Compound black tea fermentation liquor with anti-aging efficacy containing ceramide and d-form amino acid

CN118120834BActive Publication Date: 2026-09-25GUANGZHOU ZHONGZHUANG BEAUTY COSMETICS CO LTD +2
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202410234356.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-03-01
Publication Date
2026-09-25
Estimated Expiration
2044-03-01

AI Technical Summary

Benefits of technology

1、本发明构建了一种能够生产神经酰胺的菌株,可以增加红茶发酵液中的神经酰胺含量;还构建了一种能够生产D型氨基酸的菌株,可以增加红茶发酵液中的D型氨基酸含量。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118120834B_ABST
    Figure CN118120834B_ABST
Patent Text Reader

Abstract

The application provides a compound black tea fermentation liquor containing ceramide and D-type amino acid and having anti-aging effect, and belongs to the technical field of black tea fermentation. The preparation method of the compound black tea fermentation liquor comprises the following steps: S1, constructing a ceramide-producing strain; S2, constructing a D-type amino acid-producing strain; S3, culturing seed liquid of the ceramide-producing strain; S4, culturing seed liquid of the D-type amino acid-producing strain; S5, preparing black tea extract; S6, centrifuging and resuspending the two kinds of seed liquid and then adding the seed liquid into the black tea extract for fermentation; and S7, separating the obtained black tea fermentation liquor to obtain the final compound black tea fermentation liquor. In the preparation process of the compound black tea fermentation liquor, ceramide and D-type amino acid can be generated, so that the efficacy of the black tea fermentation liquor is enhanced, and the market value of the black tea fermentation liquor is increased.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of black tea fermentation technology, and in particular to a compound black tea fermentation liquid containing ceramide and D-type amino acids with anti-aging effects and its preparation method. Background Technology

[0002] Black tea is a fully fermented tea made from fresh tea leaves through deep fermentation. The main antioxidant active components in black tea are theaflavins, thearubigins, and theabrownins. Thearubigins are the main red components in black tea liquor, and their astringency and irritation are weaker than those of theaflavins. Theabrownins contain amino acids, sugars, and other compounds. Black tea also contains some catechins. These substances primarily achieve their antioxidant effects, slowing down skin aging and improving skin radiance, through various pathways such as directly scavenging oxygen free radicals, blocking lipid peroxidation, chelating metal ions, inhibiting oxidase activity, and activating antioxidant enzyme activity.

[0003] Ceramides are a class of amide compounds formed by the dehydration of the amino group of long-chain fatty acids and sphingosine. Naturally occurring ceramides are commonly found in yeast, plants, and some mammalian tissues. Phytosphingosine is a precursor to ceramides and can help generate them, thus enabling the skin to produce various types of ceramides it needs from the source. It, along with cholesterol (25%) and free fatty acids (15%), constitutes intercellular lipids (ceramide 50%), participating in maintaining the skin barrier function. 40-50% of the sebum in the human stratum corneum is composed of ceramides, which play a crucial role in maintaining the moisture balance of the stratum corneum. Ceramides have a strong water-binding capacity, maintaining skin moisture by forming a network structure in the stratum corneum. With age, the body's ceramide levels gradually decrease; skin lacking ceramides becomes dull and dry. Supplementing with ceramides can also reduce fine lines and signs of aging.

[0004] Among the active ingredients in black tea, theanine, tea polyphenols, and theaflavins have been widely reported. In recent years, D-amino acids have also gradually gained attention. For example, D-cysteine ​​in black tea can act as an antioxidant, possessing anti-inflammatory and antioxidant effects. D-alanine can promote the production of adhesion protein 332 by epidermal keratinocytes, maintaining skin homeostasis. D-glutamic acid has the function of protecting the skin barrier and promoting its functional recovery.

[0005] Therefore, the formation of ceramides and D-amino acids during the fermentation process of black tea enhances its efficacy, giving fermented black tea liquid significant market potential and added value in the cosmetics industry. In addition, the fermentation process also produces peptides, biosurfactants, and other components, further increasing the value of black tea. Summary of the Invention

[0006] To address the aforementioned problems in existing technologies, this invention provides a compound black tea fermentation liquid containing ceramides and D-type amino acids, possessing anti-aging effects. The preparation process of this compound black tea fermentation liquid generates ceramides and D-type amino acids, thereby enhancing the efficacy of the black tea fermentation liquid and increasing its market value.

