ecDNA amplification inhibiting drugs and ecDNA marker applications
By using shRNA and DDR signaling pathway inhibitors in colorectal cancer cells to target genes such as LIG3, TOP2B, and MDC1, the problem of reducing the amount of ecDNA was solved, resulting in a reduction in the amount of ecDNA and the copy number of oncogenes in tumor cells, thus improving the sensitivity and efficacy of tumor treatment.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- SHENZHEN INST OF ADVANCED TECH CHINESE ACAD OF SCI
- Filing Date
- 2024-02-05
- Publication Date
- 2026-07-21
AI Technical Summary
The lack of effective methods or reagents in the current technology to eliminate or reduce the amount of ecDNA in tumor cells leads to high heterogeneity and drug resistance in malignant tumors such as colorectal cancer.
shRNA was used to inhibit genes such as LIG3, TOP2B, and MDC1, and combined with DDR signaling pathway inhibitors such as ATM and CHK2 inhibitors. The shRNA was introduced into colorectal cancer cells through vectors such as plasmids and lentiviruses to silence target genes and reduce the amount of ecDNA and the copy number of oncogenes.
It significantly reduces the amount of ecDNA and the copy number of oncogenes in tumor cells, lowers DDR levels, improves sensitivity to tumor cells, and reduces tumor heterogeneity and drug resistance.
Smart Images

Figure CN118141827B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to an ecDNA amplification inhibitory drug and the application of an ecDNA biomarker. Background Technology
[0002] Malignant tumors are one of the major threats to human health and quality of life. Among malignant tumors, colorectal cancer (CRC) is a common digestive system malignancy, with its incidence and mortality rates increasing year by year, and patients exhibiting high rates of recurrence and drug resistance. Although modern diagnostic and treatment technologies for colorectal cancer have made significant progress, comprehensive treatment of colorectal cancer still faces enormous challenges, especially given the heterogeneity within the cancer, which contributes to recurrence and drug resistance in clinical practice. One reason for the high heterogeneity of colorectal cancer is chromosomal instability. Treatment and drug development targeting chromosomal instability in colorectal cancer hold broad application prospects. Furthermore, early screening and real-time monitoring during the development and progression of colorectal cancer play a crucial role in prolonging overall survival.
[0003] Chromosomal instability in tumor cells is caused by abnormal events such as chromosome breakage, homologous recombination, and non-homologous end recombination. Studies have shown that chromosomal instability, leading to high tumor heterogeneity and drug resistance, is primarily caused by the amplification of oncogenes, with extrachromosomal circular DNA (ecDNA) being the main pathway for chromosomal instability and oncogene copy number amplification. ecDNA was discovered in 1965 using microscopic imaging techniques and described as a "double-minute chromatin body" in the cell nucleus. Recent research has found that ecDNA is ubiquitous in tumor cells, carrying proto-oncogenes, often in the form of tens or even hundreds of copies. It produces a large number of oncogene transcripts and constitutes the true mechanism and adaptive reservoir for proto-oncogene amplification, providing a competitive advantage in response to selective pressures in the tumor microenvironment and cytotoxic therapeutic agents. Due to the unequal distribution and rapid fluctuations of ecDNA in tumors, it can drive tumor evolution and is closely related to tumor occurrence and development.
[0004] Current research on ecDNA mainly focuses on its role in tumor promotion, heterogeneity, and drug resistance mechanisms. However, specific and well-defined methods or reagents for eliminating or reducing ecDNA in tumor cells are still lacking. Therefore, in clinical applications, identifying highly sensitive and specific biomarkers targeting ecDNA, as well as novel targets for tumor immunotherapy, is of significant clinical value for cancer treatment. Summary of the Invention
[0005] The purpose of this invention is to provide an ecDNA amplification inhibitor, which addresses the shortcomings of existing drugs that lack the ability to eliminate or reduce the amount of ecDNA.
[0006] An ecDNA amplification inhibitory drug comprises the following active ingredient: shRNA; said shRNA is an shRNA that has an inhibitory effect on the expression of one or more of LIG3, TOP2B and MDC1.
