed different sequences, which were named IM3-1, IM3-2, IM3-3, IM3-4, and IM3-5, respectively (Table 2).
[0041] Table 2. Sequences of GM-020 nucleotide fragments containing IM3
[0042] Code name Core sequence Sequence ID Sequences of ODN of GM-020 IM3 TCAAGCTTGA IM3-1 SEQ ID NO:1 CCATTTTCAAGCTTGACTTT IM3-2 SEQ ID NO:2 GACATTTCAAGCTTGAACAA IM3-3 SEQ ID NO:3 TTGGTGTCAAGCTTGACATC IM3-4 SEQ ID NO:4 TCAGGCTCAAGCTTGAGTTC IM3-5 SEQ ID NO:5 TAGGACTCAAGCTTGATCTC
[0043] Example 2: Synthesis of CpG-ODN and Pretreatment
[0044] Five ODN fragments were synthesized by Chironmix Technology Co., Ltd. in Taiwan, China. The synthesized IM3-1, IM3-2, IM3-3, IM3-4, and IM3-5 sequences all contain the core sequence TCAGCTTGA, the five nucleotides preceding the 5' end, and the four nucleotides following the 3' end. The received DNA powder was rapidly centrifuged and diluted to 200 μM with injectable saline according to the volume provided by the synthesizer. After standing for 10 minutes, it was continuously diluted to stock concentrations of 100, 50, 25, and 12.5 μM.
[0045] Example 3: Adipocyte Culture
[0046] Preadipocyte 3T3-L1 cells were seeded in DMEM medium containing 10% FBS. After 2 days, the cells reached 70% confluence. The cell culture medium was then replaced with induction medium (10% FBSDMEM + 1μM Dexamethasone, 0.5mM 3-isobutyl-1-methyl-xathine (IBMX), 10μg / mL insulin). After 2 days, the cell culture medium was replaced with growth medium (10% FBSDMEM + 10μg / mL insulin). At this time, the cells were stimulated with the test substances (IM3-1, -2, -3, -4, -5). Subsequently, the growth medium (10% FBSDMEM + 10μg / mL insulin) containing the test substances was replaced every 3 days until the end of the experiment.
[0047] Example 4: Detection of Lipid Production
[0048] Differentiated adipocytes (3T3-L1) collected on the final day of the experiment were washed twice with PBS. 4% paraformaldehyde (PFA) was added and incubated at room temperature for 0.5–1 hour to fix the cells. After washing the cells twice with pure water, 60% isopropanol was added and incubated for 5 minutes. The isopropanol was then removed, and detection solution containing Oil Red O was added and incubated for 10–20 minutes. The cells were then washed twice with pure water until no stain was visible. Afterward, the cells were soaked in 60% isopropanol for 5 minutes, and then 250 μL of 100% isopropanol was used to dissolve intracellular lipid droplets. 200 μL of this solution was transferred to a 96-well plate, and the OD value was measured at 492 nm.
[0049] Adipocytes differentiated from the mouse preadipocyte cell line 3T3-L1 were stimulated with synthetically produced IM3-1 to IM3-5 fragments. Intracellular lipid droplets were stained with Oil Red O, and the results were quantified using OD values. Figure 2 The results showed that the oligodeoxynucleotide fragments IM3-1 and IM3-5 of GM-020 could inhibit the formation of oil droplets in differentiated adipocytes. Figure 3 The results showed that although IM3-2, IM3-3, and IM3-4 also have core sequences, they do not have the property of inhibiting adipogenesis.
[0050] Example 5: Expression of the fat-related gene FAS
[0051] From the 3T3-L1 adipocytes to the experimental endpoint, TRIZol was added to extract cellular RNA, which was then converted into cDNA and used as a template for Q-PCR. Each reaction reagent consisted of 5 μl of 2x Rotor-Gene SYBR Green PCR Master Mix (QIAGEN), 2 μl of cDNA, and 2 μl of 10 μM Forward (F) + Reverse (R) primers. The FAS gene primer sequence was: forward: GGAGGTGGTGATAGCCGGTAT; reversed: TGGGTAATCCATAGAGCCCAG. The control group GAPDH gene primer sequence was: forward: TGCACCACCAACTGCTTAGC; reversed: GGCATGGACTGTGGTCATGAG. The reaction solution was placed in a Q-PCR machine (model QIAGEN: Rotor-Gene Q 2Plex) to perform real-time quantitative polymerase chain reaction (Real-time PCR). The expression levels of relevant genes were calculated by subtracting the housekeeping gene (GAPDH) from the CT values obtained from Q-PCR, and then subtracting the relative expression levels obtained from the control group (2). -△△ Ct).