[0007] The technical solution of the present invention is as follows: A compound black tea fermentation liquid containing ceramides and D-type amino acids with anti-aging effects, the preparation method of the compound black tea fermentation liquid includes the following steps: S1. Construct a strain that produces ceramides; S2. Construct a strain that produces D-type amino acids; S3, Seed culture solution for culturing ceramide-producing strains; S4. Seed culture for D-type amino acid production strains; S5. Prepare black tea extract; S6. After centrifuging and resuspending the seed liquid prepared in step S3 and step S4, add it to the black tea extract prepared in step S5 for fermentation. S7. Separate the obtained black tea fermentation liquid to obtain the final compound black tea fermentation liquid.

[0008] Preferably, the strain producing ceramide in step S1 is a wild-type Yarrowia lipolytica strain that expresses phospholipidase via surface display; the amino acid sequence of the phospholipidase is shown in SEQ ID No. 1.

[0009] Preferably, the strain that produces D-type amino acids in step S2 is a Bacillus subtilis strain that expresses glutamate racemic enzyme, alanine racemic enzyme, and aspartate racemic enzyme, the amino acid sequences of which are shown in SEQ ID No. 2-SEQ ID No. 4, respectively.

[0010] More preferably, the glutamate racemic enzyme, alanine racemic enzyme, and aspartate racemic enzyme are expressed via plasmids or integrated into the genome for expression.

[0011] Preferably, the method for culturing the seed culture of the ceramide-producing strain in step S3 is as follows: the ceramide-producing strain obtained in step S1 is transferred to the seed culture medium and cultured with shaking at 25-37℃ for 12-72 h. The seed culture medium is formulated as follows: glucose 20 g / L, yeast extract 10 g / L, peptone 20 g / L, natural pH.

[0012] Preferably, the seed culture method for the D-type amino acid producing strain in step S4 is as follows: the D-type amino acid producing strain obtained in step S2 is transferred to LB medium and cultured with shaking at 25-37℃ for 12-72 h. The LB medium formula is: yeast extract 5 g / L, peptone 10 g / L, sodium chloride 10 g / L, natural pH.

[0013] Preferably, the preparation method of the black tea extract in step S5 is as follows: grind black tea into powder, add purified water, simmer at 50-100℃ for 10-240 min, centrifuge, filter and collect the filtrate.

[0014] More preferably, in step S5, the mass ratio of black tea to purified water is 1:15-25, more preferably 1:20; More preferably, in step S5, the preparation conditions are: simmering at 70°C for 30 min. More preferably, in step S5, the black tea extract is filtered and sterilized using a 0.22 μm filter membrane.

[0015] Preferably, the fermentation process described in step S6 is as follows: M1. First, inoculate the seed culture of the resuspended ceramide-producing strain into the black tea extract at an inoculation rate of 0.1-20%, add 1-50 g / L of sterilized glucose, and incubate at 15-37℃ for 2-12 h. M2, then inoculate the resuspended seed culture of the D-type amino acid production strain at an inoculation rate of 0.1-10%, and continue to culture at 15-40℃ for 2-12 h; M3, then add 1-10 g / L of sphingomyelin and 1-20 g / L of galactose, and continue culturing at 15-37℃ for 2-12 h; M4. Finally, raise the temperature to 40-45℃ and continue culturing for 1-2 hours.

[0016] More preferably, in step S6, the method for centrifuging and resuspending the seed solution is as follows: after centrifuging the prepared ceramide-producing strain seed solution and the D-type amino acid-producing strain seed solution respectively, wash them three times with purified water, and then resuspend them with purified water.

[0017] Preferably, the separation method of the black tea fermentation liquid in step S7 is as follows: after the black tea fermentation liquid is subjected to a high-pressure homogenizer to break the bacteria, it is centrifuged to obtain the supernatant; the supernatant is further filtered and sterilized using a ceramic membrane or a 0.22 or 0.45 μm filter membrane to obtain the final compound black tea fermentation liquid.

[0018] More preferably, the crushing process involves crushing 2-4 times using a pressure of 1000 bar; the centrifugal separation conditions are centrifugation at a pressure of 5000 g or more for at least 10 minutes.

[0019] The beneficial technical effects of this invention are as follows: 1. This invention constructs a strain capable of producing ceramides, which can increase the ceramide content in black tea fermentation liquid; it also constructs a strain capable of producing D-type amino acids, which can increase the D-type amino acid content in black tea fermentation liquid.