[0007] In this invention, the shRNA includes one or more of shTOP2B, shLIG3, and shMDC1;
[0008] The upstream sequence of shLIG3 is shown in SEQ ID NO.3, and the downstream sequence is shown in SEQ ID NO.4;
[0009] The upstream sequence of shTOP2B is shown in SEQ ID NO.5, and the downstream sequence is shown in SEQ ID NO.6;
[0010] The upstream sequence of shMDC1 is shown in SEQ ID NO.7, and the downstream sequence is shown in SEQ ID NO.8.
[0011] Furthermore, the target protein of shLIG3 is LIG3; the target protein of shTOP2B is TOP2B; and the target protein of shMDC1 is MDC1.
[0012] The present invention also includes a DDR signaling pathway inhibitor, which includes an ATM inhibitor or a CHK2 inhibitor.
[0013] Furthermore, the ATM inhibitor is KU55933; the CHK2 inhibitor is AZD7762.
[0014] In this invention, the ecDNA amplification inhibitory drug further includes a vector for loading the active ingredient, the vector comprising one of plasmids, lentiviruses, cell lines, liposomes, and lipid vesicles.
[0015] Furthermore, the plasmid is pLKO.1-Puro plasmid.
[0016] In some embodiments of the present invention, the cell line is a colorectal cancer cell line.
[0017] In some embodiments of the present invention, the ecDNA amplification inhibitor is loaded onto a colorectal cancer cell line via shRNA to obtain a colorectal cancer cell line that silences the target gene.
[0018] Furthermore, the colon cancer cell line with the silenced target gene is obtained through the following steps:
[0019] S1. The recombinant shRNA interference vector and packaging plasmid were co-transfected into HEK293T cells, cultured in complete culture medium, and the supernatant was collected.
[0020] S2. Centrifuge the collected supernatant, discard the supernatant, resuspend to obtain lentivirus particles, transfect into the Colo320DM colorectal cancer cell line, culture and screen, and then amplify to obtain a colorectal cancer cell line with silenced target gene.
[0021] In this invention, the recombinant shRNA interference vector is obtained by the following method: synthesizing a single-stranded primer for shRNA and carrying an enzyme restriction site sequence at the 5' end, then annealing and pairing to generate a double strand; double digesting the pLKO.1-Puro vector plasmid with Agel and EcoRI; and ligating the annealed double-stranded fragment with the double-digested vector plasmid to obtain the recombinant shRNA interference vector.
[0022] Furthermore, the packaging plasmid is a mixture of psPAX2 and pMD2.G.
[0023] In this invention, puromycin is added to the culture medium used for culture and screening.
[0024] The application of an ecDNA marker in the preparation of antitumor drugs or ecDNA diagnostic reagent products, wherein the ecDNA marker is one or more of LIG3, TOP2B and MDC1.
[0025] In this invention, the ecDNA marker also includes a phosphorylated histone 2A variant.
[0026] Furthermore, the phosphorylated histone 2A variant is γH2AX.
[0027] In this invention, the tumor is a tumor whose tumor cells contain ecDNA.
[0028] Furthermore, the tumors include colorectal cancer, glioma, melanoma, gastric cancer, and prostate cancer.
[0029] In this invention, the ecDNA contains an oncogene, which is the MYC oncogene.
[0030] In this invention, the ecDNA diagnostic reagent product is a detection kit.
[0031] The present invention has the following beneficial effects:
[0032] (1) The ecDNA amplification inhibitor of the present invention reduces the amount of ecDNA in tumor cells and the copy number of oncogenes on ecDNA by inhibiting the expression of shRNA of LIG3, TOP2B and MDC1, and has high sensitivity.
