A method for improving immune response cell function

CN118146379BActive Publication Date: 2025-09-09CARSGEN LIFE SCI CO LTD
View PDF 11 Cites 0 Cited by

Patent Information

Application Number
CN202410383209.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2016-12-13
Filing Date
2017-04-26
Publication Date
2025-09-09
Estimated Expiration
2037-04-26

AI Technical Summary

Technical Problem

Existing CAR-T cell therapy is not effective in treating leukemia and solid tumors, and systemic administration of type I interferon has serious toxic side effects, which limits its application.

Method used

An immune response cell is designed that expresses an antigen-binding receptor and exogenous type I interferon, which is expressed through a viral vector such as a lentiviral vector and releases type I interferon upon activation to enhance the anti-tumor activity of the immune response cell.

Benefits of technology

It significantly improves the anti-tumor activity of immune response cells, increases the number of cytotoxic T cells and helper T cells, effectively reduces or eliminates tumor volume, and reduces toxic side effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0004770039190000261
    Figure BDA0004770039190000261
  • Figure BDA0004770039190000552
    Figure BDA0004770039190000552
  • Figure BDA0004770039190000561
    Figure BDA0004770039190000561
Patent Text Reader

Abstract

The present invention relates to a method for improving the function of immune response cells. The present invention discloses an immune response cell that expresses at least one antigen-binding receptor and type I interferon. The immune response cell is used to treat tumors, infectious diseases, and other diseases, and exhibits significantly superior tumor or pathogen killing capabilities.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] This application is a divisional application of the invention patent application "A method for improving the function of immune response cells" with application number 2017800217918 and application date of April 26, 2017. Technical Field

[0002] The present invention belongs to the field of immunology, and more particularly, relates to a method for improving the function of immune response cells. Background Art

[0003] Chimeric antigen receptors (CARs) are artificial recombinant receptors that typically contain the antigen recognition domain of a monoclonal antibody located in the extracellular region, a transmembrane region, and an intracellular activation signaling domain for immune response cells. In recent years, clinical trials using CAR-modified T cells (CAR-T) targeting CD19 have achieved great success in the treatment of B-cell leukemia. However, many leukemia patients experience relapse. Furthermore, CAR-T cell therapy is not very effective for all hematologic malignancies. Furthermore, CAR-T cell therapy for solid tumors is also less effective. Therefore, improving existing CAR-T cell technology and increasing its anti-tumor activity remains crucial.

[0004] Type I interferons were discovered over half a century ago. They include IFNα (a class of proteins encoded by 13 human genes, from IFNA1 to IFNA13), IFNβ (encoded by a single human and mouse gene, IFNB1), and lesser-studied interferons such as IFNε, IFNκ, and IFNω (2. Trinchieri, G. Type I interferon: friend or foe? J. Exp. Med. 207, 2053-2063 (2010); 3. Kaur, S. & Platanias, LCIFN-β-specific signaling via a unique IFNAR1 interaction. Nat. Immunol. 14, 884-885 (2013)). Type I interferons are produced by various cell types upon activation of pattern recognition receptors (PRRs). PRRs respond to viral or bacterial components and ectopic endogenous molecules (such as cytoplasmic DNA and extracellular DNA and RNA) (Kawai, T. & Akira, S. The role of pattern-recognition receptors in innate immunity: update on Toll-like receptors. Nat. Immunol. 11Type I interferons signal through either the homodimeric IFNα / β receptor 1 (IFNAR1), which has a particularly high affinity for IFNβ, or the IFNAR1-IFNAR2 heterodimer, which binds all type I interferons. Activation of these receptors leads to upregulation of transcription of IFN-stimulated genes (ISGs), triggering many immunostimulatory effects (Hervas-Stubbs, S. et al. Direct effects of type I interferons on cells of the immune system. Clin. Cancer Res. 17, 2619er Res. es. mmde Weerd, NA et al. Structural basis of a unique interferon-β signaling axis mediated via the receptor IFNAR1. Nat. Immunol. 14, 901ol. nol. is oMcNab, F., Mayer-Barber, K., Sher, A., Wack, A. & O A. &, A. Type I interferons in infectious disease. Nat. Rev. Immunol. 15, 87nol. Immun). Studies have shown that type I interferons have anti-cancer effects on some tumors, which may be attributed to their immunostimulatory function. However, systemic administration of type I interferon may cause immunosuppression (Lotrich, FEMajor depression during interferon-α treatment: vulnerability and prevention. Dialogues Clin. Neurosci. 11, 417-425 (2009)), and is accompanied by major adverse events, the most common of which are fatigue, anorexia, hepatotoxicity, flu-like symptoms and severe depression (Kreutzer, K., Bonnekoh, B., Franke, I., Ulrich, J. & Gollnick, H. Sarcoidosis, myasthenia gravis and anteriorischaemic optic neuropathy: severe side effects of adjuvant interferon-α therapy in malignant melanoma?. J. Dtsch. Dermatol. Ges. 2, 689-694 (in German) (2004)). Such serious side effects seriously limit its application. Summary of the Invention

[0005] The present invention overcomes the aforementioned problems and provides additional advantages.

[0006] 1. An immune response cell expressing a receptor that binds an antigen; and exogenous type I interferon.

[0007] 2. The immune response cells according to item 1, wherein the immune response cells include: T cells, natural killer cells, cytotoxic T lymphocytes, natural killer T cells, DNT cells, and / or regulatory T cells.

[0008] 3. The immune response cell according to any one of the preceding items, wherein the antigen is a tumor antigen or a pathogen antigen.

[0009] 4. The immune response cell according to any of the preceding items, wherein the exogenous type I interferon is constitutively expressed or inducibly expressed; preferably, the promoter used to express the type I interferon includes: an immune cell inducible promoter; preferably, the immune cell inducible promoter is the NFAT6 promoter.

[0010] 5. The immune response cell according to any one of the preceding items, which expresses an endogenous or recombinant antigen-binding receptor; preferably, the antigen-binding receptor comprises sequentially linked: an antibody that specifically binds to the antigen, a transmembrane region, and an intracellular signaling region.

[0011] 6. The immune response cell as described in any of the preceding items, wherein the intracellular signaling region of the immune response cell contains a T cell stimulatory signal molecule or a combination of a T cell stimulatory signal molecule and a T cell activation co-stimulatory molecule; preferably, the T cell stimulatory signal molecule is selected from: CD3ζ or FcεRIγ; more preferably, CD3ζ; or the T cell activation co-stimulatory molecule is selected from: the intracellular signaling region of CD27, CD28, CD137, CD134, ICOS protein, or a combination thereof.

[0012] 7. The immune response cell according to any one of the preceding items, wherein the amino acid sequence of the antigen-binding receptor is at least 90% identical to one of the following sequences:

[0013] SEQ ID NO:49; SEQ ID NO:50; SEQ ID NO:51; SEQ ID NO:54; SEQ ID NO:55; SEQ ID NO:56; SEQ ID NO:61; SEQ ID NO:62; SEQ ID NO:63; SEQ ID NO:64; SEQ ID NO:65; SEQ ID NO:66; SEQ ID NO:67; SEQ ID NO:68; SEQ ID SEQ ID NO:70; SEQ ID NO:71; SEQ ID NO:72; SEQ ID NO:73; SEQ ID NO:74; SEQ ID NO:75; and SEQ ID NO:77.

[0014] 8. The immune response cell of item 7, wherein the receptor that specifically binds to the antigen and the exogenous type I interferon are encoded by a nucleotide sequence that is at least 90% identical to SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60 or SEQ ID NO: 76.

[0015] 9. The immune response cell according to any one of the preceding items, which does not contain exogenous co-stimulatory ligands.

[0016] 10. The immune response cell according to any one of the preceding items, wherein the type I interferon comprises: IFNα or IFNβ.

[0017] 11. The immune response cell according to any one of the preceding items, wherein the antigen-binding receptor and / or type I interferon are constitutively or inducibly expressed on the surface of the immune response cell.

[0018] 12. The immune response cell according to any one of the preceding items, comprising an expression construct comprising: an expression cassette for the antigen-binding receptor; and an expression cassette for the type I interferon.

[0019] 13. The immune response cell according to any of the preceding items, wherein the antigen-binding receptor and / or type I interferon are expressed using a viral vector; preferably, the viral vector is a retroviral vector; more preferably, the viral vector comprises: a lentiviral vector, a retroviral vector or an adenoviral vector.

[0020] 14. The immune response cell of any one of the preceding items, wherein the antigen-binding receptor recognizes and binds to pathogenic microorganisms.

[0021] 15. The immune response cell of claim 14, wherein the pathogenic microorganism comprises a virus, a bacterium, a fungus, a protozoa or a parasite; more preferably, the pathogenic microorganism is a virus; or more preferably, the pathogenic microorganism is selected from cytomegalovirus, Epstein-Barr virus, human immunodeficiency virus and influenza virus.

[0022] 16. The immune response cell according to any of the preceding items, wherein the antigens include: prostate-specific membrane antigen (PSMA), carcinoembryonic antigen (CEA), IL13Ralpha, HER-2, CD19, NY-ESO-1, HIV-1 Gag, Lewis Y, MART-1, gp100, tyrosinase, WT-I, hTERT, mesothelin, EGFR, EGFRvIII, glypican 3, EphA2, HER3, EpCAM, MUC1, MUC16, CLDN18.2, folate receptor, CLDN6, CD30, CD138, ASGPR1, CDH16, GD2, 5T4, 8H9, αvβ6 integrin, B cell maturation antigen (BCMA), B7-H3, B7-H6, CAIX, CA9, CD20, CD22, kappa light chain (kappa light chain), CD33, CD38, CD44, CD44v6, CD44v7 / 8, CD70, CD123, CD171, CSPG4, EGP2, EGP40, ERBB3, ERBB4, ErbB3 / 4, FAP, FAR, FBP, embryonic AchR, GD2, GD3, HLA-AI MAGE A1, MAGE3, HLA-A2, IL11Ra, KDR, Lambda, MCSP, NCAM, NKG2D ligand, PRAME, PSCA, PSC1, ROR1, Sp17, SURVIVIN, TAG72, TEM1, TEM8, VEGRR2, HMW-MAA, VEGF receptor, and / or fibronectin, tenascin, or oncofetal variants of tumor necrosis.

[0023] 17. An expression construct comprising sequentially linked: an expression cassette for an antigen-binding receptor; and an expression cassette for a type I interferon; wherein the antigen-binding receptor and the type I interferon are as defined in one of the preceding items.

[0024] 18. A method for increasing the viability of immune response cells administered to an individual, the immune response cells expressing the antigen-binding receptor of any one of items 1 to 16, and wherein the method comprises administering to the individual the immune response cells and an effective amount of exogenous type I interferon.

[0025] 19. The method of claim 18, wherein the exogenous type I interferon and the immune response cells expressing the antigen-binding receptor are administered sequentially or simultaneously.

[0026] 20. The method of claim 18 or 19, wherein the exogenous type I interferon is administered to the patient simultaneously with the immune response cells by co-expression in the immune response cells.

[0027] 21. The method of any one of items 18 to 20, wherein the immune response cells comprise T cells, natural killer cells, cytotoxic T lymphocytes, natural killer T cells, DNT cells, and / or regulatory T cells.

[0028] 22. A method as described in any one of items 18 to 21, wherein the method increases the sum of the number of cytotoxic T cells and helper T cells in the peripheral blood of the individual by at least 50% after administering the immune response cells to the individual compared to the absence of the exogenous type I interferon.

[0029] 23. A method as described in any one of items 18 to 22, wherein the method is such that about 5 days after the immune response cells are administered to the individual, the sum of the number of cytotoxic T cells and helper T cells in the individual's peripheral blood is greater than 15,000 / μL; about 7 days after the immune response cells are administered, the sum of the number of cytotoxic T cells and helper T cells in the individual's peripheral blood is greater than 500 / μL; or about 10 days after the immune response cells are administered, the sum of the number of cytotoxic T cells and helper T cells in the individual's peripheral blood is greater than 50 / μL.

[0030] 24. Use of the immune response cell described in any one of items 1 to 16 in the preparation of a pharmaceutical composition for treating tumors, pathogen infections, or enhancing the immune tolerance of an individual in need thereof.

[0031] 25. The use according to item 24, wherein the tumor comprises pancreatic cancer, liver cancer, lung cancer, gastric cancer, head and neck squamous cell carcinoma, prostate cancer, colon cancer, breast cancer, lymphoma, gallbladder cancer, kidney cancer, leukemia, myeloma, ovarian cancer, cervical cancer, ovarian cancer, cervical cancer or glioma; or

[0032] The pathogens include viruses, bacteria, fungi, protozoa or parasites; preferably, the viruses include cytomegalovirus, Epstein-Barr virus, human immunodeficiency virus or influenza virus.

[0033] 26. The use of item 24 or 25, wherein the medicament reduces the size of the tumor by at least 30% as measured by computed tomography.

[0034] 27. The use of item 24 or 25, wherein the drug causes complete disappearance of the tumor as measured by computed tomography.

[0035] 28. A pharmaceutical composition comprising:

[0036] The immune response cell according to any one of items 1 to 16; and

[0037] Pharmaceutically acceptable carrier or excipient.

[0038] 29. A kit comprising:

[0039] The immune response cell according to any one of items 1 to 16; and

[0040] Instructions directing how to administer the immune response cells to an individual.

