Application of PtoMYB113 gene in breeding of purple leaf poplar
Patent Information
- Application Number
- CN202410343678.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-03-25
- Publication Date
- 2026-09-15
- Estimated Expiration
- 2044-03-25
AI Technical Summary
[0027] This invention uses *Populus tomentosa* as the research material and clones the PtoMYB113 gene from *Populus tomentosa*. Through bioinformatics analysis, induced expression analysis, target gene overexpression, and analysis of genes related to anthocyanin synthesis, the function of PtoMYB113 in the anthocyanin synthesis process was studied. The main results are as follows:
Smart Images

Figure CN118127034B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of plant breeding, specifically to the application of the poplar PtoMYB113 gene in the breeding of purple-leaved poplar. Background Technology
[0002] White poplar (Populus tomentosa) is highly adaptable and can grow in a variety of soil and environmental conditions. It is particularly common in northern China and is widely used for urban greening and afforestation. The wood of the white poplar is hard and is an important raw material for papermaking and engineered wood products. Furthermore, due to its rapid growth and wide adaptability, the white poplar is also an important subject of genetic improvement and genetic engineering research. Through the application of science and technology, its economic and environmental value can be further enhanced. Genetic research and improvement of the white poplar can not only enhance its resistance and adaptability but also provide important support for sustainable forestry development and ecological environmental protection.
[0003] Plants encounter various biotic stresses (pathogens and pests, etc.) and abiotic environmental stresses (drought, salinity, low temperature, high temperature, etc.) during normal growth and development. These stressors affect plant growth, development, yield, and survival. Anthocyanin biosynthesis and accumulation are regulated at multiple levels during plant growth, development, and adaptation to environmental changes. Among these, MYB transcription factors, along with bHLH transcription factors and WD40 protein, form a regulatory complex that influences the expression of genes related to anthocyanin biosynthesis. These transcription factors control the production of anthocyanins, ranging from red to blue, in plants by regulating specific genes in the anthocyanin biosynthesis pathway. Environmental factors such as plant hormones, light, and temperature have a significant impact on anthocyanin biosynthesis. Abscisic acid can induce the expression of certain MYB transcription factors, thereby promoting anthocyanin synthesis; and light and temperature, by affecting the activity of MYB transcription factors, further alter anthocyanin synthesis and accumulation.
[0004] Anthocyanins are important secondary metabolites of flavonoids, widely found in plants. They are primarily responsible for the color formation of plant organs such as flowers, fruits, and leaves, and also possess biological functions such as antioxidant and disease resistance. Anthocyanins give flowers vibrant colors, attracting pollinators such as hummingbirds and insects. These pollinators are drawn to the flowers by the color, thus aiding in plant reproduction. In fruits, the presence of anthocyanins usually indicates ripeness. This color change attracts animals to eat the fruit and helps with seed dispersal. Anthocyanins also protect plants from damage caused by intense sunlight. Under strong light, excessive light energy can damage plants; anthocyanins reduce potential damage by absorbing this light. Anthocyanins in plants can change their color according to environmental conditions (especially pH), and this adaptive change may be related to ecological niche, environmental conditions, or other survival strategies.
[0005] Therefore, the present invention aims to obtain a new variety of Populus tomentosa by studying the genes that regulate anthocyanin synthesis, and to provide new ideas for the breeding of Populus tomentosa. Summary of the Invention
[0006] To solve the above-mentioned technical problems, the present invention provides an application of the PtoMYB113 gene of purple-leaved poplar in the breeding of purple-leaved white poplar.
[0007] This invention provides an application of the PtoMYB113 gene in the breeding of Populus tomentosa, wherein the gene sequence number of the PtoMYB113 gene in NCBI is MW762689.1, and the nucleotide sequence of the PtoMYB113 gene is shown in SEQ ID NO.1.
[0008] Preferably, the anthocyanin content in Populus tomentosa is increased by overexpressing PtoMYB113. Leaves of Populus tomentosa overexpressing MYB113 turn noticeably redder, and growth is inhibited.
[0009] Preferably, the expression level of the anthocyanin synthesis gene is increased by overexpressing PtoMYB113.
[0010] Preferably, the expression of anthocyanin synthesis genes Pto4CL1, Pto4CL2, PtoCHS1, PtoDFR1, PtoDFR2 or PtoUFGT1 is promoted by overexpressing PtoMYB113.