[0020] 2. The compound black tea fermentation liquid prepared using the method described in this invention exhibits a significant increase in the content of ceramides and D-type amino acids. This enhances the antioxidant, skin repair, and skin barrier strengthening properties of the compound black tea fermentation liquid when used in cosmetics. Simultaneously, the fermentation process also produces peptides, surfactants, fruit acids, and other substances, achieving multiple activities.

[0021] 3. The preparation method of the present invention can not only produce a variety of active ingredients, including polypeptides, surfactants, fruit acids, etc., but also produce ceramides and a variety of D-type amino acids. These active ingredients have significant advantages in enhancing the antioxidant properties of black tea fermentation liquid, skin repair, strengthening the skin barrier, and reconstructing the skin ecological balance, thereby improving the efficacy and use value of black tea fermentation liquid. Attached Figure Description

[0022] Figure 1 The spectrum of plasmid pJJL-23-032-3; Figure 2 Performance evaluation of JJL-23-032-1 ceramide production; Figure 3 Comparison of catalytic results of JJL-23-032-2 on different amino acids. Detailed Implementation

[0023] The present invention will now be described in detail with reference to the accompanying drawings and embodiments. Obviously, the described embodiments are merely some, not all, of the embodiments of the present invention. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort are within the scope of protection of the present invention.

[0024] The bacterial strains used in the following examples are all commercially available.

[0025] Example 1: Construction of Ceramide-producing strains To achieve surface display of phospholipase in *Yersinia lipolytica*, a construct called pox3U-P1-hph-T-P2-Flo1P::PLC-T-pox3D, driven by a constitutive promoter from *Yersinia lipolytica*, was synthesized. Here, pox3U is the upstream homologous arm in the homologous recombination construct, and pox3D is the downstream homologous arm. P1 is an endogenous constitutive promoter from *Yersinia lipolytica* used to express the hygromycin resistance gene *hph*.

[0026] To achieve surface display of the phospholipase PLC shown in SEQ ID No. 1, Flo1P was fused to its N-terminus, and expression was driven by the Yersinia lipolyticis endogenous constitutive promoter P2. T was used as the terminator. The DNA sequence of this expression cassette is shown in SEQ ID No. 5.

[0027] To construct pox3U-P1-hph-T-P2-Flo1P::PLC-T-pox3D, pox3U and pox3D were first integrated into the pUC18 plasmid. pox3U was amplified using Yersinia lipolyticis genomic DNA as a template with primers P1 / P2; pox3D was amplified using Yersinia lipolyticis genomic DNA as a template with primers P3 / P4. The pUC18 plasmid was double-digested with BamHI and EcoRI, and the three fragments were purified separately, ligated using Gibson ligation, and transformed into E. coli DH5α. LB plates containing 50 μg / mL ampicillin were used for screening, and positive clones were sequenced for verification. The correctly verified plasmid was named pJJL-23-032-1.

[0028] P1:GCTATGACCATGATTACGAATTCtcttatttttttcctcatcttctg P2: gctggttaactgtgtgtatcgtagaggtagtg P3:gatacacacagttaaccagcagaaccctgc P4: CTGCAGGTCGACTCTAGAGGATCCctcaactcttgtccttaacta P1-hph-T-P2-FloP::PLC-T was synthesized by BGI Genomics and amplified via P5 / P6. Using pJJL-23-032-1 as a template, a backbone template was obtained through primers P7 / P8. After purification of both fragments, Gibson ligation was performed, and the resulting plasmids were transformed into E. coli DH5α. Screening was conducted using LB agar plates containing 50 μg / mL ampicillin, and positive clones were sequenced for verification. The validated plasmid was named pJJL-23-032-2.

[0029] The LB plate culture medium consists of: 5 g / L yeast extract, 10 g / L peptone, 10 g / L sodium chloride, and 15 g / L agar.

[0030] P5:ctacctctacgatacacacaagagaccgggttggcggcgc P6: gcagggttctgctggttaacGCCACCTACAAGCCAGATTTTC P7: tgtgtgtatcgtagaggtag P8: gttaaccagcagaaccctgc The recombinant expression cassette fragment of pJJL-23-032-2 was obtained by double digestion with BamHI and EcoRI. It was then transformed into Yersinia lipolytica through homologous recombination using a yeast transformation kit (Frozen-EZ Yeast Transformation II). The fragments were plated on YPD agar plates containing 400 μg / mL hygromycin for initial screening and cultured at 28°C for 48 h until single colonies grew.