[0052] Table 3. Q-PCR primer sequences for FAS and GAPDH genes.
[0053] Introduction Name Serial Number nucleotide sequence FAS gene forward primer SEQ ID NO:6 GGAGGTGGTGATAGCCGGTAT FAS gene Reverse primer SEQ ID NO:7 TGGGTAATCCATAGAGCCCAG GAPDH gene forward primer SEQ ID NO:8 TGCACCACCAACTGCTTAGC GAPDH gene Reverse primer SEQ ID NO:9 GGCATGGACTGTGGTCATGAG
[0054] In cells with excessive fat accumulation, lipogenesis-related genes, such as the FAS (fatty acid synthase) gene, are highly expressed. Therefore, we further investigated whether stimulation of adipocytes with fragments IM3-1 and IM3-5 also affected the expression of the fat-related gene FAS. The RT-PCR analysis results are as follows: Figure 4 As shown, stimulation by IM3-1 and IM3-5 suppresses the FAS gene, which is normally activated and expressed in adipocytes. This patent finds that GM-020 contains two oligodeoxynucleotide fragments (IM3-1: CCATTTTCAAGCTTGACTTT and IM3-5: TAGGACTCAAGCTTGATCTC) that can significantly inhibit fat production, and the mechanism is through reducing the expression of the adipogenesis gene FAS.
[0055] Although these five ODN fragments all share the same core sequence TCAGCTTGA, their anterior and posterior ends contain five different sequences. Experimental results also showed that different fragment sequences exhibited varying effects in inhibiting lipogenesis. Only IM3-1 and IM3-5 showed significant inhibitory effects on lipogenesis, while IM3-2, IM3-3, and IM3-4 showed no statistically significant effects. This study, through lipogenesis detection and FAS gene expression analysis, identified ODN fragments with health-promoting effects, providing a novel and safe strategy for the prevention and improvement of obesity caused by a high-fat diet.
[0056] Based on the preferred embodiments disclosed in this specification, those skilled in the art will clearly understand that the foregoing embodiments are merely illustrative; those skilled in the art can implement the invention through numerous modifications and substitutions without differing from the technical features of the invention. According to the embodiments in this specification, the invention can be modified in various ways without hindering its implementation. The claims provided in this specification define the scope of the invention, which covers the foregoing methods and structures and equivalent inventions.
[0057] The aforementioned multiple benefits fully meet the statutory requirements for novelty and inventiveness for patentability. Therefore, this application is filed in accordance with the law, and we respectfully request your office to approve this invention patent application in order to encourage invention.
[0058] [Biomaterial Storage]
[0059] Lactobacillus rhamnosus (also known as Lacticaseibacillus rhamnosus) strain GM-020 is deposited at the Bioresource Conservation and Research Center of the Food Industry Research and Development Institute in Taiwan, with accession number BCRC 910236, and at the China Center for Type Culture Collection (CCTCC), with accession number CCTCM203098.
Claims
1. A nucleotide with anti-lipogenesis effect, characterized in that, The nucleotide sequence is SEQ ID NO:
1.
2. A nucleotide with anti-lipogenesis effect, characterized in that, The nucleotide sequence is SEQ ID NO.
5.
3. A composition having anti-lipogenesis effects, characterized in that, The composition comprises a nucleotide fragment of Lactobacillus rhamnosus GM-020 as an active ingredient; the Lactobacillus rhamnosus GM-020 has the accession number CCTCC M203098, and the sequence of the nucleotide fragment is SEQ ID NO. 1 or SEQ ID NO.
5.
4. A type of Lactobacillus rhamnosus (Lactobacillus rhamnosus) The use of nucleotide fragments of GM-020 in the preparation of anti-lipogenesis compositions is characterized by, The composition comprises a nucleotide fragment of Lactobacillus rhamnosus GM-020 as an active ingredient; the Lactobacillus rhamnosus GM-020 has the accession number CCTCC M203098, and the sequence of the nucleotide fragment is SEQ ID NO. 1 or SEQ ID NO. 5.