[0041] According to one aspect of the present invention, the present invention provides an immune response cell, wherein the cell expresses a receptor that binds to an antigen; and exogenous type I interferon.

[0042] In some embodiments, the immune response cells of the present invention include T cells, natural killer cells, cytotoxic T lymphocytes, natural killer T cells, DNT cells, and / or regulatory T cells.

[0043] In some embodiments, the antigen-binding receptor is endogenous. In some embodiments, the antigen-binding receptor is recombinant. In some embodiments, the antigen-binding receptor is a chimeric antigen receptor. In some embodiments, the antigen-binding receptor includes an extracellular antigen binding region, a transmembrane region, and an intracellular signaling region that are sequentially connected. In some embodiments, the antigen binding unit is an antibody or fragment thereof that specifically binds to the antigen. In some embodiments, the intracellular signaling region may contain a signal motif of a known immunoreceptor tyrosine-based activation motif (ITAM). In some embodiments, the examples of the ITAM containing cytoplasmic signaling sequences include those derived from TCRζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, and CD66d.

[0044] In some embodiments, the intracellular signaling region of the antigen-binding receptor includes one or more costimulatory domains. In some embodiments, the costimulatory domain is selected from one or more of those listed in Table 1. In some embodiments, the costimulatory domain is selected from one or more of CD28, OX40, CD27, CD2, CD5, ICAM-1, LFA-1 (CD11a / CD18), 4-1BBL, MyD88, and 4-1BB. In some embodiments, the costimulatory domain is selected from two of CD28, OX40, CD27, CD2, CD5, ICAM-1, LFA-1 (CD11a / CD18), 4-1BBL, MyD88, and 4-1BB.

[0045] In some embodiments, the amino acid sequence of the antigen-binding receptor is at least 90% identical to one of SEQ ID NO:49; SEQ ID NO:50; SEQ ID NO:51; SEQ ID NO:54; SEQ ID NO:55; SEQ ID NO:56; SEQ ID NO:61; SEQ ID NO:62; SEQ ID NO:63; SEQ ID NO:64; SEQ ID NO:65; SEQ ID NO:66; SEQ ID NO:67; SEQ ID NO:68; SEQ ID NO:69; SEQ ID NO:70; SEQ ID NO:71; SEQ ID NO:72; SEQ ID NO:73; SEQ ID NO:74; SEQ ID NO:75; and SEQ ID NO:77.

[0046] In some embodiments, the antigen-binding receptor is encoded by a nucleotide sequence that is at least 90% identical to SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, or SEQ ID NO:76.

[0047] In some embodiments, the immune response cells do not contain exogenous co-stimulatory ligands.

[0048] In some embodiments, the antigen that can be bound by the antigen-binding receptor includes a tumor antigen or a pathogen antigen. In some embodiments, the tumor antigen is selected from prostate-specific membrane antigen (PSMA), carcinoembryonic antigen (CEA), IL13Ralpha, HER-2, CD19, NY-ESO-1, HIV-1 Gag, Lewis Y, MART-1, gp100, tyrosinase, WT-I, hTERT, mesothelin, EGFR, EGFRvIII, phosphatidylinositol proteoglycan 3, EphA2, HER3, EpCAM, MUC1, MUC16, CLDN18.2, folate receptor, CLDN6, CD30, CD138, ASGPR1, CDH16, GD2, 5T4, 8H9, αvβ6 integrin, B cell maturation antigen (BCMA), B7-H3, B7-H6, CAIX, CA9, CD20, CD22, kappa light chain (kappa light chain), CD33, CD38, CD44, CD44v6, CD44v7 / 8, CD70, CD123, CD171, CSPG4, EGP2, EGP40, ERBB3, ERBB4, ErbB3 / 4, FAP, FAR, FBP, embryonic AchR, GD2, GD3, HLA-AI MAGE A1, MAGE3, HLA-A2, IL11Ra, KDR, Lambda, MCSP, NCAM, NKG2D ligand, PRAME, PSCA, PSC1, ROR1, Sp17, SURVIVIN, TAG72, TEM1, TEM8, VEGRR2, HMW-MAA, VEGF receptor, and / or fibronectin, tenascin, or oncofetal variants of tumor necrosis.

[0049] In some embodiments, the pathogen antigen comprises a viral antigen, a bacterial antigen, a fungal antigen, or a parasitic antigen. In some embodiments, the pathogen is a virus. The virus includes cytomegalovirus, Epstein-Barr virus, human immunodeficiency virus, and influenza virus.

[0050] In some embodiments, the expression of the type I interferon is constitutive. In some embodiments, the expression of the type I interferon is inducible. In some embodiments, the type I interferon is expressed on the surface of the immune response cell. In some embodiments, the type I interferon includes: IFNα or IFNβ.

[0051] According to one aspect of the present invention, an expression construct is provided, comprising, sequentially linked: an expression cassette for an antigen-binding receptor of the present invention; and an expression cassette for a type I interferon. In some embodiments, expression of the type I interferon is constitutive. In some embodiments, expression of the type I interferon is inducible. In some embodiments, expression of the type I interferon is inducible, and an inducible promoter is used to express the type I interferon. In some embodiments, the inducible promoter used to express the type I interferon is the NFAT6 promoter. In some embodiments, the NFAT6 promoter comprises the nucleic acid sequence set forth in SEQ ID NO: 78.

[0052] According to one aspect of the present invention, the present invention provides a vector that expresses an antigen-binding receptor and / or type I interferon of the present invention. In some embodiments, the viral vector is a lentiviral vector, a retroviral vector, or an adenoviral vector. In some embodiments, the viral vector is a retroviral vector.

[0053] According to one aspect of the present invention, the present invention provides a method for improving the viability of immune response cells administered to an individual, wherein the immune response cells express the antigen-binding receptor of the present invention, and wherein the method comprises administering to the individual the immune response cells and an effective amount of exogenous type I interferon. In some embodiments, the exogenous type I interferon and the immune response cells expressing the antigen-binding receptor are administered sequentially or simultaneously. In some embodiments, the exogenous type I interferon is co-expressed in the immune response cells and administered to the patient simultaneously with the immune response cells.

[0054] According to one aspect of the present invention, the present invention provides the use of the immune response cells of the present invention in the preparation of a pharmaceutical composition for treating a tumor or pathogen infection in an individual in need thereof, or for enhancing an individual's immune tolerance. The present invention also provides a method for treating a tumor or pathogen infection in an individual, or for enhancing an individual's immune tolerance, comprising administering the immune response cells of the present invention to an individual in need thereof.

[0055] In some embodiments, the methods of the present invention result in an increase of at least 50% in the sum of the number of cytotoxic T cells and helper T cells in the peripheral blood of the individual after administration of the immune response cells to the individual, compared to the absence of the exogenous type I interferon. In some embodiments, the methods result in an increase of the sum of the number of cytotoxic T cells and helper T cells in the peripheral blood of the individual to greater than 15,000 cells / μL about 5 days after administration of the immune response cells to the individual; an increase of the sum of the number of cytotoxic T cells and helper T cells in the peripheral blood of the individual to greater than 500 cells / μL about 5 days after administration of the immune response cells; or an increase of the sum of the number of cytotoxic T cells and helper T cells in the peripheral blood of the individual to greater than 50 cells / μL about 5 days after administration of the immune response cells.

[0056] In some embodiments, the tumor comprises pancreatic cancer, liver cancer, lung cancer, gastric cancer, head and neck squamous cell carcinoma, prostate cancer, colon cancer, breast cancer, lymphoma, gallbladder cancer, kidney cancer, leukemia, myeloma, ovarian cancer, cervical cancer, or glioma. In some embodiments, the pathogen comprises a virus, bacteria, fungus, protozoa, or parasite; preferably, the virus comprises cytomegalovirus, Epstein-Barr virus, human immunodeficiency virus, or influenza virus.

[0057] In some embodiments, the individual's tumor is reduced by at least 30% as measured by computed tomography following treatment with the methods of the invention. In some embodiments, the individual's tumor disappears completely as measured by computed tomography following treatment with the methods of the invention.

[0058] According to one aspect of the present invention, the present invention provides a pharmaceutical composition comprising the immune response cells of the present invention and a pharmaceutically acceptable carrier or excipient.

[0059] According to one aspect of the present invention, the present invention provides a kit comprising the immune response cells of the present invention and instructions for administering the immune response cells to an individual.

[0060] Incorporated by reference

[0061] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. BRIEF DESCRIPTION OF THE DRAWINGS

[0062] The accompanying drawings further illustrate the novel features disclosed in this specification. The features and advantages disclosed in this specification can be better understood with reference to these drawings, but it should be understood that these drawings are only intended to illustrate specific embodiments applying the principles disclosed herein and are not intended to limit the scope of the appended claims.

[0063] Figure 1 shows the schematic diagram of the structure of the recombinant lentiviral vector pRRL-EF-1α-92-CAR ( Figure 1A ), and the construction of 92-28Z-NFAT6-IFN-β plasmid ( Figure 1B ).

[0064] Figure 2 Shown is the positive rate detection graph of PBMC infected with lentivirus.

[0065] Figure 3 Shown is the positive rate detection graph of PBMC infected with lentivirus.

[0066] FIG4 shows a comparison of cytokine release by GPC3 CAR-T cells containing IFN and without IFN. Figure 4A The results show that GPC3-28Z-IFN and GPC3-28Z CAR T cells induced IFN-β expression. The results show that IFN-β was expressed only when GPC3-28Z-IFN was co-incubated with Huh7 cells, indicating that after GPC3-28Z-IFN was activated by the target antigen, IFNβ was successfully induced and secreted into the cells. Figure 4B Shown is the comparison of INF-γ induced expression by GPC3-28Z-IFN and GPC3-28Z CAR. Figure 4C The figure shows a comparison of IL-2 release induced by GPC3-28Z-IFN and GPC3-28Z CAR T cells in vitro. The results show that GPC3-28Z-IFN can more effectively induce cytokine release, indicating that CAR T cells containing IFNβ can be more effectively activated.

[0067] Figure 5 The figure shows a comparison of cytokine release induced by 85-28Z T cells and 85-28Z-IFN T cells in different cell lines in vitro. The results show that CAR T cells containing IFNβ can be activated more effectively.

[0068] FIG6 shows the in vitro effects of GPC3-28Z CAR T cells containing IFNβ and GPC3 CAR T cells not containing IFNβ on various cell lines ( Figure 6A :Huh7; Figure 6B :Hep3B; Figure 6C :PLC / PRR / 5; Figure 6D:Hep G2; Figure 6E : Comparison of killing efficiency of SK-hep-1).

[0069] Figure 7 Shown are the cytotoxic activities of CLD18A2 CAR-T cells with and without IFN.

[0070] Figure 8 shows the CLD18A2 CAR-T cells containing IFNβ and CLD18A2 CAR-T cells not containing IFNβ in the peripheral blood of mice after 5 days of reinfusion ( Figure 8A ) shows 7 days ( Figure 8B ) and 10 days ( Figure 8C ). The results showed that at all time points, the number of surviving CLD18A2 CAR-T cells containing IFNβ was significantly higher than that of the CLD18A2 CAR-T cell group without IFNβ.

[0071] Figure 9 shows a comparison of the effects of GPC3-28Z CAR T cells containing IFNβ and GPC3-28Z CAR T cells not containing IFNβ on tumor volume over time in a mouse tumor model ( Figure 9A ) and tumor photo comparison chart ( Figure 9B The results showed that GPC3-28Z CAR T cells containing IFNβ were able to significantly reduce tumor volume compared with GPC3-28Z CAR T cells not containing IFNβ and the control group.

[0072] Figure 10 shows a comparison of the effects of CLD18A2 CAR-T cells containing IFNβ and CLD18A2 CAR-T cells not containing IFNβ on tumor volume over time in a mouse BGC-823-A2 cell subcutaneous transplantation tumor model ( Figure 10A ) and tumor photo comparison chart ( Figure 10B The results showed that CLD18A2CAR-T cells containing IFNβ could more significantly reduce tumor volume than CLD18A2CAR-T cells not containing IFNβ and the control group.

[0073] Figure 11 The figure shows a comparison of the anti-tumor activity of CLD18A2 CAR-T cells in the presence of IFN and those without IFN in subcutaneous xenografts of a gastric cancer PDX model. The results show that one mouse in the IFN-treated group experienced complete tumor regression.

[0074] Figure 12 shows a comparison of tumor infiltration in vivo by GPC3 CAR-T (92-28Z) cells containing IFN and those without IFN. Figure 12A For tissue chemistry pictures, Figure 12B The figure shows the number of T cells. The results show that there were no obvious infiltrating CD3+ cells in the tumor tissue of the control group, and the number of CD3+ T cells in the INFβ-CAR-T treatment group was higher than that in the 28Z CART group.

[0075] Figure 13 The following is a comparison of in vivo immunohistochemical images of tumor infiltration by CLD18A2 CAR-T cells containing and without IFN. The results show that mock T cells have almost no T cell infiltration around the tumor tissue, while 85-28Z and 85-2-28Z CAR T cells can be seen at the edge of the tumor tissue, and 85-2-28Z-IFN T cells can be observed to infiltrate the tumor tissue to a certain extent.

[0076] Figure 14 Shown are schematic diagrams of the EGFR-CAR structures with and without IFN.

[0077] Figure 15 Shown is the infection positive rate of T lymphocytes in mice infected with retrovirus.