[0031] Then, single colonies were picked and placed in YPD liquid medium containing hygromycin, cultured at 28°C for 48 h, the genome was extracted, and PCR verification was performed using primers P9 / P10. The correct strain was selected and named JJL-23-032-1.

[0032] The YPD plate medium consists of 10 g / L yeast extract, 20 g / L peptone, 20 g / L glucose, and 20 g / L agar. The YPD liquid medium consists of 10 g / L yeast extract, 20 g / L peptone, and 20 g / L glucose.

[0033] P9: acacccgcccgctttgtgctctc P10: ctcaccgatgtcaagcacctc Example 2: Construction of D-type amino acid producing strain To achieve the production of D-type amino acids, the genes encoding glutamate racemase, alanine racemase, and aspartate racemase were expressed in Bacillus subtilis. The specific construction process is as follows: Using the genome of *Pseudomonas putida* KT2440 as a template, the glutamate racemase gene shown in SEQ ID No. 2 was amplified using primers P11 / P12, the alanine racemase gene shown in SEQ ID No. 3 was amplified using primers P13 / P14, and the aspartic acid racemase gene shown in SEQ ID No. 4 was amplified using primers P15 / P16; the plasmid backbone was obtained by amplification using pHT08 plasmid as a template and primers P17 / P18.

[0034] The four fragments obtained were purified, ligated using Gibson ligation, and transformed into E. coli DH5α. Screening was performed using LB agar plates containing 50 μg / mL ampicillin, and positive clones were sequenced for verification. The validated plasmid was named pJJL-23-032-3, and its map is shown below. Figure 1 As shown.

[0035] P11: CAATTAAAGGAGGAAGGATCTATGGCTGAGCGCTCGGCGCC P12: GGGCATAGATCCTTCCTCCTTTTCACAACGCAAAGCTTTGCAC P13: GTGAAAAGGAGGAAGGATCTATGCCCTTTCGCCGTACCCT P14:TACGCATAGATCCTTCCTCCTTTTCAGTCGACGAGTATCTTCG P15: CTGAAAAGGAGGAAGGATCTATGCGTATTCTGATCGCCAAC P16: CCAGGTAAGGTATAAACTTTTCAGCGCCGAAGCGCATC P17: AGATCCTTCCTCCTTTAATTG P18: AAAGTTTATACCTTACCTGG pJJL-23-032-3 was transformed into Bacillus subtilis and screened using LB agar plates containing 5 μg / mL chloramphenicol. Positive clones were verified by PCR using primers P19 / P20. The correctly verified strain was named JJL-23-032-2.

[0036] P19: GGCTTGAACAATCACGAAAC P20: GTCGGACTTATGCCACAGCAC Example 3: Method for determining ceramide content Take 10 mL of the sample to be tested, add 40 mL of chloroform / methanol (2:1 v / v) for extraction, and centrifuge after vigorous shaking to separate the layers. Discard the upper aqueous phase containing proteins, nucleic acids, and water-soluble lipids, and collect the lower organic phase, which is the crude lipid extract containing ceramides. Dry the obtained crude extract, add 10 mL of chloroform / methanol (2:1 v / v) and 1 mL of water again, vigorously shake, and centrifuge to separate the layers. Dry the lower organic phase, make up to a final volume in chloroform, and perform HPLC analysis.

[0037] The liquid chromatograph was an LC-16 manufactured by Shimadzu Corporation, Japan, using an evaporative light scattering detector. The detector temperature was set to 40°C, and the air pressure was 350,000 Pa. An Alltima CN column (4.6 × 150 mm) was used. The mobile phase was n-hexane / ethanol (99:1 v / v) at a flow rate of 0.8 mL / min.

[0038] Example 4: Method for determining the content of D-type amino acids Take 200 μL of the sample to be tested, add 4.8 mL of 0.1 mM L-sulfoalanine, mix well, and then take 0.5 mL of the mixture to add phthalaldehyde and N-acetylcysteine ​​to derivatize the amino acids. The sample was analyzed using an LC-16 high-performance liquid chromatography (HPLC) system manufactured by Shimadzu Corporation, Japan. The chromatographic column was a J'sphere ODS-M80 column (4.6 × 150 mm). The mobile phase was a 50 mM sodium acetate solution containing 3.8% methanol (pH 5.55), and the flow rate was 1 mL / min. A fluorescence detector was used, with an excitation wavelength of 320 nm and an absorption wavelength of 440 nm.