[0033] (2) The shLIG3, shTOP2B, and shMDC1 vectors in the ecDNA amplification inhibitor of this invention are stably expressed in the Colo320 DM colorectal cancer cell line and can stably knock down the expression of the corresponding target proteins LIG3, TOP2B, and MDC1 in the cell line. Knockdown of LIG3, TOP2B, or MDC1 significantly converts ecDNA to HSR in the cell line and also leads to a decrease in the intracellular DDR level of ecDNA. This indicates that LIG3, TOP2B, or MDC1 are associated with ecDNA amplification / replication in the cell line, and that ecDNA amplification / replication is coupled with the intracellular DDR signaling pathway. Therefore, shLIG3, shTOP2B, or shMDC1 can be used to prepare inhibitors of tumor cell heterogeneity or drug resistance. Attached Figure Description
[0034] The technical solution of the present invention will be further described below with reference to the accompanying drawings and specific embodiments.
[0035] Figure 1 This is the pLKO.1 plasmid map;
[0036] Figure 2 Western blot analysis was performed to detect the knockdown of TOP2B, MDC1, and LIG3 proteins by shRNA.
[0037] Figure 3 This is a FISH result diagram of the shNC / shLIG3 of this invention;
[0038] Figure 4 This is a FISH result diagram of the shNC / shTOP2B of the present invention;
[0039] Figure 5 This is a FISH result diagram of the shNC / shMDC1 of the present invention;
[0040] Figure 6 This is a statistical diagram of the number of ecDNA in shNC, shLIG3, shTOP2B and shMDC1 cells of the present invention.
[0041] Figure 7 The changes in MYC gene copy number in shNC, shLIG3, shTOP2B, and shMDC1 cells;
[0042] Figure 8This study investigated the activation of the DDR signaling pathway mediated by ATM in cells containing ecDNA, including: a. IF detection of γH2AX fluorescence signals in ecDNA+ and ecDNA- cells; b. quantitative analysis and statistical analysis of γH2AX signal in Colo 320 cells (γH2AXfoci>5); and c. Western blot analysis of the DDR signaling pathway in Colo 320 cells.
[0043] Figure 9 The analysis used IF and FISH to determine the co-localization of ecDNA and γH2AX.
[0044] Figure 10 This study investigated the ATM-mediated DDR signaling pathway, including: a) treating Colo 320DM cells in the mid-stage with KU55933 (ATMi), AZD7762 (CHK2i), and DMSO (Control), respectively, and observing changes in ecDNA using FISH; b) adding KU55933 (ATMi) and AZD7762 (CHK2i) inhibitors, and detecting the sensitivity of Colo 320HSR and Colo 320DM cells to the drugs using CCK8 assay. Detailed Implementation
[0045] This invention is based on the Colo 320DM colorectal cancer cell line containing ecDNA. Short hairpin RNA (shRNA) was stably transfected into Colo 320DM cells, and stably transfected cell lines were screened. The results showed that the number of ecDNA in Colo 320DM cells treated with shRNA was significantly reduced, while the number of HSRs integrated into the chromosome increased, and the copy number of the oncogene MYC carried on the ecDNA was significantly reduced. Simultaneously, the inventors discovered that ecDNA replication and maintenance are closely related to the genomic DNA damage response (DDR), and for the first time proposed the existence of phosphorylated histone 2A variants (γH2AX) on ecDNA. This opens up a new avenue for inhibiting ecDNA copy number in colorectal cancer cells and lays the foundation for further research into drugs targeting the heterogeneity and drug resistance of colorectal cancer cells.
[0046] Instruments, reagents and materials
[0047] 1. Instruments
[0048] Cell counter (Nexcelom, Bioscience), ultracentrifuge (Beckman), biosafety cabinet (ESCO), electroporator (Thermo Scientific), fluorescence microscope (Thermo Scientific), confocal microscope (Nikon), constant temperature water bath (Shanghai Yiheng Technology Co., Ltd.), electroporation cuvette (Celetrix), electrophoresis apparatus (Bio-rad), floor-standing low-temperature centrifuge (Eppendorf), protein transfer apparatus (Novizan), glass slides (Jiangsu Shitai), coverslips (Jiangsu Shitai), pipette (Eppendorf).