[0078] Figure 16 The figure shows the comparison of the ability of EGFR CAR T cells containing IFN and those without IFN to secrete mIFNβ in vitro. The results show that after stimulation with target cells, mCAR-806-mIFNβ can be successfully activated and induced to express mIFNβ, while no mIFNβ expression was detected in the control group.

[0079] Figure 17 shows the cytokine release induced by EGFR CAR-T cells containing IFN and without IFN in vitro ( Figure 17A :mIL-2; Figure 17B :mIFN-γ; Figure 17C : Comparison chart of mTNF-α).

[0080] Figure 18 The figure shows a comparison of in vitro toxicity tests of EGFR CAR-T cells containing and without IFN. The results showed that EGFR-CAR and EGFR-CAR-IFN had a potent killing effect on target-positive CT26VIII cells compared with UT cells, with significant differences (***P < 0.001). The killing percentage was dose-dependent, while untransfected UT cells had no killing effect on CT26 and CT26VIII. EGFR-CAR and EGFR-CAR-IFN CAR-T cells had no killing effect on target-negative CT26 cells.

[0081] Figure 19The figure shows a comparison of in vivo toxicity tests of EGFR CAR-T cells with and without IFN. The results show that the EGFR-CAR-T cell-treated group maintained tumors of similar size to the control group, with no observed inhibitory effect. However, after reinfusion of EGFR-CAR-IFN cells, tumor growth inhibition began to appear on day 7, reaching a tumor inhibition rate of 5.9%. This inhibition peaked at 18.5% on day 10, and remained at 12.4% on day 17, significantly superior to the EGFR-CAR-T cell group. DETAILED DESCRIPTION

[0082] The following detailed description presents the embodiments disclosed herein in detail. It should be understood that this description is not intended to be limited to the specific embodiments disclosed herein, but rather is subject to change. Those skilled in the art will appreciate that the disclosure herein is subject to numerous variations and modifications, all of which fall within the scope and principles disclosed. Unless otherwise indicated, each embodiment may be combined with any other embodiment.

[0083] Certain embodiments disclosed herein include numerical ranges, and certain aspects of the present invention may be described in terms of ranges. Unless otherwise stated, it should be understood that numerical ranges or the use of range descriptions are intended only for simplicity and convenience, and should not be considered as strict limitations on the scope of the present invention. Therefore, the use of range descriptions should be considered to specifically disclose all possible subranges and all possible specific numerical points within the range, as these subranges and numerical points have been clearly stated herein. For example, the description of a range from 1 to 6 should be considered to specifically disclose subranges from 1 to 3, 1 to 4, 1 to 5, 2 to 4, 2 to 6, 3 to 6, and specific numerical points within these ranges, such as 1, 2, 3, 4, 5, 6. Regardless of the width of the numerical value, the above principles apply equally. When describing in terms of ranges, the range includes the endpoints of the range.

[0084] To overcome the shortcomings of the prior art, the present invention conducted in-depth research and found that inducible expression of type I interferon in CAR-T cells can effectively increase the anti-tumor activity of CAR-T cells and reduce their toxic side effects. Based on this, the present invention provides an immune response cell that expresses at least one receptor that can bind to an antigen (such as a tumor antigen or an antigen from a pathogen) and type I interferon, which can be used to treat tumors, infectious diseases, and other diseases, and has a significantly superior ability to kill tumors or pathogens.

[0085] As used herein, the terms "activation" and "activation" are used interchangeably, and they and their grammatical other forms can refer to the process by which a cell is transformed from a resting state to an active state. This process can include responses to phenotypic or genetic changes in antigen, migration, and / or functional activity states. For example, the term "activation" can refer to the process by which T cells are gradually activated. For example, T cells may require at least two signals to be fully activated. The first signal can occur after the antigen-MHC complex engages the TCR, and the second signal can occur by the engagement of costimulatory molecules (see the costimulatory molecules listed in Table 1). In vitro, anti-CD3 can simulate the first signal, and anti-CD28 can simulate the second signal. For example, engineered T cells can be activated by expressed CAR. T cell activation or T cell triggering used herein can refer to the state of T cells that have been fully stimulated to induce detectable cell proliferation, cytokine production, and / or detectable effector function.

[0086] As used herein, the term "costimulatory ligand" includes molecules on antigen presenting cells (e.g., aAPCs, dendritic cells, B cells, etc.) that specifically bind to the same costimulatory molecule on a T cell, thereby providing a signal that, together with the first signal provided by, for example, the binding of the TCR / CD3 complex to the MHC molecule loaded with the peptide, mediates a T cell response, including but not limited to proliferation, activation, differentiation, etc. Costimulatory ligands may include, but are not limited to, CD7, B7-1 (CD80), B7-2 (CD86), PD-L, PD-L2, 4-1BBL, OX40L, inducible co-stimulatory ligand (ICOS-L), intercellular adhesion molecule (ICAM), CD30L, CD40, CD70, CD83, HLA-G, MICA, MICB, HVEM, lymphotoxin beta receptor, 3 / TR6, ILT3, ILT4, HVEM, agonists or antibodies that bind to Toll ligand receptors, and ligands that specifically bind to B7-H3. Co-stimulatory ligands also specifically include antibodies that specifically bind to co-stimulatory molecules present on T cells, such as, but not limited to, CD27, CD28, 4-1BB, OX40, CD30, CD40, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, and ligands that specifically bind to CD83.

[0087] The term "costimulatory molecule" as used herein refers to an identical binding partner on a T cell that specifically binds to a costimulatory ligand, thereby mediating a co-stimulatory response of the T cell, such as, but not limited to, proliferation. Costimulatory molecules include, but are not limited to, MHC class I molecules, BTLA, and Toll ligand receptors.

[0088] As used herein, a "co-stimulatory signal" refers to a signal that, in combination with a primary signal, such as TCR / CD3 binding, results in T cell proliferation and / or upregulation or downregulation of key molecules.

[0089] As used herein, the term "antigen binding unit" refers to immunoglobulin molecules and the immunologically active portion of an immune molecule, i.e., a molecule containing an antigen binding site that specifically binds to an antigen ("immunoreaction"). The term "antigen binding unit" also includes immunoglobulin molecules from various species, including invertebrates and vertebrates. Structurally, the simplest naturally occurring antibody (e.g., IgG) comprises four polypeptide chains, two heavy (H) chains and two light (L) chains interconnected by disulfide bonds. Immunoglobulins represent a large family of molecules that includes several types of molecules, such as IgD, IgG, IgA, IgM, and IgE. The term "immunoglobulin molecule" includes, for example, hybrid antibodies or altered antibodies and their fragments. It has been shown that the antigen binding function of an antibody can be performed by fragments of naturally occurring antibodies. These fragments are collectively referred to as "antigen binding units." The term "antigen binding unit" also includes any molecular structure containing polypeptide chains that has a specific shape that matches and recognizes an epitope, wherein one or more non-covalent binding interactions stabilize the complex between the molecular structure and the epitope.

[0090] An antigen binding unit "specifically binds" or is "immunoreactive" with an antigen if it binds the antigen with greater affinity or avidity than it binds other reference antigens (including polypeptides or other substances).

[0091] As used herein, "antigen" refers to a substance that is recognized and specifically bound by an antigen binding unit. Antigens can include peptides, proteins, glycoproteins, polysaccharides and lipids, portions thereof and combinations thereof. Non-limiting exemplary antigens include tumor antigens or pathogen antigens. "Antigen" can also refer to a molecule that elicits an immune response. This immune response may involve the production of antibodies or the activation of specific immunologically-competent cells, or both. Those skilled in the art will appreciate that any macromolecule, including virtually all proteins or peptides, can serve as an antigen.

[0092] The term "immunoglobulin" or "Ig" as used herein may refer to a class of proteins that function as antibodies. Antibodies expressed by B cells are sometimes referred to as chimeric antigen receptors or antigen receptors. The five members included in this class of proteins are IgA, IgG, IgM, IgD, and IgE, of which IgG is the most common circulating antibody. It is the most effective immunoglobulin in agglutination, complement fixation, and other antibody reactions, and is important in defending against bacteria and viruses. For example, tumor cell antigens (or "tumor antigens") or pathogen antigens can be recognized by CAR.

[0093] As used herein, the term "autologous" and its grammatical alternatives may refer to originating from the same source. For example, a sample (e.g., cells) may be removed, processed, and administered to the same individual (e.g., patient) at a later time. Autologous procedures differ from allogeneic procedures in that the donor and recipient are different individuals.

[0094] As used herein, "xenotransplantation" and its grammatical alternatives may include any procedure in which cells, tissues, or organs are transplanted, implanted, or infused into a recipient in which the recipient and donor are of different species. Transplantation of cells, organs, and / or tissues as described herein may be used for xenotransplantation into humans. Xenotransplantation includes, but is not limited to, vascularized xenografts, partially vascularized xenografts, non-vascularized xenografts, xenogeneic dressings, xenogeneic bandages, and xenogeneic structures, among others.

[0095] As used herein, "allogeneic transplantation" and its grammatical alternatives (e.g., allogeneic transplantation) can include any procedure in which cells, tissues, or organs are transplanted, implanted, or infused into a recipient in which the recipient and donor are of the same species but different individuals. Transplantation of cells, organs, and / or tissues as described herein can be used for allogeneic transplantation into the human body. Allografts include, but are not limited to, vascularized allografts, partially vascularized allografts, non-vascularized allografts, allogeneic dressings, allogeneic bandages, and allogenic structures.

[0096] As used herein, "autologous transplantation" and its grammatical alternatives (e.g., autologous transplantation) can include any procedure in which cells, tissues, or organs are transplanted, implanted, or infused into a recipient in which the recipient and donor are the same individual. Transplantation of cells, organs, and / or tissues as described herein can be used for autologous transplantation into the human body. Autologous transplantation includes, but is not limited to, vascularized autologous transplantation, partially vascularized autologous transplantation, non-vascularized autologous transplantation, autologous dressings, autologous bandages, and autologous structures.

[0097] The term "chimeric antigen receptor" or "CAR" as used herein refers to an engineered molecule that can be expressed by immune cells, including but not limited to T cells. CARs are expressed in T cells and can redirect T cells to induce killing of target cells with a specificity determined by an artificial receptor. The extracellular binding domain of a CAR can be derived from a murine, humanized, or fully human monoclonal antibody.

[0098] As used herein, the term "epitope" and its grammatical alternatives may refer to a portion of an antigen that is recognized by an antibody, B cell, T cell, or engineered cell. For example, an epitope may be a tumor epitope or pathogen epitope recognized by a TCR. Multiple epitopes within an antigen may also be recognized. Epitopes may also mutate.

[0099] As used herein, the term "engineered" and its grammatical alternatives may refer to one or more changes in a nucleic acid, such as a nucleic acid within the genome of an organism. The term "engineered" may refer to the alteration, addition, and / or deletion of a gene. An engineered cell may also refer to a cell having an added, deleted, and / or altered gene.

[0100] The term "cell" or "engineered cell" as used herein and its grammatical other forms may refer to cells of human or non-human animal origin. Engineered cells may also refer to cells expressing CAR.

[0101] The term "transfection" as used herein refers to the introduction of exogenous nucleic acid into eukaryotic cells. Transfection can be achieved by various means known in the art, including calcium phosphate-DNA coprecipitation, DEAE-dextran-mediated transfection, polybrene-mediated transfection, electroporation, microinjection, liposome fusion, lipofection, protoplast fusion, retroviral infection, and biolistics.

[0102] The term "stable transfection" or "stably transfected" refers to the introduction and integration of foreign nucleic acid, DNA or RNA, into the genome of the transfected cell. The term "stable transfectant" refers to a cell that has stably integrated foreign DNA into its genomic DNA.

[0103] As used herein, the terms "nucleic acid molecule encoding," "coding DNA sequence," and "coding DNA" refer to the sequence or order of deoxyribonucleotides along a deoxyribonucleic acid chain. The order of these deoxyribonucleotides determines the order of amino acids along a polypeptide (protein) chain. Thus, a nucleic acid sequence encodes an amino acid sequence.

[0104] The term "subject" as used herein refers to any animal, such as a mammal or marsupial. Subjects of the present invention include, but are not limited to, humans, non-human primates (e.g., rhesus monkeys or other types of macaques), mice, pigs, horses, donkeys, cattle, sheep, rats, and poultry of any kind.

[0105] As used herein, the term "peripheral blood lymphocytes" (PBL) and its grammatical alternatives may refer to lymphocytes circulating in the blood (e.g., peripheral blood). Peripheral blood lymphocytes may refer to lymphocytes that are not restricted to an organ. Peripheral blood lymphocytes may include T cells, NK cells, B cells, or any combination thereof.

[0106] The term "immune response cell" or "immunoreactive cell" as used herein may refer to a cell that can elicit an immune response, including but not limited to T cells, B cells, and NKT cells, their respective precursor cells, and their progeny. Immune response cells may also refer to cells of the lymphoid or myeloid lineages.

[0107] The term "T cell" and its grammatical alternatives used herein may refer to T cells of any origin. For example, the T cell may be a primary T cell such as an autologous T cell, etc. The T cell may also be human or non-human.