[0039] Example 5: Production of ceramides by strain JJL-23-032-1 Single colonies of strain JJL-23-032-1 were transferred to 5 mL of YPD liquid medium and cultured at 30°C and 200 rpm with shaking for 48 h. Then, all colonies were transferred to 500 mL unbaffled shake flasks containing 100 mL of YPD liquid medium and cultured at 30°C and 200 rpm for 24 h with shaking. 5 g / L sphingomyelin was added, and the culture was continued at 30°C and 200 rpm with shaking for another 48 h, followed by incubation at 40°C for 1 h. After incubation, the culture was homogenized three times using a high-pressure homogenizer at 1000 bar. The ceramide content of the supernatant was determined by centrifugation.

[0040] As a control, wild-type Yersinia lipolyticis was selected and cultured and isolated using the same methods, and the ceramide content was determined. The results are as follows: Figure 2 As shown in the figure, 24 mg / L of ceramide can be obtained using wild-type Yersinia lipolytica, while 322 mg / L of ceramide can be obtained using JJL-23-032-1, representing a 12.4-fold increase in ceramide content.

[0041] Example 6: Production of D-type amino acids by strain JJL-23-032-2 Single colonies of strain JJL-23-032-2 were inoculated into 5 mL of LB liquid medium and cultured at 37°C and 200 rpm for 12 h with shaking. Then, the entire culture was transferred to a 500 mL shake flask with baffles containing 100 mL of fermentation medium and cultured at 30°C and 200 rpm for 12 h with shaking. Afterward, 10 g / L galactose was added, and the culture was continued at 30°C and 200 rpm with shaking for 36 h. The fermentation medium consisted of: 70 g / L sucrose, 1 g / L yeast extract, 25 g / L NaNO3, 0.333 g / L KH2PO4, 1 g / L Na2HPO4·12H2O, 0.15 g / L MgSO4·7H2O, 7.5 mg / L CaCl2, 6 mg / L MnSO4·H2O, 6 mg / L FeSO4·7H2O, and pH 7.0.

[0042] The culture medium was collected, centrifuged, and the bacterial cell precipitate was collected. The obtained bacterial cell precipitate was washed three times with 100 mM PB and finally resuspended in 100 mL of 100 mM PB (pH 8.0). The ability of the cultured bacteria to produce different D-amino acids was determined. The determination method was as follows: Take 50 mL of BD tube, add 3 mL of the resuspended bacterial cells, and then add L-alanine, L-arginine, L-aspartic acid, L-cysteine, L-glutamic acid, L-glutamine, L-histidine, L-valine, L-leucine, L-lysine, L-methionine, L-phenylalanine, L-proline, L-serine, L-glycine, L-isoleucine, L-threonine, L-tryptophan, L-tyrosine, and L-asparagine to a final concentration of 10 g / L. Incubate at 30℃ and 200 rpm for 6 h with shaking. The content of D-amino acids obtained by transforming different types of L-amino acids from the cultured bacterial cells is as follows: Figure 3 As shown in the figure, the cultured strain can catalyze the production of most D-type amino acids, with the highest catalytic activity for alanine, but D-methionine, D-isoleucine, D-threonine, D-tryptophan, and D-tyrosine were not produced.

[0043] Example 7: Preparation of Compound Black Tea Fermentation Broth JJL-23-032-1 cell activation: Single colonies of strain JJL-23-032-1 were transferred to 5 mL of YPD liquid medium (i.e., seed culture medium) and cultured at 30℃ and 200 rpm for 48 h with shaking. The YPD liquid culture medium consisted of 10 g / L yeast extract, 20 g / L peptone, 20 g / L glucose, and natural pH.

[0044] JJL-23-032-2 cell activation: Single colonies of strain JJL-23-032-2 were picked and inoculated into 5 mL of LB medium and cultured at 37℃ with shaking at 200 rpm for 12 h. The LB medium consisted of 5 g / L yeast extract, 10 g / L peptone, 10 g / L sodium chloride, and natural pH.

[0045] Preparation of black tea extract: Grind 5 g of black tea into powder, add 100 g of purified water, simmer at 70℃ for 30 min, centrifuge and collect the filtrate. Filter the black tea extract through a 0.22 μm filter membrane for sterilization.