[0049] 2. Reagents and Materials
[0050] pLKO.1-puro vector (Addgene), psPAX2 vector (Addgene), pMD2.G vector (Addgene), 20×SSC (Beyotime), formamide (Beyotime), formic acid (Shanghai Lingfeng Chemical Reagent Co., Ltd.), glacial acetic acid (Shanghai Lingfeng Chemical Reagent Co., Ltd.), anhydrous ethanol (Shanghai Lingfeng Chemical Reagent Co., Ltd.), KCl (Sigma), DAPI (Beyotime), CEN8 / MYC FISH probe (MetaSystems), DH5α competent cells (Qingke Biotechnology), T4 DNA ligase (TaKaRa), endotoxin-free plasmid extraction kit (Tiangen Biotech Co., Ltd.), DMEM medium (Pronos), 1640 medium (Pronos), Excell Bio fetal bovine serum (Ruixin Biotechnology), trypsin (Gibco), colchicine (MCE), OptiMEM medium (Gibco), penicillin-streptomycin solution (100×) (Gibco), chemiluminescence solution (Beyotime), HRP-labeled goat anti-rabbit IgG (Beyotime), HRP-labeled goat anti-mouse IgG (Beyotime), primary antibody dilution solution (Beyotime), restriction endonuclease EcoRI (NEB), restriction endonuclease AgeI (NEB), 20×SSC (Beyotime).
[0051] HEK293T cells were preserved by the Shenzhen Institutes of Advanced Technology, Chinese Academy of Sciences, while human colorectal cancer cell lines Colo 320DM and Colo 320HSR were purchased from ATCC (American Type Culture Collection).
[0052] Example 1
[0053] 1.1 Construction of shLIG3 lentiviral vector
[0054] Using the pLKO.1 vector (Sigma-Aldrich, SHC001), the plasmid map is as follows: Figure 1As shown, this serves as the backbone for constructing shLIG3. The shRNA sequence targeting the LIG3 gene was designed using the BLOCK-iT™ RNAiDesigner on the ThermoFisher website.
[0055] The upstream sequence of shNC is:
[0056] 5'CCGGCGACGTAAACGGCCACAAGTTCTCGAGAACTTGTGGCCGTTTACGTCGTTTTTG 3'(SEQID NO.1)
[0057] The downstream sequence of shNC is:
[0058] 5'AATTCAAAAACGACGTAAACGGCCACAAGTTCTCGAGAACTTGTGGCCGTTTACGTCG 3'(SEQID NO.2)
[0059] The upstream sequence of shLIG3 is:
[0060] 5'CCGGGCCTCATTTGTCACCAGTACCCTCGAGGGTACTGGTGACAAATGAGGCTTTTTG 3'(SEQID NO.3)
[0061] The downstream sequence of shLIG3 is:
[0062] 5'AATTCAAAAAGCCTCATTTGTCACCAGTACCCTCGAGGGTACTGGTGACAAATGAGGC 3'(SEQID NO.4)
[0063] After double digestion of the pLKO.1 backbone vector with EcoRI and AgeI, the shRNA sequence was ligated into the backbone vector using T4 ligase to obtain a vector containing the shLIG3 sequence. This shLIG3 and empty vector were then transfected into 293T cells with the lentiviral packaging vectors psPAX2 (Addgene#12260) and pMD2.G (Addgene#12259) and packaged into lentiviruses. The supernatants were collected at 24h and 48h, respectively, and then ultracentrifuged to obtain lentiviral vectors containing shLIG3 and shNC (control group). (Note: The shRNA construction in this invention can also be performed using the piggybac vector; the specific sequence only needs to inhibit the expression of one or more genes among LIG3, TOP2B, and MDC1.)
[0064] 1.2 Screening of LIG3-knockdown Colo 320DM cell lines
[0065] After infecting Colo 320DM cells with the obtained shLIG3 and shNC lentiviral vectors, Colo 320DM cell lines carrying shLIG3 could be screened using puromycin, as the vectors carried the antibiotic. After treating the Colo 320DM cell lines with 5 μg / ml puromycin for 5 days, the treated cells were collected, proteins were extracted and subjected to Western blot electrophoresis. After incubation with LIG3 antibody, the knockdown of LIG3 in the treated cell lines was detected. Once the knockdown of LIG3 protein in the treated Colo 320DM cell lines was confirmed, the next step was fluorescence in situ hybridization (FISH) detection.