[0011] Preferably, dwarfed Populus tomentosa is obtained by overexpressing PtoMYB113. MYB113 overexpression reduces both the height and stem diameter of Populus tomentosa.
[0012] Preferably, the breeding process of Populus tomentosa includes the following steps:
[0013] Amplify the PtoMYB113 gene;
[0014] The full-length CDS sequence of the amplified PtoMYB113 gene was ligated into an expression vector to obtain an overexpression vector;
[0015] The overexpression vector was transformed into Agrobacterium competent cells, and the resulting Agrobacterium competent cells containing the overexpression vector were used to infect plants and cultured to obtain transgenic Populus tomentosa plants.
[0016] Preferably, the primer pair for amplifying the PtoMYB113 gene is:
[0017] OE-MYB113-F: 5'-CGGGATCCATGGTAGGCTCATTAGGAGTAAG-3';
[0018] OE-MYB113-R: 5'-GGAATTCTTATAGAATAAAGTCCTTTCCAGGTT-3'.
[0019] Preferably, the PCR reaction program used to amplify the PtoMYB113 gene is as follows: 98℃ pre-denaturation for 3 min, 98℃ denaturation for 15 sec, 58℃ annealing for 15 sec, 72℃ extension for 10 sec, 34 cycles, and 72℃ complete extension for 5 min.
[0020] Preferably, the PCR reaction system used for amplifying the PtoMYB113 gene is as follows: 25 μL of 5×Primer STAR MAX, 1 μL of 10 μM F-Primer, 1 μL of 10 μM R-Primer, 2 μL of template DNA, and 24 μL of ddH2O.
[0021] Preferably, the expression vector is pBI121.
[0022] Preferably, the PtoMYB113 gene and expression vector are digested with BamHI and EcoRI, respectively, and then ligated. After ligation, the gene is directly transformed into E. coli DH5α, and positive strains are identified by PCR.
[0023] Preferably, the enzyme digestion system is: 10×Green Buffer 5μL, SacⅠ 2μL, BamHI 2μL, plasmid / target fragment 20μL, ddH2O 21μL.
[0024] Preferably, the ligation system consists of: 1 μL of 10×T4 DNA Ligase Buffer, 1 μL of T4 DNA Ligase, 3 μL of digestion vector, and 5 μL of target fragment.
[0025] Preferably, the competent Agrobacterium cells are EHA105 Agrobacterium.
[0026] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0027] This invention uses *Populus tomentosa* as the research material and clones the PtoMYB113 gene from *Populus tomentosa*. Through bioinformatics analysis, induced expression analysis, target gene overexpression, and analysis of genes related to anthocyanin synthesis, the function of PtoMYB113 in the anthocyanin synthesis process was studied. The main results are as follows:
[0028] (1) The phylogenetic tree construction results showed that PtoMYB113 and PeMYB113 of Populus tomentosa had the highest homology; sequence alignment showed that MYB113 is a typical R2R3-MYB transcription factor, and its N-terminal region is a relatively conserved functional region, including a 56-amino acid R2 functional domain and a 50-amino acid R3 functional domain.
[0029] (2) Morphological observation of PtoMYB113 overexpression in Populus tomentosa showed that after overexpression of the PtoMYB113 gene in Populus tomentosa, the growth phenotype and color phenotype of the transgenic lines were compared: compared with WT, the leaves of the MYB113 overexpression material turned redder and growth was inhibited. The anthocyanin content determination showed that the total anthocyanin content of the MYB113 overexpression material increased significantly.
[0030] (3) The expression levels of marker genes Pto4CL1, Pto4CL2, PtoCHS1, PtoDFR1, PtoDFR2, and PtoUFGT1 in the flavonoid synthesis pathway were detected. The results showed that compared with the wild type, the expression levels of Pto4CL1, Pto4CL2, PtoCHS1, PtoDFR1, PtoDFR2, and PtoUFGT1 in the flavonoid synthesis pathway were increased, with PtoDFR1 and PtoDFR2 showing an upregulation of more than 50-fold. These results indicate that PtoMYB113 can promote anthocyanin accumulation by promoting flavonoid synthesis.