[0046] Black tea fermentation: The seed cultures of JJL-23-032-1 and JJL-23-032-2 prepared in steps (1) and (2) were centrifuged, washed three times with purified water, and then resuspended in purified water. The resuspended JJL-23-032-1 was inoculated into the black tea extract at a 5% inoculum, and 10 g / L sterilized glucose was added. The mixture was then incubated at 30°C for 6 h. Then, 5% of the resuspended JJL-23-032-2 seed culture was added, and the mixture was incubated at 30°C for another 6 h. Subsequently, 5 g / L sphingomyelin and 10 g / L galactose were added, and the mixture was incubated at 30°C for another 6 h. Then, the temperature was increased to 40°C and the mixture was incubated for another 1 h.

[0047] After fermentation, the bacterial cells in the fermentation broth were disrupted using a high-pressure homogenizer. The disruption pressure was 1000 bar, and the disruption process was repeated three times. The resulting disrupted broth was then centrifuged to separate the bacterial cell fragments under the following conditions: 10000 g for 10 min.

[0048] The supernatant was obtained and further filtered and sterilized using a 0.22 μm filter membrane to obtain a compound black tea fermentation liquid.

[0049] The contents of ceramide and various D-type amino acids in the compound black tea fermentation liquid obtained in step (6) and the black tea extract obtained in step (3) were determined respectively, and the results are shown in Table 1.

[0050] Table 1. Comparison of ceramide and D-amino acid content in compound black tea fermentation liquid and black tea extract.

[0051] The table shows that the concentration of ceramide in the compound black tea fermentation liquid was 184 mg / L, and the contents of various D-type amino acids were increased to varying degrees, with glutamic acid having the highest content at 3.363 ppm. The total content of D-type amino acids in the compound black tea fermentation liquid was 15 ppm, which was 2.4 times higher than that in the black tea extract.

[0052] Example 8: Determination of anti-wrinkle indexes of fibroblasts in compound black tea fermentation broth and black tea extract Anti-wrinkle indicators were determined according to the group standard T / SHRH031-2020, "Test of Firming and Anti-wrinkle Efficacy of Cosmetics - Determination of Type I Collagen Content in In Vitro Fibroblasts." Human dermal fibroblasts were digested with trypsin / EDTA at a concentration of 0.25% using a T75 culture flask with a volume of 3 mL. Observation was performed under an inverted microscope. When most cells became rounded and in suspension, approximately three times the volume of trypsin in serum-containing DMEM medium was added to terminate the digestion. The cells were then collected in centrifuge tubes and centrifuged at 800 r / min for 6 min. After centrifugation, the supernatant was discarded, and a certain volume of cell culture medium was added to the centrifuge tube. The cells were mixed by pipetting with a bent pipette and counted using a cell counter or hemocytometer. The cells were diluted with cell culture medium to a density of 2.5 × 10⁻⁶. 6 The solution was inoculated into 96-well plates, with a volume of 200 μL per well. After inoculation, the plates were incubated in a CO2 incubator for 24 h.

[0053] Discard the culture medium and add culture medium containing 20% ​​black tea extract and black tea fermentation broth respectively. Add normal cell culture medium to the blank group, 200 μL per well. After completion, incubate the 96-well plate in a CO2 incubator for 24 h. Centrifuge the cell culture supernatant at 1000 g for 15 min at 4℃, and transfer the supernatant to a 1.5 mL sterile centrifuge tube. Store at -80℃. ELISA detection was performed according to the instructions for use of the Human Type I Collagen Enzyme-Linked Immunosorbent Assay Kit.

[0054] The collagen content of cells treated with the compound black tea fermentation liquid was 8.5 ± 0.4 ng / mL, the collagen content of cells treated with black tea extract was 7.2 ± 0.3 ng / mL, and the collagen content of cells in the control group was 5.3 ± 0.3 ng / mL. These results indicate that the compound black tea fermentation liquid of this invention can significantly increase the collagen content in fibroblasts.

[0055] Although the embodiments of the present invention have been disclosed above, they are not limited to the applications listed in the specification and embodiments. They can be applied to various fields suitable for the present invention. For those skilled in the art, and for those of ordinary skill in the art, various changes, modifications, substitutions and variations can be made to these embodiments without departing from the principles and spirit of the present invention. Therefore, the present invention is not limited to the specific details without departing from the general concept defined by the claims and their equivalents.