[0108] The terms "T cell activation" or "T cell triggering" used herein and other grammatical forms thereof may refer to the state of T cells that are fully stimulated to induce detectable cell proliferation, cytokine production and / or detectable effector function. In some embodiments, "complete T cell activation" may be similar to the cytotoxicity of triggering T cells. Various assays known in the art can be used to measure T cell activation. The assay can be ELISA, ELISPOT, flow cytometry assays (CD107) for measuring cytokine secretion, flow cytometry assays for measuring intracellular cytokine expression, and cytotoxicity assays (51Cr release assays) for determining target cell elimination. The assay is typically compared using a control (non-engineered cells) with engineered cells (CAR T) to determine the relative activation of engineered cells compared to the control. In addition, the assay can be compared with engineered cells incubated or contacted with target cells that do not express the target antigen. For example, the comparison can be a comparison of CD19-CART cells incubated with target cells that do not express CD19.

[0109] When used to refer to a nucleotide sequence, the term "sequence" as used herein and its grammatical alternatives may include DNA or RNA and may be single-stranded or double-stranded. A nucleic acid sequence may be mutated. A nucleic acid sequence may have any length, for example, a length of 2 to 1,000,000 or more nucleotides (or any integer value therebetween or above), for example, a length of about 100 to about 10,000 nucleotides or about 200 to about 500 nucleotides.

[0110] As used herein, the term "effective amount" refers to an amount that provides a therapeutic or prophylactic benefit.

[0111] The term "expression vector" as used herein refers to a vector comprising a recombinant polynucleotide comprising an expression control sequence operably linked to a nucleotide sequence to be expressed. The expression vector comprises sufficient cis-acting elements for expression; other elements for expression may be provided by the host cell or an in vitro expression system. Expression vectors include all those known in the art, such as cosmids, plasmids (e.g., naked or contained in liposomes), and viruses (e.g., lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses).

[0112] As used herein, the term "lentivirus" refers to a genus of the Retroviridae family. Retroviruses are unique among retroviruses in their ability to infect non-dividing cells; they can deliver large amounts of genetic information into the host cell's DNA, making them one of the most effective methods of gene delivery vectors. HIV, SIV, and FIV are all examples of lentiviruses. Vectors derived from lentiviruses provide a means to achieve significant levels of gene transfer in vivo.

[0113] As used herein, the term "operably linked" refers to a functional connection between a regulatory sequence and a heterologous nucleic acid sequence, which connection results in the expression of the latter. For example, a first nucleic acid sequence is operably linked to a second nucleic acid sequence when the first nucleic acid sequence is in a functional relationship with the second nucleic acid sequence. For example, a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence. Generally, operably linked DNA sequences are contiguous and, where necessary, connect two protein coding regions in the same reading frame.

[0114] The term "promoter" as used herein is defined as a DNA sequence recognized by the synthetic machinery of the cell or introduced synthetic machinery required to initiate specific transcription of a polynucleotide sequence.

[0115] The term "vector" as used herein is a composition comprising an isolated nucleic acid and which can be used to deliver the isolated nucleic acid to the interior of a cell. Many vectors are known in the art, including but not limited to linear polynucleotides, polynucleotides associated with ions or amphiphilic compounds, plasmids and viruses. Therefore, the term "vector" includes autonomously replicating plasmids or viruses. The term should also be interpreted to include non-plasmids and non-viral compounds that promote the transfer of nucleic acids into cells, such as polylysine compounds, liposomes, etc. Examples of viral vectors include but are not limited to adenoviral vectors, adeno-associated viral vectors, retroviral vectors, etc.

[0116] The term sequence "identity" as used herein is determined by comparing two optimally matched sequences over a comparison window (e.g., at least 20 positions) to determine the percentage of identity, wherein the portion of the polynucleotide or polypeptide sequence in the comparison window may contain additions or deletions (i.e., gaps), such as 20% or less gaps (e.g., 5 to 15%, or 10 to 12%) for the two optimally matched sequences compared to the reference sequence (which does not contain additions or deletions). Percentages are typically calculated by determining the number of positions at which the same nucleic acid base or amino acid residue occurs in the two sequences to produce the number of correctly matched positions, dividing the number of correctly matched positions by the total number of positions in the reference sequence (i.e., the window size), and multiplying the result by 100 to produce the percentage of sequence identity.

[0117] The term "type I interferon" used herein includes IFNα, IFNβ, IFN-ε, IFN-κ and IFN-ω, etc. All type I interferons bind to specific cell surface receptors (the so-called IFN-α / β receptors) composed of two chains, IFNAR1 and IFNAR2. In some embodiments, the term "type I interferon" used herein is IFNα or IFNβ. In some embodiments, the term "type I interferon" used herein is IFNβ. In some embodiments, the type I interferon used herein includes human, mouse, or synthetic type I interferon. In some embodiments, the term "interferon α" used herein can be a polypeptide having a sequence shown in NCBI aaa52724.1 or aaa52716.1 or aaa52725.1, or a polypeptide whose sequence has at least 85% identity with these sequences. In some embodiments, the term "interferon beta" (INF-β) as used herein can be a protein having at least 85% identity with NCBI aac41702.1 or np_002167.1 or aah96152.1p41273 or NP 001552, or a fragment thereof having tumor necrosis factor (TNF) ligand function.

[0118] In some embodiments, the components used to construct the antigen-binding receptor or the type I interferon can be naturally occurring, such as being isolated or purified from a mammal; or they can be artificially prepared, such as by producing recombinant components or type I interferon using conventional genetic engineering recombinant techniques. Preferably, the present invention can use recombinant components or type I interferon.

[0119] Amino acid sequences formed by substitution, deletion, or addition of one or more amino acid residues based on the aforementioned elements or type I interferon polypeptide sequences are also encompassed by the present invention. Appropriate amino acid substitution is well known in the art and can be readily implemented without altering the biological activity of the resulting molecule. These techniques have taught those skilled in the art that, generally speaking, altering a single amino acid in a non-essential region of a polypeptide will not substantially alter biological activity.

[0120] Each of the aforementioned elements or biologically active fragments of type I interferon polypeptides can be used in the present invention. Herein, a biologically active fragment refers to a polypeptide that, as a portion of a full-length polypeptide, retains all or part of the full-length polypeptide's function. Typically, the biologically active fragment retains at least 50% of the activity of the full-length polypeptide. More preferably, the biologically active fragment retains 60%, 70%, 80%, 90%, 95%, 99%, or 100% of the activity of the full-length polypeptide.

[0121] Based on the aforementioned elements or type I interferon polypeptide sequences, modified or improved polypeptides may also be used in the present invention. For example, polypeptides modified or improved to enhance their half-life, effectiveness, metabolism, and / or potency may be used. In other words, any variation that does not affect the biological activity of the polypeptide may be used in the present invention.

[0122] As used herein, the terms "disease," "condition," or "disorder" refer to any change or disorder that damages or interferes with the normal function of a cell, tissue, or organ. For example, the term "disease" includes, but is not limited to, tumors, pathogen infection, autoimmune diseases, T-cell dysfunction, or immune tolerance defects (e.g., transplant rejection).

[0123] The term "tumor" as used herein refers to a disease characterized by a pathological proliferation of cells or tissues, and their subsequent migration or invasion of other tissues or organs. Tumor growth is generally uncontrolled and progressive, and does not induce or inhibit normal cell proliferation. Tumors can affect a variety of cells, tissues or organs, including but not limited to those selected from the bladder, bone, brain, breast, cartilage, glial cells, esophagus, fallopian tubes, gall bladder, heart, intestine, kidney, liver, lung, lymph node, nervous tissue, ovary, pancreas, prostate, skeletal muscle, skin, spinal cord, spleen, stomach, testicles, thymus, thyroid, trachea, urethra, ureter, urethra, uterus, vaginal organs, or tissues or corresponding cells. Tumors include cancers such as sarcomas, carcinomas, or plasmacytomas (malignant tumors of plasma cells). The tumors described in the present invention may include, but are not limited to, leukemia (such as acute leukemia, acute lymphocytic leukemia, acute myeloid leukemia, acute granulocytic leukemia, acute promyelocytic leukemia, acute myelomonocytic leukemia, acute monocytic leukemia, acute leukemia, chronic leukemia, chronic myeloid leukemia, chronic lymphocytic leukemia, polycythemia vera), lymphoma (Hodgkin's disease, non-Hodgkin's disease), primary macroglobulinemia, heavy chain disease, solid tumors such as sarcomas and cancers (such as fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteosarcoma, chordoma, endotheliosarcoma, lymphangiosarcoma, angiosarcoma, lymphangioendotheliosarcoma, synovial vioma, mesothelioma, Ewing's Tumor, leiomyosarcoma, rhabdomyosarcoma, colon cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinoma, carcinoma, bronchogenic carcinoma, medullary carcinoma, renal cell carcinoma, liver cancer, Nile duct carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilms' tumor, cervical cancer, uterine cancer, testicular cancer, lung cancer, small cell lung cancer, bladder cancer, epithelial carcinoma, glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, schwannoma, meningioma, melanoma, neuroblastoma, retinoblastoma), esophageal cancer, gallbladder cancer, kidney cancer, multiple myeloma. Preferably, the "tumor" includes but is not limited to: pancreatic cancer, liver cancer, lung cancer, gastric cancer, esophageal cancer, head and neck squamous cell carcinoma, prostate cancer, colon cancer, breast cancer, lymphoma, gallbladder cancer, kidney cancer, leukemia, multiple myeloma, ovarian cancer, cervical cancer and glioma.

[0124] The types of tumor antigens mentioned in the present invention may also be tumor-specific antigens (TSAs) or tumor-associated antigens (TAAs). TSAs are unique to tumor cells and do not occur on other cells in the body. TAA-related antigens are not unique to tumor cells, but are expressed on normal cells under conditions where a state of immune tolerance to the antigen cannot be induced. The expression of antigens on tumors can occur under conditions that enable the immune system to respond to the antigens. TAAs may be antigens expressed on normal cells during fetal development when the immune system is immature and unable to respond, or they may be antigens that are normally present at very low levels on normal cells but expressed at higher levels on tumor cells.

[0125] Non-limiting examples of TSA or TAA antigens include the following: differentiation antigens such as MART-1 / MelanA (MART-I), gp100 (Pmel17), tyrosinase, TRP-1, TRP-2 and tumor-specific multicentric antigens such as MAGE-1, MAGE-3, BAGE, GAGE-1, GAGE-2, p15; overexpressed embryonic antigens such as CEA; overexpressed oncogenes and mutated tumor suppressor genes such as p53, Ras, HER-2 / neu; unique tumor antigens caused by chromosomal translocations, such as BCR-ABL, E2A-PRL, H4-RET, IGH-IGK, and MYL-RAR; and viral antigens, such as Epstein-Barr virus antigen EBVA and human papillomavirus (HPV) antigens E6 and E7, etc. Other large, protein-based antigens include TSP-180, MAGE-4, MAGE-5, MAGE-6, RAGE, NY-ESO, p185erbB2, p180erbB-3, c-met, nm-23H1, PSA, TAG-72, CA 19-9, CA 72-4, CAM17.1, NuMa, K-ras, β-catenin, CDK4, Mum-1, p15, p16, 43-9F, 5T4, 791Tgp72, alpha-fetoprotein, beta-HCG, BCA225, BTAA, CA 125, CA 15-3\CA 27.29\BCAA, CA 195, CA 242, CA-50, CAM43, CD68\P1, CO-029, FGF-5, G250, Ga733\EpCAM, HTgp-175, M344, MA-50, MG7-Ag, MOV18, NB / 70K, NY-CO-1, RCAS1, SDCCAG16, TA-90\Mac-2 binding protein\cyclophilin C-related protein, TAAL6, TAG72, TLP, and TPS.

[0126] In some embodiments, the “tumor antigen” includes but is not limited to prostate-specific membrane antigen (PSMA), carcinoembryonic antigen (CEA), IL13Ralpha, HER-2, CD19, NY-ESO-1, HIV-1 Gag, Lewis Y, MART-1, gp100, tyrosinase, WT-I, hTERT, mesothelin, EGFR, EGFRvIII, glypican 3, EphA2, HER3, EpCAM, MUC1, MUC16, CLDN18.2, folate receptor, CLDN6, CD30, CD138, ASGPR1, CDH16, GD2, 5T4, 8H9, αvβ6 integrin, B cell maturation antigen (BCMA), B7-H3, B7-H6, CAIX, CA9, CD20, CD22, kappa light chain, chain), CD33, CD38, CD44, CD44v6, CD44v7 / 8, CD70, CD123, CD171, CSPG4, EGP2, EGP40, ERBB3, ERBB4, ErbB3 / 4, FAP, FAR, FBP, embryonic AchR, GD2, GD3, HLA-AI MAGE A1, MAGE3, HLA-A2, IL11Ra, KDR, Lambda, MCSP, NCAM, NKG2D ligand, PRAME, PSCA, PSC1, ROR1, Sp17, SURVIVIN, TAG72, TEM1, TEM8, VEGRR2, HMW-MAA, VEGF receptor, and / or fibronectin, tenascin, or oncofetal variants of tumor necrosis.

[0127] The term "pathogen" as used herein refers to a protozoan that can cause disease, including viruses, bacteria, fungi or parasites. The "viral antigen" refers to a polypeptide expressed by a virus that can induce an immune response.