[0031] (4) By using transgenic methods, the MYB113 gene was integrated into the genome of Populus tomentosa, which changed the plant height, stem diameter and anthocyanin content accumulation of Populus tomentosa.
[0032] In summary, the MYB113 gene in Populus tomentosa can significantly promote anthocyanin accumulation in its leaves, resulting in purple leaves and providing a purple-leaved ornamental poplar for urban landscaping. Furthermore, overexpression of the MYB113 gene can inhibit plant growth and cause leaves to turn red, offering insights for genetic engineering in the breeding of landscape plants. Attached Figure Description
[0033] Figure 1 Evolutionary tree comparison of MYB113 in different species;
[0034] Figure 2 The amino acid sequences of MYB113 were compared between different species; among them, Indicates the R2 functional domain; Indicates the R3 functional domain;
[0035] Figure 3 To identify the expression level of the MYB113 gene; compared with the WT group, ***P<0.001;
[0036] Figure 4 Phenotypic analysis of MYB113 overexpression was performed, including (a) seedling phenotype of MYB113-overexpressing plants, (b) anthocyanin content of MYB113-overexpressing plants, (c) plant height of MYB113-overexpressing plants, and (d) stem diameter of MYB113-overexpressing plants. Compared with the WT group, * P<0.05, *** P<0.001;
[0037] Figure 5 Analysis of gene expression levels in the MYB113 overexpression pathway of flavonoid synthesis.
[0038] Note: WT represents wild-type white poplar. Detailed Implementation
[0039] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort are within the scope of protection of the present invention. Unless otherwise specified, the experimental methods described in the embodiments of the present invention are conventional methods.
[0040] Example 1
[0041] 1. Bioinformatics analysis of the MYB113 gene family
[0042] (1) Phylogenetic tree and homology analysis of MYB113 protein
[0043] The amino acid sequences of MYB113 in different species were searched using the NCBI database (https: / / www.ncbi.nlm.nih.gov / ) and the Phytozome database (https: / / phytozome.jgi.doe.gov / ). A phylogenetic tree of the MYB113 gene in poplar was constructed using MEGA11 (http: / / www.megasoftware.net / mega.html). Figure 1 As shown. Multiple alignments were performed using DNAMAN 8.0 to compare the amino acid sequence of poplar MYB113 with the amino acid sequences of MYB113 from different species, such as... Figure 2 As shown.
[0044] 2. Amplification of the target gene
[0045] To identify the function of MYB113 in Populus tomentosa in detail, the homologous gene of MYB113 in Populus tomentosa was cloned. The CDS sequence of the AtMYB113 gene was found in the Arabidopsis Tair database (https: / / www.arabidopsis.org / ). The CDS sequence of the PtrMYB113 gene in Populus trichocarpa was obtained by blasting the Phytozome database, and the CDS sequence of the MYB113 homologous gene in Populus alba was obtained by blasting the NCBI database. Finally, the MYB113 sequences of Populus alba and Populus trichocarpa were aligned using Snapgene. Specific primers for the UTR region were designed in the homologous region. The sequence of PtoMYB113 is as follows:
[0046] ATGGTAGGCTCATTAGGAGTAAGGAAAGGCGCATGGACGGAGGAGGAA
[0047] GATATACTTCTAAGGAAGTGCGTTGAGAAATATGGTGAAGCAAGATGGT
[0048] ATGAAGTTCCTCCAGAGCAGGCTTGAATCGATGCAGGAAGAGCTGCAG
[0049] AATGAGTGGTTGAATTATCTTAAGCCAAATATCAAGAGAGGACAGTTT
[0050] TCCGAGGACGAAGTGGACTTGATTATCAGACTACACAAGTTGCTGGCA
[0051] ATAGGTGGTCATTGATAGCTGGTAGACTTTCAGGAAGAACAGCGAATGA
[0052] TGTAAAGAATTATTGGAACTCAAACCAGCGTAAGAAGGTGATTTCTAGC
[0053] ACTGATGAAGTTCGATCAAAACCAGAAGCAAAATCAATCACAAGAGAC
[0054] AACATAATAAAGCCTCGACCTTGGAAGTTCAGAAAATTTATTCTGGTTAG
[0055] GAGGAAAAAGCACTCCACTTATTAACGTTGGTTCTCAACATGGGAACGA
[0056] TCTTTGTAAGCCATGTTATTCAACAGTATCGCCACCTTCCGACATTAATG
[0057] AAGTTTTAAGTTTATGGTGGGAAAGCTCGTTAGATGACAAAGAAATTAA
[0058] TCAAACGATCAACAGCAGTTGTCTGGGTTCTGCAGGTTCAGCAGCAGCA
[0059] GCTTACCTAGAGTCCAACGAAAGTCATCTTGTAGAGAACAACGAACCAG
[0060] GAGGGATCAAAACTGGGGATGTGTTCTATGAACAAGCTGGACAAAATT
[0061] GTTGGAGTGACATTTCTCTGGATGCAGACCTCTGGAATCTAATCAATGCAGAACTAGATCAACAACAACCTGAGAAGGACTTTATTCTATAA, which is recorded as SEQ ID NO. 1.