Claims

1. A method for preparing a compound black tea fermentation liquid containing ceramides and D-amino acids with anti-aging effects, characterized in that, The preparation method of the compound black tea fermentation liquid includes the following steps: S1. Construct a strain that produces ceramides; S2. Construct a strain that produces D-type amino acids; S3, Seed culture of the ceramide-producing strain constructed in step S1; S4. Cultivate the seed culture of the strain that produces D-type amino acids constructed in step S2; S5. Prepare black tea extract; S6. After centrifuging and resuspending the seed liquid prepared in step S3 and step S4, add it to the black tea extract prepared in step S5 for fermentation. S7. Separate the obtained black tea fermentation liquid to obtain the final compound black tea fermentation liquid; The strain used to produce ceramide in step S1 is wild-type Yersinia lipolyticis (Yersinia lipolyticis). Yarrowia lipolytica Phospholipase C is expressed by surface display in a [substrate name]; the amino acid sequence of said phospholipase C is shown in SEQ ID No.

1. The strain used in step S2 to produce D-type amino acids is Bacillus subtilis (… Bacillus subtilis The enzyme expresses glutamate racemase, alanine racemase, and aspartate racemase, the amino acid sequences of which are shown in SEQ ID No. 2-SEQ ID No. 4, respectively. The fermentation process described in step S6 is as follows: M1. First, inoculate the seed culture of the resuspended ceramide-producing strain into the black tea extract at an inoculation rate of 0.1-20%, add 1-50 g / L of sterilized glucose, and incubate at 15-37℃ for 2-12 h. M2, then inoculate the resuspended seed culture of the D-type amino acid production strain at an inoculation rate of 0.1-10%, and continue to culture at 15-40℃ for 2-12 h; M3, then add 1-10 g / L of sphingomyelin and 1-20 g / L of galactose, and continue culturing at 15-37℃ for 2-12 h; M4. Finally, raise the temperature to 40-45℃ and continue culturing for 1-2 hours.

2. The method for preparing the compound black tea fermentation liquid according to claim 1, characterized in that, The glutamate racemic enzyme, alanine racemic enzyme, and aspartate racemic enzyme are expressed via plasmids or integrated into the genome.

3. The method for preparing the compound black tea fermentation liquid according to claim 1, characterized in that, The method for culturing the seed culture of the ceramide-producing strain in step S3 is as follows: the ceramide-producing strain obtained in step S1 is transferred to the seed culture medium and cultured with shaking at 25-37℃ for 12-72 h. The seed culture medium is formulated as follows: glucose 20 g / L, yeast extract 10 g / L, peptone 20 g / L, natural pH.

4. The method for preparing the compound black tea fermentation liquid according to claim 1, characterized in that, The method for culturing the seed culture of the D-type amino acid producing strain described in step S4 is as follows: the D-type amino acid producing strain obtained in step S2 is transferred to LB medium and cultured with shaking at 25-37℃ for 12-72 h. The LB medium formula is: yeast extract 5 g / L, peptone 10 g / L, sodium chloride 10 g / L, natural pH.

5. The method for preparing the compound black tea fermentation liquid according to claim 1, characterized in that, The preparation method of the black tea extract in step S5 is as follows: grind black tea into powder, add purified water, simmer at 50-100℃ for 10-240 minutes, centrifuge, filter and collect the filtrate.

6. The method for preparing the compound black tea fermentation liquid according to claim 1, characterized in that, The separation method of the black tea fermentation liquid in step S7 is as follows: after the black tea fermentation liquid is crushed by a high-pressure homogenizer, the supernatant is obtained by centrifugation; the supernatant is further filtered and sterilized using a 0.22 or 0.45 μm filter membrane to obtain the final compound black tea fermentation liquid.

7. The method for preparing the compound black tea fermentation liquid according to claim 6, characterized in that, The crushing process involves crushing the material 2-4 times under 1000 bar pressure; the centrifugal separation condition is 5000... g Centrifuge for at least 10 minutes.

Citation Information

Patent Citations

  • Gene for encoding LsGAD (Lactobacillus senmaizukei glutamic acid decarboxylase), recombinant bacterium and Kombucha fermentation viable bacteria preparation

    CN110791516A

  • Black tea fermentation filtrate as well as preparation method and application thereof

    CN115105452A

  • Recombinant bacterium for exogenous expression of alanine racemase and application of recombinant bacterium

    CN116410906A