[0066] 1.3 FISH detection of changes in ecDNA in Colo 320DM cells
[0067] After expanding the Colo 320DM cell line with knocked-down LIG3 protein, colchicine was added to the cells at a ratio of 1:1000, and shLIG3 and shNC cells were synchronized to metaphase. Following colchicine treatment, the cells were treated with 75 mM KCl solution for 30 min to induce cell swelling. The swollen cells were then fixed with a 3:1 mixture of methanol and glacial acetic acid. The fixed cells were then dropped onto a glass slide at a specific height until the chromosomes were clearly visible. After drying, the cells were sequentially immersed in ethanol at different concentrations for dehydration. Next, FISH probe hybridization solution containing the centromere of chromosome 8 and the MYC gene was diluted and pre-denatured at 80°C. After incubation overnight at 37°C in the dark, the cells were washed twice with 1×SSC (containing Tween-20) buffer, air-dried, and then added with DAPI (an anti-quenching agent) before photographing. After FISH probe labeling, the chromosome and MYC gene location can be determined under a fluorescence microscope based on the centromere and the color of the MYC gene probe, thereby identifying the location of the ecDNA carrying the MYC gene. Furthermore, the intracellular distribution of ecDNA and HSR is statistically analyzed separately.
[0068] 1.4 Immunofluorescence (IF) detection of DDR changes in Colo 320DM cells
[0069] COLO 320 cell lines were collected, washed twice with PBS, and then centrifuged onto slides. Cells were fixed with 4% paraformaldehyde for 15 minutes at room temperature. Cells were washed three times with PBS and blocked for 1 hour at room temperature with 3% BSA in 0.1% PBST (blocking solution). Next, cells were incubated overnight at 4°C with primary antibody (γH2AX, 1:200 dilution). After washing three times with PBS, cells were incubated with secondary antibody (mouse IgG-Alexa Fluor 488, 1:200) at room temperature in the dark for 1 hour, followed by washing three times with PBST. Coverslips were washed in PBS and then stained with DAP. Cell images were captured at ×100 resolution using a Nikon confocal microscope.
[0070] 1.5 Western blot analysis of ATM-DDR changes in Colo 320DM cells
[0071] Colo 320 cells were collected and lysed using RIPA protein lysis buffer to extract total cellular protein. 30 μg of each sample was mixed with protein loading buffer, boiled, and then separated by SDS-PAGE gel electrophoresis. The protein was then transferred to PVDF, blocked with 5% skim emulsion for 1 hour, and washed three times with 1×TBST for approximately 5 minutes each time. The cells were incubated overnight at 4°C with primary antibodies (γH2AX, 1:1000; tubulin, 1:2000; CHK2, 1:1000; phospho-CHK2, 1:1000; ATM, 1:1000; phospho-ATM, 1:1000; H3 at 1:3000). The cells were washed three times with TBST, then incubated with fluorescent secondary antibody (anti-rabbit HRP or anti-mouse HRP) at room temperature for 1 hour, followed by three more washes with TBST and development. Relative quantification of the band intensity in the western blot was performed using ImageJ software (v150).
[0072] 1.6 Inhibitor treatment validates ATM-DDR as an ecDNA target signaling pathway
[0073] 1×10 6 Colo 320DM and Colo 320HSR cells were seeded in 10cm plates and cultured under standard conditions for 24 hours. They were then treated with 0.2μM AZD7762 (CHK inhibitor), 5μM KU55933 (ATM inhibitor), or DMSO for approximately 24 hours before FISH assays were performed.
[0074] In the quantitative real-time PCR experiment, 1×10 5Colo 320DM and Colo 320HSR cells were seeded in 6-well plates and cultured under standard conditions for 24 hours, followed by treatment with the aforementioned inhibitor for approximately 24 hours. Aphidicolin (a DNA polymerase inhibitor) was dissolved in DMSO to a final concentration of 2 μM and treated for 20 hours. The experiment was performed in triplicate.