[0062] The amino acid sequence encoded by PtoMYB113 is shown as SEQ ID NO. 2:
[0063] MVGSLGVRKGAWTEEEDILLRKCVEKYGEARWYEVPSRAGLNRCRKSCRMRWLNYLKPNIKRGQFSEDEVDLIIRLHKLLGNRWSLIAGRLSGRTANDVKNYWNSNQRKKVISSTDEVRSKPEAKSITRDNIIKPRPWKFRNLFWLGGKSTPLINVGSQHGNDLCKPCYSTVSPPSDINEVLSLWWESSLDDKEINQTINSSCLGSAGSAAAAYLESNESHLVENNEPGGIKTGDVFYEQAGQNCWSDISLDADLWNLINAELDQQQPEKDFIL
[0064] Using the cDNA of Populus tomentosa as a template, the MYB113 gene was amplified according to the PCR reaction system in Table 1 to obtain the CDS sequence of the Populus tomentosa MYB113 gene. The 50 μL reaction system is shown in Table 2.
[0065] Table 1 PCR reaction system
[0066] F-Primer (10μM) 1μL R-Primer (10μM) 1μL Template DNA 2μL <![CDATA[ddH2O]]> 24μL
[0067] Table 2 PCR reaction procedures
[0068]
[0069] After the PCR reaction, the PtoMYB113 gene sequence was obtained by 1% agarose gel electrophoresis and recovered using a gel recovery kit (Tiangen Biotech Co., Ltd.).
[0070] Example 2
[0071] 1. Obtaining the MYB113-pBI121 overexpressing plant
[0072] To identify the function of PtoMYB113 in Populus tomentosa in detail, primers OE-MYB113-F / R were designed and synthesized by BGI Genomics Co., Ltd. The full-length CDS sequence of the amplified PtoMYB113 gene was ligated into the plant expression vector pBI121 to construct the overexpression vector. PtoMYB113 and the expression vector pBI121 were digested with two restriction endonucleases, BamHI and EcoRI, in 50 μL solutions, as shown in Table 3.
[0073] OE-MYB113-F (BamHI): 5'-CGGGATCC ATGGTAGGCTCATTAGGAGTAAG-3', as shown in SEQ IDNO.3;
[0074] OE-MYB113-R(EcoRⅠ): 5'-GGAATTC TTATAGAATAAAGTCCTTCTCAGGTT-3', shown in SEQ IDNO.4.
[0075] Table 3 Enzyme digestion system
[0076] SacⅠ 2μL BamHⅠ 2μL plasmid / target fragment 20μL <![CDATA[ddH2O]]> 21μL
[0077] The gel was incubated at 37℃ for 1 hour and then recovered using the gel recovery method described above. The recovered linearized pBI121 was then ligated with MYB113, and the 10 μL ligation system is shown in Table 4.
[0078] Table 4 Connection System
[0079] T4 DNA Ligase 1μL Enzyme digestion vector 3μL Enzyme digestion of the target fragment 5μL
[0080] The mixture was gently blown and stirred with a pipette tip until homogeneous, and then ligated at 16°C for 3 hours. After ligation, it was directly transformed into *E. coli* DH5α, and positive strains were identified by PCR and sequenced to verify the correctness. The MYB113-pBI121 vector was obtained.