[0128] Typical viruses include, but are not limited to, Retroviridae (e.g., human immunodeficiency viruses, such as HIV-1 (also known as HDTV-III, LAVE or HTLV-III / LAV, or HIV-III; and other strains, such as HIV-LP); Picornaviruses (e.g., poliovirus, hepatitis A virus; human enteroviruses, coxsackieviruses, rhinoviruses, echoviruses); Caliciviruses (e.g., strains causing gastroenteritis); Togaviruses (e.g., equine encephalitis virus, rubella virus); Flaviviridae (e.g., dengue virus, Japanese encephalitis virus, yellow fever virus); Coronaviridae (e.g., coronavirus); Rhabdoviridae (e.g., vesicular stomatitis virus, rabies virus); Filoviridae (e.g., Ebola virus); Paramyxoviridae (e.g., parainfluenza virus, mumps virus, measles virus, respiratory syncytial virus); Orthomyxoviridae (e.g., influenza virus); Subviridae ( (e.g., Hantavirus, some viruses, sandfly, and Nairovirus); Arenaviridae (hemorrhagic fever viruses); Reoviridae (e.g., reoviruses, orbiviruses, and rotaviruses); Binaviridae; Hepatoviruses (hepatitis B virus); Parvoviridae (parvoviruses); Papovaviridae (papillomaviruses, polyomaviruses); Adenoviridae (most adenoviruses); Herpes simplex virus (HSV) 1 and 2, varicella-zoster virus, cytomegalovirus (CMV), herpes simplex virus; Poxviruses (variola virus, cowpox virus, poxviruses); Iridoviridae (e.g., African swine fever virus); and unclassified viruses (e.g., hepatitis B virus with a defective satellite TE), non-A, non-B hepatitis agents (Class 1 = internal transmission; Class 2 = parenteral transmission (i.e., hepatitis C); Norwalk and related viruses, and Astroviruses).

[0129] Typical bacteria include, but are not limited to, Pasteurella, Staphylococcus aureus, Streptococcus, Escherichia coli, Salmonella and Pseudomonas aeruginosa. Specific examples of infectious bacteria include, but are not limited to, Helicobacter pylori, spirochetes, Legionella pneumophila, Mycobacterium SPS (such as Mycobacterium tuberculosis, Mycobacterium avium, Mycobacterium endomycobacterium, M. Kansaii, M. gordonae), Staphylococcus aureus, Neisseria gonorrhoeae, Neisseria meningitidis, Listeria monocytogenes, Streptococcus pyogenes (Group A Streptococcus), Streptococcus agalactiae (Group B Streptococcus), Streptococcus agalactiae (Group B Streptococcus), Streptococcus aureus ... Streptococcus faecalis, Streptococcus bovis, Streptococcus (anaerobic SPS), Streptococcus pneumoniae, Campylobacter, Enterococcus, Haemophilus influenzae, Bacillus anthracis, Corynebacterium diphtheriae, Corynebacterium, Erysipelothrix, Clostridium perfringens, Clostridium tetani, Enterobacter cloacae, Klebsiella pneumoniae, Pasteurella multocida, Bacteroides, Fusobacterium nucleatum, Moniliform chain, Treponema pallidum, Treponema yawsii, Leptospira, Rickettsia, Actinomyces israelii.

[0130] In some embodiments, the immune response cells of the present invention are capable of recognizing and binding parasite antigens. The parasites include internal parasites and external parasites. The internal parasites include protozoa, helminths, roundworms, and flukes. In some embodiments, the parasite antigen is, for example, an antigen from a species of the family Entamoeba histolytica; Babesia B. divergens, B. bigemina, B. equi, B. microfti, B. duncani; Balantidium coli; Blastocystis spp.; Trypanosoma cruzi; Cryptosporidium spp.; Cyclosporacayetanensis; Dientamoeba fragilis; Giardia lamblia; Balamuthia mandrillaris; Acanthamoeba spp.; Isospora belli; Leishmania spp.; Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale curtisi, Plasmodium ovale wallikeri, Plasmodium malariae, Plasmodium knowlesi; Naegleria fowleri; Rhinosporidium seeberi; Sarcocystis bovihominis,Sarcocystis suihominis;Trypanosoma brucei;Toxoplasma gondii;Trichomonas vaginalis;Taenia saginata;Bertiella mucronata,Bertiella studeri;Taenia solium;Diphyllobothrium latum;Echinococcusgranulosus,Echinococcus multilocularis,E.vogeli,E.oligarthrus;Hymenolepisnana,Hymenolepis diminuta;Spirometra erinaceieuropaei;Cestoda,Taeniamulticeps;Clonorchis sinensis;Clonorchis viverrini;Dicrocoelium dendriticum;Fasciola hepatica,Fasciola gigantica;Fasciolopsis buski;Gnathostomaspinigerum,Gnathostoma hispidum;Metagonimus yokogawai;Metorchis conjunctus;Opisthorchis viverrini,Opisthorchis felineus,Clonorchis sinensis;Paragonimuswestermani;Paragonimus africanus;Paragonimus caliensis;Paragonimuskellicotti;Paragonimus skrjabini;Paragonimus uterobilateralis;Schistosomasp.;Schistosoma mansoni and Schistosoma intercalatum;Schistosoma haematobium;Schistosoma japonicum;Schistosoma mekongi;Echinostoma echinatum;Trichobilharzia regenti,Schistosomatidae;Ancylostoma duodenale,Necatoramericanus;Angiostrongylus costaricensis;Anisakis;Ascaris sp.Ascarislumbricoides;Baylisascaris procyonis;Brugia malayi,Brugia timori;Dioctophymerenale;Dracunculus medinensis;Enterobius vermicularis,Enterobius gregorii;Halicephalobus gingivalis;Loa loa filaria;Mansonella streptocerca;Onchocercavolvulus;Strongyloides stercoralis;Thelazia californiensis,Thelaziacallipaeda;Toxocara canis,Toxocara cati;Trichinella spiralis,Trichinellabritovi,Trichinella nelsoni,Trichinella nativa;Trichuris trichiura,Trichurisvulpis;Wuchereria bancrofti;Archiacanthocephala,Moniliformis moniliformis;Linguatula serrata;Oestroidea;Calliphoridae,Sarcophagidae;Cochliomyiahominivorax;Tunga penetrans;Cimex lectularius;Dermatobia hominis;Pediculushumanus;Pediculus humanus corporis;Pthirus pubis;Demodex folliculorum / brevis / canis; Sarcoptes scabiei; Trombiculidae; Pulex irritans; Ixodidae and Argasidae.

[0131] The term "autoimmune disease" as used herein is defined as a condition caused by an autoimmune response. An autoimmune disease is the result of an inappropriate and excessive reaction to a self-antigen. Examples of autoimmune diseases include, but are not limited to, appendicitis, alopecia, ankylosing spondylitis, autoimmune hepatitis, autoimmune mumps, Crohn's disease, diabetes (type I), malnutrition epidermolysis bullosa, epididymitis, glomerulonephritis, Graves' disease, Guillain-Barre syndrome, Hashimoto's disease, hemolytic anemia, systemic lupus erythematosus, multiple sclerosis, myasthenia gravis, pemphigus vulgaris, psoriasis, rheumatic fever, rheumatoid arthritis, sarcoidosis, scleroderma, Sjögren's syndrome, spondyloarthropathies, thyroiditis, vasculitis, vitiligo, myxedema, pernicious anemia, ulcerative colitis, etc.

[0132] "Tolerance" or "immune tolerance" is the failure of the immune system to mount a defensive immune response to a specific antigen. Tolerance can be natural or autologous, in which the body does not attack its own proteins and antigens, or it can be induced through manipulation of the immune system. Central tolerance occurs during lymphocyte development and operates in the thymus and bone marrow. During this process, T and B lymphocytes that recognize self-antigens are deleted before they develop into fully immunocompetent cells. This process is most active during fetal development but continues throughout life as immature lymphocytes are generated. Peripheral T cell tolerance refers to the functional unresponsiveness to self-antigens present in peripheral tissues and occurs after T and B cells mature and enter the periphery. These processes include the suppression of autoreactive cells by "regulatory" T cells and the generation of hyporeactivity (anergy) in lymphocytes that encounter antigens in the absence of co-stimulatory signals associated with inflammation. "Acquired" or "induced tolerance" refers to the adaptation of the immune system to external antigens, characterized by the specific non-reactivity of lymphoid tissues to a given antigen, which may otherwise induce cell-mediated or humoral immunity. In adults, tolerance can be clinically induced by repeated administration of very large doses of antigen or small doses below the threshold required to stimulate an immune response (e.g., by intravenous or sublingual administration of soluble antigens). Antigens that induce immune tolerance are called tolerogens. Immunosuppression can also help induce tolerance. The breakdown of self-tolerance can lead to autoimmunity.

[0133] The immune recognition of non-self antigens usually complicates the transplantation and transplantation of foreign tissues from organisms of the same species (allografts), leading to transplant rejection. Lymphocytes, particularly T lymphocytes, play a key role in allograft rejection, transplant failure and GVHD. There are usually two situations in which allografts can be accepted. One is when cells or tissues are transplanted to immune-exempt sites (such as in the eyes or testicles) separated from the immune surveillance system, or with strong molecular signals to prevent dangerous inflammation (such as in the brain). The second situation is when a state of tolerance has been induced, whether previously exposed to the donor's antigen in a manner that causes immune tolerance rather than sensitization of the recipient, or after chronic rejection. Successful allografts require the development of a certain degree of immune tolerance for alloantigens. The realization of immune tolerance can prevent the host-versus-graft reaction that causes transplant rejection and failure, and prevent graft-versus-host reaction (GVHD).

[0134] The term "enhancing immune response cell function" as used herein includes, for example, enhancing T cell function. Taking T cells as an example, enhancing T cell function includes inducing, causing or stimulating T cells to have a sustained or enhanced biological function, or renewing or reactivating exhausted (exhausted) or inactive T cells. Examples of enhancing T cell function include: relative to pre-intervention levels, increased interferon secretion by CD8+ T cells, increased proliferation, and increased antigen reactivity (such as virus or pathogen clearance). In one embodiment, the enhancement level is at least 50%, or 60%, 70%, 80%, 90%, 100%, 120%, 150%, 200%. The manner of measuring this enhancement is known to those of ordinary skill in the art.

[0135] As used herein, the term "T cell dysfunction disease" includes disorders or conditions of T cells characterized by reduced responsiveness to antigen stimulation. In some embodiments, the T cell dysfunction disorder is a disorder specifically associated with inappropriately increased signaling through PD-1. In some embodiments, the T cell dysfunction disease is a disease in which T cells are anergic or have reduced ability to secrete cytokines, proliferate, or perform cytolytic activity. Examples of T cell dysfunction diseases characterized by T cell dysfunction include unabsorbed acute infections, chronic infections, and tumor immunity.

[0136] As used herein, the term "exogenous" refers to a nucleic acid molecule or polypeptide that is not endogenously expressed in a cell, or is expressed at a level insufficient to achieve the function that would be achieved if overexpressed. Thus, "exogenous" includes recombinant nucleic acid molecules or polypeptides expressed in a cell, such as exogenous, heterologous, and overexpressed nucleic acid molecules and polypeptides.

[0137] As used herein, the term "receptor" refers to a polypeptide, or portion thereof, that selectively binds one or more ligands on a cell membrane.

[0138] In some embodiments, an antigen-binding receptor of the invention specifically binds to an antigen to which it is capable of binding.

[0139] In some embodiments, the antigen-binding receptor of the present invention is a chimeric antigen receptor. The term "chimeric antigen receptor (CAR)" used herein refers to a tumor antigen binding domain fused to an intracellular signal transduction domain that can activate T cells. Commonly, the extracellular binding domain of CAR is derived from a mouse or humanized or human monoclonal antibody.

[0140] Chimeric antigen receptors generally comprise an extracellular antigen binding region or antigen binding unit. In some embodiments, the extracellular antigen binding region may be fully human. In other cases, the extracellular antigen binding region may be humanized. In other cases, the extracellular antigen binding region may be murine, or the chimera in the extracellular antigen binding region may be composed of amino acid sequences from at least two different animals. In some embodiments, the extracellular antigen binding region may be non-human.

[0141] A variety of antigen binding regions can be designed. Non-limiting examples include single-chain variable fragments (scFv) derived from antibodies, fragment antigen binding regions (Fab) selected from libraries, single domain fragments, or natural ligands that engage their cognate receptors. In some embodiments, the extracellular antigen binding region may comprise scFv, Fab, or natural ligands, and any derivatives thereof. The extracellular antigen binding region may refer to a molecule other than a complete antibody, which may comprise a portion of a complete antibody and may bind to the antigen to which the complete antibody is bound. Examples of antibody fragments may include, but are not limited to, Fv, Fab, Fab', Fab'-SH, F(ab')2; bifunctional antibodies, linear antibodies; single-chain antibody molecules (e.g., scFv); and multispecific antibodies formed by antibody fragments.

[0142] The extracellular antigen binding region, such as scFv, Fab or natural ligand, can be a part of the CAR that determines the antigen specificity. The extracellular antigen binding region can be combined with any complementary target. The extracellular antigen binding region can be derived from an antibody of a known variable region sequence. The extracellular antigen binding region can be obtained from the antibody sequence obtained from an available mouse hybridoma. Alternatively, the extracellular antigen binding region can be obtained from the full excision sequencing of tumor cells or primary cells such as tumor infiltrating lymphocytes (TIL).