[0075] Example 2
[0076] 2.1 Construction of shTOP2B lentiviral vector
[0077] The shTOP2B backbone was constructed using the same method as in Example 1, and shRNA targeting the TOP2B gene was constructed.
[0078] The upstream sequence of shTOP2B is:
[0079] 5'CCGGGCAGTTCATGTGGGTGTATGACTCGAGTCATACACCCACATGAACTGCTTTTTG
[0080] 3'(SEQ ID NO.5)
[0081] The downstream sequence of shTOP2B is:
[0082] 5'AATTCAAAAAGCGTATGCCGAATTGGCAAAGCTCGAGCTTTGCCAATTCGGCATACGC 3'(SEQID NO.6)
[0083] 2.2 Screening of Colo 320DM cell lines with TOP2B knockdown
[0084] After infecting Colo 320DM cells with the shTOP2B and shNC lentiviral vectors obtained above, Colo 320DM cell lines carrying shTOP2B could be screened using puromycin, as the vectors carried the antibiotic. After treating Colo 320DM cell lines with 5 μg / ml puromycin for 5 days, the treated cells were collected, proteins were extracted and subjected to Western blot electrophoresis. After incubation with TOP2B antibody, the knockdown of TOP2B in the treated cell lines was detected. Once TOP2B protein knockdown was confirmed in the treated Colo 320DM cell lines, fluorescence in situ hybridization (FISH) was performed.
[0085] Following the same steps as in Example 1, FISH was used to detect changes in ecDNA in Colo 320DM cells, immunofluorescence (IF) was used to detect changes in DDR in Colo 320DM cells, Western blot was used to detect changes in ATM-DDR in Colo 320DM cells, and inhibitor treatment was used to verify that ATM-DDR can serve as an ecDNA target signaling pathway.
[0086] Example 3
[0087] 3.1 Construction of the shMDC1 lentivirus vector
[0088] The shMDC1 backbone was constructed using the same method as in Example 1, and shRNA targeting the MDC1 gene was constructed.
[0089] The upstream sequence of shMDC1 is:
[0090] 5'CCGGCCCTGAATCAACTGTCCCTATCTCGAGATAGGGACAGTTGATTCAGGGTTTTG
[0091] 3'(SEQ ID NO.7)
[0092] The downstream sequence of shMDC1 is:
[0093] 5'AATTCAAAAACCCTGAATCAACTGTCCCTATCTCGAGATAGGGACAGTTGATTCAGGG 3'(SEQID NO.8)
[0094] 3.2 Screening of MDC1-knockdown Colo 320DM cell lines
[0095] After infecting Colo 320DM cells with the obtained shMDC1 and shNC lentiviral vectors, Colo 320DM cell lines carrying shMDC1 could be screened using puromycin, as the vectors carried the antibiotic. After treating the Colo 320DM cell lines with 5 μg / ml puromycin for 5 days, the treated cells were collected, proteins were extracted and subjected to Western blot electrophoresis. After incubation with MDC1 antibody, the knockdown of MDC1 in the treated cell lines was detected. Once the knockdown of MDC1 protein in the treated Colo 320DM cell lines was confirmed, the next step was fluorescence in situ hybridization (FISH) detection.
[0096] Following the same steps as in Example 1, FISH was used to detect changes in ecDNA in Colo 320DM cells, immunofluorescence (IF) was used to detect changes in DDR in Colo 320DM cells, Western blot was used to detect changes in ATM-DDR in Colo 320DM cells, and inhibitor treatment was used to verify that ATM-DDR can serve as an ecDNA target signaling pathway.
[0097] Experimental results
[0098] (1) Western blot analysis showed that the shLIG3, shTOP2B, and shMDC1 proteins in the shRNA of this invention knocked down LIG3, TOP2B, and MDC1 proteins, respectively. (See [link]) Figure 2 .