[0081] 2. Transformation of Agrobacterium tumefaciens EHA105 with MYB113-pBI121 vector
[0082] The MYB113-pBI121 vector plasmid was transformed into Agrobacterium tumefaciens EHA105. Pre-prepared competent Agrobacterium tumefaciens EHA105 cells were removed from the cryostat, and 2 μL of purified recombinant plasmid DNA was thawed on ice and transferred into 100 ml of competent Agrobacterium tumefaciens cells. The cells were then incubated on ice for 40 min. After the ice bath, the competent Agrobacterium tumefaciens cells containing the recombinant DNA plasmid were flash-frozen in liquid nitrogen for 1 min. After flash freezing, the cells were immediately incubated in a 37°C water bath for 5 min. After incubation, 800 μL of SOC medium was added to EP tubes, and the cells were incubated at 28°C and 200 rpm on a shaker for 3 h. The cells were centrifuged at 5000 rpm for 4 min, and the supernatant was discarded to 100 μL in a clean bench. The resuspended cells were then plated onto LB solid selection medium. The cells were incubated upside down in a 28°C incubator for 2 days.
[0083] Colony PCR identification: The positive Agrobacterium culture containing recombinant plasmid DNA was inoculated into LB liquid medium containing rifampicin and kanamycin and incubated at 28°C and 200 rpm on a constant temperature shaker for 1-2 days until the culture turned orange-yellow. The culture was then stored.
[0084] Example 3
[0085] 1. Obtaining and identifying transgenic Populus tomentosa
[0086] (1) Obtaining transgenic Populus tomentosa by overexpression
[0087] The Agrobacterium tumefaciens culture containing recombinant plasmid DNA was re-inoculated into LB liquid medium containing rifampicin and antibiotics, and acetylsyringone AS (100 μmol / mL) was added. The culture was shaken at 28°C until the culture turned orange-yellow. 10 mL of the culture was centrifuged at 6000 rpm for 4 min and used for genetic transformation of Populus tomentosa.
[0088] Inside a clean bench, discard the supernatant from the centrifuged Agrobacterium and resuspend it in 5 mL of WPM inoculation buffer (pre-added with 100 μmol / mL As). Cut the tender tips of sterile wild-type seedlings into small square pieces in WPM inoculation buffer. Add 3 mL of Agrobacterium resuspension and inoculate for 10 min. After inoculation, use tweezers to remove the small leaf squares to sterile filter paper and blot dry. Carefully remove the leaf pieces from the filter paper and place them on a co-culture medium (WPM medium + 1 mg / L NAA + 2 mg / L ZT), then seal with plastic wrap.
[0089] The leaf pieces were cultured in WPM co-culture medium at 25°C in the dark for two days. After two days of dark co-culture, the leaf pieces were transferred to WPM induction medium (WPM medium + 1 mg / L NAA + 2 mg / L ZT + 25 mg / L kana + 200 mg / L LTMT) and cultured in the dark at 25°C for one week. The leaf pieces from which callus tissue was induced were transferred to WPM differentiation medium (WPM medium + 1.5 mg / L ZT + 25 mg / L kana + 200 mg / L LTMT) and cultured under light. The medium was changed every week. After two weeks of culture, the callus tissue was transferred to culture bottles, with four callus tissues per bottle, and the medium was changed every two weeks. When the adventitious shoots differentiated from the callus tissue reached 1-2 cm in length, the shoots were cut off from the callus tissue with sterile scissors, and excess leaves were removed. The adventitious shoots were then vertically inserted into the rooting medium. Rooting culture until seedlings reach approximately 10 cm in length and have a well-developed root system takes about 35 days. Positive identification of the transgenic poplar seedlings is then performed. High-expression positive seedlings are selected for propagation, following the same steps as the tissue culture method described above. The rooted positive seedlings are carefully removed from the culture flasks using tweezers, and the root culture medium is washed off with clean water. The seedlings are then transplanted into small black pots filled with vermiculite. The seedlings are kept at 25℃, with a light exposure of 16 hours and a photosynthetic limiting radiation of 130 μmol / m³. -2 ·s -1 Cultivate under suitable growth conditions. Replace half of the Hogland nutrient solution every week.