[0143] In some embodiments, the binding specificity of the extracellular antigen binding region can be determined by complementary determining regions or CDRs, such as light chain CDRs or heavy chain CDRs. In many cases, the binding specificity can be determined by light chain CDRs and heavy chain CDRs. Compared with other reference antigens, the combination of a given heavy chain CDR and a light chain CDR can provide a given binding pocket, which can give an antigen (such as GPC3) greater affinity and / or specificity. For example, CDRs specific for glypican-3 can be expressed in the extracellular binding region of CAR, so that CAR targeting GPC3 can target immune response cells to tumor cells expressing GPC3.

[0144] In certain aspects of any of the embodiments disclosed herein, the extracellular antigen binding region, such as scFv, may include a light chain CDR specific for an antigen. The light chain CDR may be the complementary determining region of the scFv light chain of an antigen binding unit such as a CAR. The light chain CDR may include a continuous sequence of amino acid residues, or two or more continuous sequences of amino acid residues separated by a non-complementary determining region (such as a framework region). In some embodiments, the light chain CDR may include two or more light chain CDRs, which may be referred to as light chain CDR-1, CDR-2, etc. In some embodiments, the light chain CDR may include three light chain CDRs, which may be referred to as light chain CDR-1, light chain CDR-2, and light chain CDR-3, respectively. In some instances, a group of CDRs present in a common light chain may be collectively referred to as light chain CDRs.

[0145] In some aspects of any embodiment disclosed herein, the extracellular antigen binding region, such as scFv, may include heavy chain CDRs specific for an antigen. Heavy chain CDRs may be heavy chain complementary determining regions of antigen binding units such as scFv. Heavy chain CDRs may include a continuous sequence of amino acid residues, or a continuous sequence of two or more amino acid residues separated by non-complementary determining regions (e.g., framework regions). In some embodiments, the heavy chain CDR may include two or more heavy chain CDRs, which may be referred to as heavy chain CDR-1, CDR-2, etc. In some embodiments, the heavy chain CDR may include three heavy chain CDRs, which may be referred to as heavy chain CDR-1, heavy chain CDR-2, and heavy chain CDR-3, respectively. In some embodiments, a group of CDRs present on a common heavy chain may be collectively referred to as heavy chain CDRs.

[0146] By using genetic engineering, the extracellular antigen binding region can be modified in various ways. In some embodiments, the extracellular antigen binding region can be mutated so that the extracellular antigen binding region can be selected to have a higher affinity for its target. In some embodiments, the affinity of the extracellular antigen binding region to its target can be optimized for targets that can be expressed at low levels on normal tissues. This optimization can be performed to minimize potential toxicity. In other cases, clones of the extracellular antigen binding region with a higher affinity for the membrane-bound form of the target can be superior to their soluble counterparts. This modification can be performed because different levels of soluble forms of the target can also be detected, and their targeting can cause undesirable toxicity.

[0147] In some embodiments, the extracellular antigen binding region includes a hinge or a spacer. The terms hinge and spacer can be used interchangeably. The hinge can be considered as a part of the CAR for providing flexibility to the extracellular antigen binding region. In some embodiments, the hinge can be used to detect the CAR on the cell surface of the cell, particularly when the antibody detecting the extracellular antigen binding region does not work or is available. For example, the length of the hinge derived from the immunoglobulin may need to be optimized, depending on the position of the epitope on the target of the extracellular antigen binding region.

[0148] In some embodiments, the hinge may not belong to an immunoglobulin, but to another molecule, such as the natural hinge of the CD8α molecule. The CD8α hinge may contain cysteine ​​and proline residues that are known to play a role in the interaction between the CD8 co-receptor and the MHC molecule. The cysteine ​​and proline residues may affect the performance of the CAR.

[0149] The CAR hinge can be size-adjustable. This morphology of the immunological synapse between the immune response cell and the target cell also defines the distance that cannot be functionally bridged by the CAR due to the membrane distal epitope on the cell surface target molecule. Even with a short hinge CAR, the synaptic distance cannot reach the approximate value at which the signal can be conducted. Similarly, the membrane proximal CAR target antigen epitope is only observed to output a signal in the context of a long hinge CAR. The hinge can be adjusted according to the extracellular antigen binding region used. The hinge can be of any length.

[0150] The transmembrane domain can anchor the CAR to the plasma membrane of the cell. The native transmembrane portion of CD28 can be used in the CAR. In other cases, the native transmembrane portion of CD8α can also be used in the CAR. "CD8" can be a protein that is at least 85, 90, 95, 96, 97, 98, 99 or 100% identical to NCBI Reference No.: NP_001759 or a fragment thereof having stimulatory activity. A "CD8 nucleic acid molecule" can be a polynucleotide encoding a CD8 polypeptide. In some cases, the transmembrane region can be the native transmembrane portion of CD28. "CD28" can refer to a protein that is at least 85, 90, 95, 96, 97, 98, 99 or 100% identical to NCBI Reference No.: NP_006130 or a fragment thereof having stimulatory activity. A "CD28 nucleic acid molecule" can be a polynucleotide encoding a CD28 polypeptide. In some embodiments, the transmembrane portion can include a CD8α region.

[0151] The (thin) intracellular signaling region of CAR can be responsible for activating at least one of the effector functions of the immune response cells in which CAR has been placed. CAR can induce the effector functions of T cells, for example, the effector functions are cytolytic activity or auxiliary activity, including the secretion of cytokines. Therefore, the term intracellular signaling region refers to a protein portion that transduces effector function signals and guides cells to perform specific functions. Although the entire intracellular signaling region can generally be used, in many cases, it is not necessary to use the entire chain of the signaling domain. In some embodiments, a truncated portion of the intracellular signaling region is used. In some embodiments, the term intracellular signaling region is therefore intended to include any truncated portion of the intracellular signaling region that is sufficient to transduce effector function signals.

[0152] Preferred examples of signaling domains used in CARs may include the cytoplasmic sequences of T cell receptors (TCRs) and co-receptors that act synergistically to initiate signal transduction following target-receptor binding, as well as any derivative or variant sequences thereof and any synthetic sequences of these sequences having the same functionality.

[0153] In some embodiments, the intracellular signaling region may contain a signaling motif of a known immunoreceptor tyrosine-based activation motif (ITAM). Examples of ITAMs containing cytoplasmic signaling sequences include those derived from TCRζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, and CD66d. However, in a preferred embodiment, the intracellular signaling domain is derived from the CD3ζ chain.

[0154] An example of a T cell signaling domain containing one or more ITAM motifs is the CD3ζ domain, also known as the T cell receptor T3ζ chain or CD247. This domain is part of the T cell receptor-CD3 complex and plays an important role in coupling antigen recognition of several intracellular signal transduction pathways with primary effector activation of T cells. As used herein, CD3ζ primarily refers to human CD3ζ and its isoforms, as known from Swissprot entry P20963, including proteins having substantially the same sequence. As part of a chimeric antigen receptor, it is reiterated that the entire T cell receptor T3ζ chain is not required, and any derivative thereof containing the signaling domain of the T cell receptor T3ζ chain is suitable, including any functional equivalents thereof.

[0155] The intracellular signaling domain can be selected from any one of the domains in Table 1. In some embodiments, the domain can be modified such that the identity to the reference domain can be from about 50% to about 100%. Any one of the domains in Table 1 can be modified such that the modified form can comprise about 50, 60, 70, 80, 90, 95, 96, 97, 98, 99, or up to about 100% identity.

[0156] The intracellular signal transduction region of CAR can further include one or more costimulatory domains.The intracellular signal transduction region can include a single costimulatory domain, such as ζ chain (first generation CAR) or its and CD28 or 4-1BB (second generation CAR).In other examples, the intracellular signal transduction region can include two costimulatory domains, such as CD28 / OX40 or CD28 / 4-1BB (third generation).

[0157] Together with intracellular signaling domains such as CD8, these co-stimulatory domains can produce downstream activation of kinase pathways, thereby supporting gene transcription and functional cellular responses. The co-stimulatory domains of CARs can activate proximal signaling proteins associated with the CD28 (phosphatidylinositol-4,5-bisphosphate 3-kinase) or 4-1BB / OX40 (TNF-receptor-associated factor adaptor protein) pathways, as well as MAPK and Akt activation.

[0158] In some cases, the signal produced by CAR may be combined with auxiliary or costimulatory signals.For costimulatory signal domains, chimeric antigen receptor-like complexes can be designed to include some possible costimulatory signal domains. As well known in the art, in immature T cells, the separate engagement of T cell receptors is not enough to induce the complete activation of T cells as cytotoxic T cells. Complete productive T cell activation requires a second costimulatory signal. It has been reported that several receptors for costimulation are provided for T cell activation, including but not limited to CD28, OX40, CD27, CD2, CD5, ICAM-1, LFA-1 (CD11a / CD18), 4-1BBL, MyD88 and 4-1BB. The signal transduction pathways used by these costimulatory molecules can synergize with the main T cell receptor activation signal. The signal provided by these costimulatory signal transduction regions can synergize with the main effector activation signal derived from one or more ITAM motifs (such as CD3zeta signal transduction domains), and the requirements for T cell activation can be completed.

[0159] In some embodiments, the addition of a co-stimulatory domain to the chimeric antigen receptor-like complex can enhance the efficacy and durability of the engineered cells. In another embodiment, the T cell signaling domain and the co-stimulatory domain are fused to each other to form a signaling region.

[0160] Table 1. Costimulatory domains

[0161]

[0162]

[0163] Chimeric antigen receptors bind to target antigens. When T cell activation is measured in vitro or in vitro, target antigens can be obtained or isolated from various sources. As used herein, target antigens are antigens or immune epitopes on antigens that are crucial for immune recognition and ultimately elimination or control of pathogenic factors or disease states in mammals. Immune recognition can be cellular and / or bodily fluids. In the case of intracellular pathogens and cancers, immune recognition can be, for example, a T lymphocyte response.

[0164] The target antigen can be derived or isolated from, for example, an antigen of a viral microorganism, such as an antigen of a virus described herein. In some embodiments, the chimeric antigen receptor of the present invention binds to, for example, viruses including HIV (Korber et al., eds HIV Molecular Immunology Database, Los Alamos National Laboratory, Los Alamos, N.Mex. 1977), influenza, herpes, herpes simplex human papillomavirus (U.S. Patent No. 5,719,054), hepatitis B (U.S. Patent No. 5,780,036), hepatitis C (U.S. Patent No. 5,709,995), EBV, cytomegalovirus (CMV), and the like.

[0165] The target antigen can also be derived from or isolated from the pathogenic bacteria described herein. In some embodiments, the chimeric antigen receptor of the present invention binds to antigens such as those from Chlamydia (U.S. Patent No. 5,869,608), Mycobacterium, Legionella, Meningitis, Group A Streptococcus, Salmonella, Listeria, Haemophilus influenzae (U.S. Patent No. 5,955,596), etc.

[0166] In some embodiments, the target antigen can be derived or isolated from pathogenic yeasts, such as Aspergillus, Candida invasives (U.S. Patent No. 5,645,992), Nocardia, histoplasmosis, cryptosporidiosis, and the like.

[0167] In some embodiments, the target antigen can be derived or isolated from, for example, pathogenic protozoa and pathogenic parasites, including but not limited to Pneumocystis carinii, Trypanosomiasis, Leishmania (U.S. Pat. No. 5,965,242), Plasmodium (U.S. Pat. No. 5,589,343), and Asxoplasma gondii.

[0168] In some embodiments, the target antigen includes an antigen associated with a precancerous or proliferative state. The target antigen may also be associated with or caused by cancer. For example, in some embodiments, the chimeric antigen receptor of the present invention recognizes and binds to tumor antigens including TSAs and TAAs described above.

[0169] As used herein, the term "modulate" refers to a positive or negative change. Examples of modulation include 1%, 2%, 10%, 25%, 50%, 75%, or 100% change.

[0170] As used herein, the term "treatment" refers to clinical intervention aimed at altering the course of a disease in an individual or cell, and can be either preventative or interventional in the clinical pathological process. Therapeutic effects include, but are not limited to, preventing the onset or recurrence of a disease, alleviating symptoms, reducing any direct or indirect pathological consequences of a disease, preventing metastasis, slowing the progression of a disease, ameliorating or relieving the condition, and alleviating or improving the prognosis.

[0171] As used herein, the term "immunocompromised" refers to a subject with an immune deficiency that makes them susceptible to infection. Organisms that cause opportunistic infections do not normally cause illness in people with healthy immune systems but can infect people with a weakened or suppressed immune system.

[0172] As used herein, the term "constitutive expression" refers to expression under all physiological conditions.

[0173] The term "induced expression" as used herein refers to expression under certain conditions, such as when T cells bind to antigens. Those skilled in the art know how to perform conventional "induced expression."

[0174] In some embodiments, the present invention provides an immune response cell that expresses an antigen-binding receptor and exogenous type I interferon.