[0099] (2) The intracellular distribution of ecDNA and HSR was determined by FISH assay in the colorectal cancer cell line Colo 320DM. Figure 3-5 The results clearly showed a decrease in the amount of ecDNA in the shLIG3, shTOP2B, and shMDC1 cell lines constructed with Colo 320DM. Figure 6 Simultaneously, qPCR (quantitative PCR) analysis of changes in the MYC gene copy number carried on ecDNA revealed that shRNA treatment significantly reduced the MYC gene copy number. Figure 7 .
[0100] (3) Figure 8 As shown, the results demonstrate that the γH2AX fluorescence signal is significantly enhanced in Colo 320DM cells. Figure 8 a, b), γH2AX protein levels were also significantly increased in ecDNA+ cells. Figure 8 c). Although there was no significant difference in the protein expression of total ATM and CHK2 between ecDNA+ and ecDNA- cells, the levels of phosphorylated ATM (p-ATM) and phosphorylated CHK2 (p-CHK2) were significantly increased in ecDNA+ cells. Figure 8 c) This indicates that the DDR signaling pathway in cell lines containing ecDNA is activated. The oncogene MYC is carried on the ecDNA of Colo 320DM cells. Immunofluorescence staining and fluorescence in situ hybridization (IF-FISH) revealed co-localization of MYC and γH2AX. Figure 9 This indicates that ecDNA itself also exhibits DDR activation.
[0101] (4) Since DDR is activated in cell lines containing ecDNA, this invention investigated whether DDR activation contributes to the maintenance of ecDNA in cancer cells. Therefore, Colo 320DM cells were treated with KU55933 (an ATM inhibitor) and AZD7762 (a CHK2 inhibitor), respectively, to inhibit the cellular DDR pathway. Results showed that most MYC lesions reintegrated into the chromosome to form HSR regions 5 days after treatment. The number of ecDNA lesions was significantly reduced compared to the control group. Figure 10 a). Drug resistance assays using CCK8 cell proliferation assays showed that Colo 320DM cells containing ecDNA were more sensitive to drugs targeting ATM and CHK2. Figure 10 (b) In summary, the ATM-mediated DDR signaling pathway in ecDNA cells can serve as a detection target in tumor cell therapy. By inhibiting the maintenance of ecDNA through DDR pathway ATM and CHK2 inhibitors, the amplification of oncogenes carried by ecDNA can be reduced or treated, thereby improving the therapeutic effect of cancer and providing an important reference for clinical diagnosis and treatment plans.
[0102] This invention focuses on the interaction between intracellular proteins and ecDNA. By screening multiple proteins that interact with ecDNA, it was discovered that the presence of ecDNA is associated with the DDR signaling pathway. Furthermore, by knocking down the enriched proteins, the amount of ecDNA and the copy number of oncogenes in tumor cells were reduced. Simultaneously, the intracellular DDR levels were also attenuated, indicating that the DDR signaling pathway within ecDNA can be targeted. This allows for the development of inhibitors and targeted drugs for the enriched proteins or the DDR signaling pathway in clinical research, enabling precise treatment of cancers containing ecDNA.
[0103] The above description discloses only preferred embodiments of the present invention and should not be construed as limiting the scope of the present invention. Therefore, equivalent variations made in accordance with the claims of the present invention are still within the scope of the present invention.
Claims
1. An shRNA, characterized in that, The shRNA is an shRNA that has an inhibitory effect on the expression of one or more of LIG3, TOP2B and MDC1; The shRNA includes one or more of shTOP2B, shLIG3, and shMDC1; The upstream sequence of shLIG3 is shown in SEQ ID NO.3, and the downstream sequence is shown in SEQ ID NO.4; The upstream sequence of shTOP2B is shown in SEQ ID NO.5, and the downstream sequence is shown in SEQ ID NO.6; The upstream sequence of shMDC1 is shown in SEQ ID NO.7, and the downstream sequence is shown in SEQ ID NO.
8.
2. The use of the shRNA as described in claim 1 in the preparation of a drug for treating colorectal cancer.