[0090] (2) Identification of transgenic Populus tomentosa overexpressed
[0091] Fresh plant tissues were flash-frozen in liquid nitrogen and then ground into fractions using a mortar and pestle within the liquid nitrogen. A polysaccharide and polyphenol total RNA extraction kit (BSC65S1B, BIOER) was used. Specific steps are detailed in the kit instructions. After extraction, RNA concentration and purity were measured using a microporous spectrophotometer, and RNA degradation was detected by electrophoresis.
[0092] RNA reverse transcription was performed using the TransScript All-in-One First-Strand cDNA Synthesis Super Mix for qPCR kit; detailed instructions are provided in the product manual. The cDNA obtained from reverse transcription was stored at -20°C.
[0093] Specific quantitative primers were designed, and the Perfect Start Green qPCR Super Mix real-time PCR kit was used. Poplar cDNA was used as a template, and the expression level of the MYB113 gene was detected according to the instructions. Overexpression lines L21 and L24 were obtained. Figure 3 As shown.
[0094] The 10 μL reaction system is shown in Table 5:
[0095] Table 5 10 μL reaction system
[0096]
[0097] The reaction procedure is shown in Table 6:
[0098] Table 6 Reaction Procedure
[0099]
[0100]
[0101] 2. Phenotypic analysis of Populus tomentosa overexpression PtoMYB113
[0102] Comparison of growth and color phenotypes of transgenic lines: Compared with WT, the leaves of MYB113 overexpression materials were significantly redder, growth was inhibited, and anthocyanin content measurements showed a significant increase in total anthocyanin content in MYB113 overexpression materials. Figure 4 As shown.
[0103] The growth of transgenic materials was observed and analyzed: compared with WT, the plant height and stem diameter of the MYB113 overexpression material were reduced, such as Figure 4 As shown.
[0104] 3. Analysis of the effect of PtoMYB113 overexpression on the anthocyanin synthesis gene of Populus tomentosa
[0105] Quantitative analysis of genes related to the flavonoid synthesis pathway after PtoMYB113 overexpression revealed that the expression levels of most genes related to the flavonoid synthesis pathway were upregulated after PtoMYB113 overexpression, with PtoDFR1 and PtoDFR2 showing an upregulation of more than 50-fold. Figure 5 As shown.
[0106] In summary, this study used a transgenic approach to integrate the MYB113 gene into the genome of Populus tomentosa, altering the plant height, stem diameter, and anthocyanin accumulation. This resulted in a purple-leaved Populus tomentosa phenotype, providing a new option for urban botanical gardens.
[0107] It should be noted that when numerical ranges are mentioned in the claims of this invention, it should be understood that the two endpoints of each numerical range and any value between the two endpoints can be selected. To avoid redundancy, the present invention describes preferred embodiments.
[0108] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including both the preferred embodiments and all changes and modifications falling within the scope of the invention.
[0109] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.
Claims
1. A kind PtoMYB113 The application of genes in the breeding of Populus tomentosa is characterized by, The PtoMYB113 The nucleotide sequence of the gene is shown in SEQ ID NO.1, and it is obtained through overexpression. PtoMYB113 To obtain dwarfed Populus tomentosa.
2. The application according to claim 1, characterized in that, The breeding process of Populus tomentosa includes the following steps: Amplification PtoMYB113 Gene; The amplified PtoMYB113 The full-length CDS sequence of the gene is ligated into an expression vector to obtain an overexpression vector; The overexpression vector was transformed into Agrobacterium competent cells, and the resulting Agrobacterium competent cells containing the overexpression vector were used to infect plants and cultured to obtain transgenic Populus tomentosa plants.
3. The application according to claim 2, characterized in that, Amplification PtoMYB113 The primer pairs for the gene are: OE-MYB113-F: 5'-CGGGATCC ATGGTAGGCTCATTAGGAGTAAG-3'; OE-MYB113-R: 5'-GGAATTCTTATAGAATAAAGTCCTTTCCAGGTT-3'.
4. The application according to claim 2, characterized in that, Amplification PtoMYB113 The PCR reaction program used for the gene was as follows: 98 °C pre-denaturation for 3 min, 98 °C denaturation for 15 sec, 58 °C annealing for 15 sec, 72 °C extension for 10 sec, 34 cycles, and 72 °C complete extension for 5 min.
5. The application according to claim 2, characterized in that, The expression vector is pBI121.
Citation Information
Patent Citations
Transgenic plants for enhancing anthocyanin biosynthesis
US20170211079A1