[0175] In some embodiments, the immune response cells of the present invention can target antigens expressed on cancer. Its antigens or epitopes can be expressed on cancer or cancer-related tissues. In some cases, the target antigen may be overexpressed on cancer and have reduced or no expression on normal tissues. In some cases, cancer-specific antigens and their epitopes can be targeted with the immune response cells of the present invention. Antigens can be derived from a variety of tumor antigens, such as tumor antigens produced by mutations, shared tumor-specific antigens, differentiation antigens, and antigens overexpressed in tumors. To give just a few examples, the antigens that can be targeted or bound by the immune response cells of the present invention may be or are derived from, including but not limited to: folate receptor α, 707-AP, adipophilin, AFP, AIM-2, ALDH1A1, Annexin II, ART-4, ARTC1, BAGE, BAGE-1, BCLX(L), BCMA, BING-4, BRACHYURY (IVS7 T / C polymorphism), BRACHYURY (TIVS7-2, polymorphism), BRACHYURY, B-RAF, CAMEL, CAR-ABL fusion protein (b3a2), CASP-5, CASP-8, Cdc27, CDC27 / m, CDK4, CDK-4 / m, CDKN2A, CEA, COA-1, CPSF, Cyp-B, DAM-6, -10, dek-can fusion protein, DKK1, EFTUD2, EGFR, ELF2M, ENAH (hMena), EP-CAM, EphA3, ESO-1 / LAGE-2, ETV6-AML1 fusion protein, ETV6 / AML, EZH2, FGF5, FLT3-ITD, FN1, G250, G250 / MN / CAIX, Gage 3,4,5,6,7,GAGE-1,2,8,GAGE-3,-4,-5,-6,-7B,GnT-V,GnTVf,Gp100,gp100 / Pmel17,GPC3,GPNMB,Her2 / neu,Her3,HERV-K-MEL,HLA-A1ld,HLA-A2d,HPV E6,HPV E7, hsp70-2, HSP70-2M, HST-2, hTERT, hTRT, iCE, IL13Rα2, KIAA0205, KK-LC-1, KM-HN-1, K-ras, LDLR / FUT, LDLR-fucosyltransferase fusion protein, MAGE-A1, MAGE-A10, MAGE-A12, MAGE-A2, MAGE-A3, MAGE-A4, MAGE-A6, MAGE-A9, MAGE-C2, MART-1, MART2, MC1R, M-CSFT, MCSP, mdm-2, ME1,Melan-A / MART-1, MMP-2, MUC1 (VNTR polymorphism)-c, MUC1, MUC1-n, MUC2, MUM-1, MUM-1f, MUM-2, MUM-3, NA-88, NA88-A, NFYC, N-ras, NY-BR-1, NY-ESO-1, OA1, OGT, OS-9, P15, p53, PAP, PBF, Pml / RARα and TEL / AML1pml-RARα fusion protein, PRAME, PRDX5, PSA, PSCA, PSMA, PTPRK, RAB38 / NY-MEL-1, RAGE, RAGE-1, RBAF600, RGS5, RNF43, RU1, RU2, RU2AS, SAGE, SART-1, SART-2, SART-3, secernin 1, SIRT2, SNRPD1, SOX10, Sp17, SSX-2, SSX-4, STEAP, STEAP1, SYT-SSX1- or -SSX2 fusion protein, TBRACHYURY, T, TAG-1, TAG-2, TGF-βRII, TPI / mbcr-abl, TRAG-3, TRP-2, TRP-1, TRP-1 / gp75, TRP-2, TRP-2 / INT2, TRP2-INT2g, VEGF and / or WT1, XA GE-1b, α-actinin-4, β-catenin, β-catenin / m, triphosphate isomerase, mammaglobulin-A, human papillomavirus (HPV), human epidermal growth factor receptor 2 (HER2 / neu), human epidermal growth factor receptor 3 (HER3), elongation factor 2, prostate-specific antigen (PSA), survivin, neo-PAP, kallikrein 4, alpha-fetoprotein, telomerase, mucin, cyclin D1, myosin / m, myosin I, intestinal carboxylesterase, caspase-8 / m, tyrosinase.

[0176] In addition, the immune response cells of the present invention can target tumor-associated antigens. Tumor-associated antigens can be antigens that are not normally expressed by the host, which may be mutated, truncated, misfolded or otherwise abnormally expressed by the molecules expressed by the host; they can be the same as the molecules that are normally expressed but expressed at abnormally high levels; or they can be expressed in an abnormal environment. Tumor-associated antigens can be, for example, proteins or protein fragments, complex carbohydrates, gangliosides, haptens, nucleic acids, other biomolecules or any combination thereof. In some cases, the antigen can be a new antigen (neo-antigen). The new antigen can be derived from a somatic mutation of a cancer cell. For example, the new antigen can be a mutant form of triphosphate isomerase (TPI). Mutated fibronectin (FN) is another example of a new antigen that can be targeted with the immune response cells of the present invention. The new antigen can be identified by a screening platform, such as biochemistry, full exo-cleavage sequencing, genetically targeted expression (GTE) or a combination thereof.

[0177] In some cases, the target that can be bound by the immune response cells of the present invention may be associated with the cancer stroma. The cancer stroma may be associated with the tumor microenvironment. The antigen can be a stromal antigen. For example, stromal antigens and epitopes can be present on, but not limited to, tumor endothelial cells, tumor vasculature, tumor fibroblasts, tumor pericytes, tumor stroma, and / or tumor mesenchymal cells. Those antigens can be selected, for example, from CD34, MCSP, FAP, CD31, PCNA, CD117, CD40, MMP4, and / or tenascin.

[0178] Tissue expression of the antigen can be measured by immunohistochemistry (IHC) analysis and / or flow cytometry. Tissue expression can also be measured by the copy number obtained by quantitative PCR (qPCR). In some cases, the target antigen can be expressed on the surface of cancer cells. In some cases, the targeted antigen may not be expressed in the environment of MHC or HLA. The immune response cells of the present invention can target cell surface antigens in a non-MHC restricted manner. In some cases, the antigen that can be targeted by CAR-T may be overexpressed compared to its expression on normal tissues. Measured by IHC, qPCR or flow cytometry, overexpression can be about 1 times, 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 20 times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times or up to 100 times the expression on normal tissues.

[0179] In some embodiments, the antigen-binding receptor comprises an antigen-binding domain (extracellular binding region) and an intracellular signaling domain capable of activating immune response cells. Preferably, a transmembrane region is further included between the antigen-binding domain and the intracellular signaling domain (intracellular signaling region). As an embodiment, the extracellular binding region comprises an antibody against an antigen, and the antigen is a tumor antigen or a pathogen antigen. Expressing the antigen-binding receptor on the surface of immune response cells can enable immune response cells to have a highly specific cytotoxic effect on tumor cells or pathogens expressing the antigen.

[0180] In some embodiments, the antigen-binding receptor of the present invention comprises a single-chain antibody connected to a transmembrane region, which is followed by an intracellular signaling region.

[0181] In some embodiments, the antigen binding domain of the present invention is a binding domain that binds to a tumor antigen. In some embodiments, the tumor antigen is a differentiation antigen selected from MART-1 / MelanA (MART-I), gp100 (Pmel17), tyrosinase, TRP-1, TRP-2, and tumor-specific multicentric antigens such as MAGE-1, MAGE-3, BAGE, GAGE-1, GAGE-2, p15; overexpressed embryonic antigens such as CEA; overexpressed oncogenes and mutated tumor suppressor genes such as p53, Ras, HER-2 / neu; unique tumor antigens caused by chromosomal translocations, such as BCR-ABL, E2A-PRL, H4-RET, IGH-IGK, and MYL-RAR; and viral antigens such as Epstein-Barr virus antigen EBVA and human papillomavirus (HPV) antigens E6 and E7. Other large, protein-based antigens include TSP-180, MAGE-4, MAGE-5, MAGE-6, RAGE, NY-ESO, p185erbB2, p180erbB-3, c-met, nm-23H1, PSA, TAG-72, CA 19-9, CA 72-4, CAM 17.1, NuMa, K-ras, β-catenin, CDK4, Mum-1, p15, p16, 43-9F, 5T4, 791Tgp72, alpha-fetoprotein, beta-HCG, BCA225, BTAA, CA 125, CA 15-3\CA 27.29\BCAA, CA 195, CA 242, CA-50, CAM43, CD68\P1, CO-029, FGF-5, G250, Ga733\EpCAM, HTgp-175, M344, MA-50, MG7-Ag, MOV18, NB / 70K, NY-CO-1, RCAS1, SDCCAG16, TA-90\Mac-2 binding protein\cyclophilin C-related protein, TAAL6, TAG72, TLP, and one or more of TPS.In some embodiments, the tumor antigen is selected from prostate-specific membrane antigen (PSMA), carcinoembryonic antigen (CEA), IL13Ralpha, HER-2, CD19, NY-ESO-1, HIV-1 Gag, Lewis Y, MART-1, gp100, tyrosinase, WT-I, hTERT, mesothelin, EGFR, EGFRvIII, glypican 3, EphA2, HER3, EpCAM, MUC1, MUC16, CLDN18.2, folate receptor, CLDN6, CD30, CD138, ASGPR1, CDH16, GD2, 5T4, 8H9, αvβ6 integrin, B cell maturation antigen (BCMA), B7-H3, B7-H6, CAIX, CA9, CD20, CD22, kappa light chain (kappa light chain), CD33, CD38, CD44, CD44v6, CD44v7 / 8, CD70, CD123, CD171, CSPG4, EGP2, EGP40, ERBB3, ERBB4, ErbB3 / 4, FAP, FAR, FBP, embryonic AchR, GD2, GD3, HLA-AI MAGE A1, MAGE3, HLA-A2, IL11Ra, KDR, Lambda, MCSP, NCAM, NKG2D ligand, PRAME, PSCA, PSC1, ROR1, Sp17, SURVIVIN, TAG72, TEM1, TEM8, VEGRR2, HMW-MAA, VEGF receptor, and / or one or more of fibronectin, tenascin, or oncofetal variants of tumor necrosis. In some embodiments, the tumor antigen is selected from one or more of prostate-specific membrane antigen, carcinoembryonic antigen, IL13Ralpha, HER-2, CD19, NY-ESO-1, HIV-1 Gag, Lewis Y, MART-1, gp100, tyrosinase, WT-I, hTERT, mesothelin, EGFR, EGFRvIII, glypican 3, EphA2, HER3, EpCAM, MUC1, MUC16, claudin 18.2, folate receptor, claudin 6, CD30, CD138, MAGE3, ASGPR1 and CDH16.

[0182] In some embodiments, the transmembrane region of the antigen-binding receptor can be selected from the transmembrane region of proteins such as CD8 or CD28. The human CD8 protein is a heterodimer composed of two chains, αβ or γδ. In some embodiments, the transmembrane region is selected from the transmembrane region of CD8α or CD28. In addition, the CD8α hinge region is a flexible region. Therefore, CD8 or CD28 and the transmembrane region plus the hinge region are used to connect the target recognition domain scFv of the antigen-binding receptor CAR and the intracellular signaling region.

[0183] The intracellular signaling domain of the present invention can be selected from CD3ζ, FcεRIγ, CD28 costimulatory signaling domain, CD137 costimulatory signaling domain, and a combination thereof. The CD3 molecule is composed of five subunits, of which the CD3ζ subunit (also known as CD3zeta, abbreviated as Z) contains 3 ITAM motifs, which are important signal transduction regions in the TCR-CD3 complex. In addition, as previously mentioned, CD28 and CD137 are costimulatory signal molecules, and the costimulatory effects produced by their intracellular signaling segments after binding to their respective ligands cause sustained proliferation of immune response cells (mainly T lymphocytes), and can increase the levels of cytokines such as IL-2 and IFN-γ secreted by immune response cells, thereby increasing the survival cycle and anti-tumor effects of CAR immune response cells in vivo. In some embodiments, the intracellular signal transduction domain is a combination of CD3ζ signaling domain or CD3ζ signaling domain with other costimulatory signals such as CD28.

[0184] In some embodiments, the immune response cell of the present invention may include an expression construct comprising the following elements sequentially linked: an antibody, a CD28 costimulatory signaling domain, CD3ζ, and, inversely linked to the aforementioned elements, an NFAT6 and type I interferon expression unit. Preferably, the antibody and the CD28 costimulatory signaling domain are linked via a CD8α transmembrane region and a CD8α hinge region.

[0185] In some embodiments, NFAT (Nuclear factor of activated T cells) plays an important role in the transcriptional expression of cytokines during T cell activation. Based on this consideration, the inventors placed the IFN-beta coding sequence under the regulation of the NFAT6 promoter, so that IFN-beta can only be expressed at high levels when CAR-T cells contact antigens to trigger T cell activation.

[0186] The NFAT6 promoter is a promoter composed of six NFAT binding sites and the minimal promoter of IL2 in series (Hooijberg E, Bakker AQ, Ruizendaal JJ, Spits H. NFAT-controlled expression of GFP permits visualization and isolation of antigen-stimulated primary human Tcells. Blood. 2000 Jul 15; 96(2): 459-66), which can be used to regulate the expression of cytokines such as IL12 in T lymphocytes such as TCR-T (Zhang L, Kerkar SP, Yu Z, Zheng Z, Yang S, Restifo NP, Rosenberg SA, Morgan RA. Improving adoptive T cell therapy by targeting and controlling IL-12 expression to the tumor environment. Mol Ther. 2011 Apr; 19(4): 751-9).

[0187] According to one aspect of the present invention, the present invention also includes nucleic acids encoding the antigen-binding receptors. The present invention also relates to variants of the above polynucleotides, which encode polypeptides or polypeptide fragments, analogs and derivatives having the same amino acid sequence as the present invention.

[0188] The present invention also provides a vector comprising the aforementioned nucleic acid encoding an antigen-binding receptor protein expressed on the surface of immune response cells. In one embodiment, the vector used in the present invention is a lentiviral plasmid vector pRRLSIN-cPPT.PGK-GFP.WPRE. It should be understood that other types of viral and non-viral vectors are also applicable.

[0189] The present invention also includes viruses comprising the above-described vectors. The viruses of the present invention include both packaged and infectious viruses and viruses ready for packaging that contain the necessary components for packaging into infectious viruses. Other viruses known in the art for transducing exogenous genes into immune response cells and their corresponding plasmid vectors may also be used in the present invention.

[0190] The immune response cells of the present invention are transduced with a construct, expression vector, or virus containing the plasmid that expresses an antigen-binding receptor and exogenous type I interferon. Conventional nucleic acid transduction methods in the art, including non-viral and viral transduction methods, can be used in the present invention.

[0191] The immune response cells described herein may further carry coding sequences for exogenous cytokines, including but not limited to IL-12, IL-15, or IL-21. These cytokines possess further immunomodulatory or anti-tumor activity, enhancing the function of effector T cells and activated NK cells, or directly exerting anti-tumor effects. Therefore, those skilled in the art will appreciate that the use of these cytokines can help the immune response cells function more effectively.

[0192] The immune response cells of the present invention may further express another antigen-binding receptor in addition to the above-mentioned antigen-binding receptors.

[0193] The immune response cells of the present invention may also express chemokine receptors; such chemokine receptors include but are not limited to CCR2. Those skilled in the art will appreciate that the CCR2 chemokine receptor can allow CCR2 in the body to competitively bind to it, which is beneficial for blocking tumor metastasis.

[0194] The immune response cells described herein may also express siRNA that reduces PD-1 expression or proteins that block PD-L1. Those skilled in the art will appreciate that competitively blocking the interaction between PD-L1 and its receptor PD-1 is beneficial for restoring anti-tumor T cell responses, thereby inhibiting tumor growth.

[0195] The immune response cells of the present invention may further express a safety switch; preferably, the safety switch comprises: iCaspase-9, Truancated EGFR or RQR8.

[0196] In some embodiments, the immune response cells of the invention do not express co-stimulatory ligands such as 4-1BBL.

[0197] A transgene encoding a receptor or CAR for a target binding antigen can be incorporated into a cell. For example, a transgene can be incorporated into an immune response cell, such as a T cell. When inserted into a cell, the transgene can be a complementary DNA (cDNA) fragment, which is a copy of a messenger RNA (mRNA); or the gene itself (with or without introns) located in the original region of its genomic DNA.

[0198] Nucleic acids, such as DNA, encoding transgenic sequences can be randomly inserted into the chromosomes of cells. Random integration can occur by any method for introducing nucleic acids (e.g., DNA) into cells. For example, such methods can include, but are not limited to, electroporation, ultrasound, use of a gene gun, lipofection, calcium phosphate transfection, use of dendrimers, microinjection, and use of viral vectors including adenovirus, AAV, and retroviral vectors, and / or type II ribozymes.

[0199] The DNA encoding the transgene can also be designed to include a reporter gene so that the presence of the transgene or its expression product can be detected by activation of the reporter gene. Any reporter gene can be used, such as those described above. By selecting cells in cell culture in which the reporter gene has been activated, cells containing the transgene can be selected.

[0200] The expression of CAR can be verified by expression assays, such as qPCR or by measuring the level of RNA. The expression level can also indicate the copy number. For example, if the expression level is very high, this can indicate that more than one copy of the CAR is integrated into the genome. Alternatively, high expression can indicate that the transgene is integrated in a highly transcribed region, such as near a highly expressed promoter. Expression can also be verified by measuring protein levels, such as by Western blotting.

[0201] In some embodiments, the immune response cells of the present invention may include one or more transgenes. The one or more transgenes may express a CAR protein, and the CAR protein recognizes and binds to at least one epitope on an antigen or a mutant epitope on a binding antigen. CAR may be a functional CAR. In some embodiments, the immune response cells of the present invention may include one or more CARs, or they may include a single CAR and a secondary engineered receptor.

[0202] In some embodiments, transgenic can encode suicide genes. As demonstrated by many effective treatments for cancer patients, CAR immune response cells cause tumor regression but can be accompanied by toxicity. In some embodiments, when the target antigen is shared between normal tissue and tumor cells, CAR immune response cells may not be able to distinguish between tumors and normal tissues ("on-target / off-target toxicity"). In other cases, systemic perturbations of the immune system may occur, known as cytokine release syndrome (CRS). The CRS may include systemic inflammatory response syndrome or cytokine storm, which may be the consequence of rapid expansion of CAR immune response cells in vivo. CRS is a disease characterized by fever and hypotension, and severe cases can lead to multiple organ failure. In most cases, the toxicity is associated with the in vivo amplification of the infused CAR immune response cells, which can cause overall perturbations of the immune system and release high levels of proinflammatory cytokines, such as TNFα and IL-6. Suicide genes can induce the elimination of CAR immune reactive cells. Suicide genes can be any genes that induce apoptosis in the CAR immune reactive cells. Suicide genes can be encoded in viral vectors together with the receptors for the antigen binding. Encoding suicide genes can, under certain circumstances, alleviate or completely terminate the toxicity caused by the in vivo expansion of infused CAR immune response cells.

[0203] In some embodiments, CAR immune reactive cells can be produced for antigens present in normal tissues so that they transiently express CAR, for example after electroporation of mRNA encoding the receptor. In addition, by including a safety switch to further enhance the significant efforts of CAR immune reactive cells, CAR immune reactive cells can be greatly eliminated in the case of severe on-target toxicity. The vector encoding CAR can be combined with a safety switch such as an inducible caspase-9 gene (activated by a dimerization chemical inducer) or a truncated form of the EGF receptor R (activated by the monoclonal antibody cetuximab) or RQR8.

[0204] The one or more transgenes used herein can be from different species. For example, the one or more transgenes can comprise human genes, mouse genes, rat genes, pig genes, cattle genes, dog genes, cat genes, monkey genes, chimpanzee genes, or any combination thereof. For example, the transgene can be from a human with human genetic sequences. The one or more transgenes can comprise human genes. In some cases, the one or more transgenes are not adenoviral genes.

[0205] As mentioned above, transgenic can be inserted into the genome of immunoreactive cells in a random or site-specific manner. For example, transgenic can be inserted into a random site in the genome of an immune cell. These transgenics can be functional, for example, fully functional when inserted into any place in the genome. For example, transgenic can encode its own promoter, or can be inserted into the position controlled by its internal promoter. Alternatively, transgenic can be inserted into a gene, such as an intron of a gene or an exon, promoter or non-coding region of a gene. Transgenic can be inserted so that a gene is destroyed by insertion, such as an endogenous immune checkpoint.

[0206] In some embodiments, more than one copy of the transgene can be inserted into multiple random sites within the genome. For example, multiple copies can be inserted into random sites within the genome. This can result in increased overall expression compared to a single random insertion of the transgene. Alternatively, one copy of the transgene can be inserted into a gene, and another copy of the transgene can be inserted into a different gene. The transgene can be targeted so that it can be inserted into a specific site in the genome of an immunoreactive cell.

[0207] In some embodiments, the polynucleic acid comprising a sequence encoding an antigen-binding receptor may be in the form of a plasmid vector. The plasmid vector may comprise a promoter. In some cases, the promoter may be constitutive. In some embodiments, the promoter is inducible. The promoter may be or may be derived from CMV, U6, MND, or EF1a. In some embodiments, the promoter may be adjacent to the CAR sequence. In some embodiments, the plasmid vector further comprises a splice acceptor. In some embodiments, the splice acceptor may be adjacent to the CAR sequence. The promoter sequence may be a PKG or MND promoter. The MND promoter may be a synthetic promoter containing the U3 region of the MoMuLV LTR modified with a myeloproliferative sarcoma virus enhancer.

[0208] In some embodiments, the polynucleic acid encoding the receptor of interest can be designed to be delivered to cells by non-viral techniques. In some cases, the polynucleic acid can be a good manufacturing practice (GMP) compatible reagent.

[0209] The expression of the polynucleic acid encoding the target antigen-binding receptor or CAR can be controlled by one or more promoters. The promoter can be ubiquitous, constitutive (unrestricted promoter, allowing continuous transcription of related genes), tissue-specific promoter or inducible promoter. The expression of a transgene inserted adjacent to or near the promoter can be regulated. For example, the transgene can be inserted near or next to a ubiquitous promoter. Some ubiquitous promoters can be CAGGS promoter, hCMV promoter, PGK promoter, SV40 promoter or ROSA26 promoter.

[0210] The promoter can be endogenous or exogenous. For example, one or more transgenes can be inserted adjacent to or near an endogenous or exogenous ROSA26 promoter. In addition, the promoter can be specific for immunoreactive cells. For example, one or more transgenes can be inserted adjacent to or near the porcine ROSA26 promoter.

[0211] Tissue-specific promoters or cell-specific promoters can be used to control the location of expression. For example, one or more transgenes can be inserted adjacent to or near a tissue-specific promoter. The tissue-specific promoter can be a FABP promoter, a Lck promoter, a CamKII promoter, a CD19 promoter, a keratin promoter, an albumin promoter, aP2 promoter, an insulin promoter, a MCK promoter, a MyHC promoter, a WAP promoter, or a Col2A promoter.

[0212] Inducible promoters can also be used. If desired, these inducible promoters can be turned on and off by adding or removing an inducing agent. Expected inducible promoters can be, but are not limited to, Lac, tac, trc, trp, araBAD, phoA, recA, proU, cst-1, tetA, cadA, nar, PL, cspA, T7, VHB, Mx, and / or Trex.

[0213] The term "inducible promoter" as used herein is a controlled promoter that does not express or underexpresses a gene to which it is operably connected before the desired conditions are met, and expresses or expresses a gene to which it is operably connected at a high level when the desired conditions are met. For example, in some embodiments, the inducible promoter of the present application does not express or underexpresses a gene to which it is operably connected under normal or high oxygen levels in the cell, and in response to reduced oxygen levels in the cell, expresses or overexpresses a gene to which it is operably connected under hypoxic conditions. In some embodiments, the inducible promoter used herein includes hypoxia-inducible transcription factor-1α (HIF-1α). In some embodiments, the term "inducible promoter" used herein refers to an "immune cell inducible promoter" that does not express or underexpresses a gene to which it is operably connected before the immune response cell contacts an antigen or the immune response cell is not activated, and only when the immune response cell contacts an antigen or the immune response cell is activated will the gene to which it is operably connected be driven to be expressed at a high level or expressed under conditions such as hypoxia. In some embodiments, the "immune cell-inducible promoter" includes an NFAT (nuclear factor of activated T cells) type promoter.

[0214] As used herein, "NFAT-type promoter" refers to a type of promoter that regulates the expression of a gene operably linked thereto based on NFAT binding activity.

[0215] NFAT is a family of transcription factors that play a crucial role in immune responses. One or more members of the NFAT family are expressed in most cells of the immune system. NFAT is also involved in the development of the heart, skeletal muscle, and nervous system.

[0216] The NFAT transcription factor family consists of five members: NFAT1, NFAT2, NFAT3, NFAT4, and NFAT5. NFAT1 to NFAT4 are regulated by calcium signals. Calcium signals are crucial for NFAT activation because calmodulin (CaM) activates the serine / threonine phosphatase calcineurin (CN). Activated CN rapidly dephosphorylates the serine-rich region (SRR) and SP repeats at the amino terminus of the NFAT protein, leading to conformational changes that expose nuclear localization signals and cause NFAT to be imported into the nucleus.

[0217] Based on the role of NFAT in the transcriptional expression of cytokines during T cell activation, it can be used to regulate the immune cell inducible promoter described herein, thereby expressing or expressing at high levels the genes operably linked thereto when immune response cells are activated by contact with antigens.

[0218] The nucleic acid of the present invention may comprise any suitable nucleotide sequence encoding an NFAT-type promoter (or a functional portion or functional variant thereof). As used herein, "NFAT-type promoter" refers to one or more NFAT response elements linked to the minimal promoter of any gene expressed by T cells. Preferably, the minimal promoter of a gene expressed by T cells is the minimal human IL-2 promoter. NFAT response elements may include, for example, NFAT1, NFAT2, NFAT3, and / or NFAT4 response elements. In some embodiments, the "NFAT-type promoter" described herein may include more than one NFAT binding motif. For example, the "NFAT-type promoter" may include 2, 3, 4, 5, 6, 7, 8, 9, 10, or more NFAT binding motifs. In some embodiments, the "NFAT-type promoter" may include up to 12 NFAT binding motifs. In some embodiments, the "NFAT-type promoter" may be a promoter consisting of multiple NFAT binding motifs in series with a promoter, such as the IL2 minimal promoter. In some embodiments, the NFAT-type promoter described herein includes 6 NFAT binding motifs, denoted as (NFAT) 6. For the purpose of convenience, the (NFAT) 6 is also denoted as NFAT6. In some embodiments, the NFAT6 also represents the 6 repeated NFAT binding motifs (SEQ ID NO: 78) in the NFAT-type promoter.

[0219] Additionally, although not required for expression, the transgenic sequence may also include transcriptional or translational regulatory sequences, such as promoters, enhancers, insulators, internal ribosome entry sites, sequences encoding 2A peptides and / or polyadenylation signals.

[0220] In some embodiments, the transgenic encoding target antigen-binding receptor or CAR, wherein the transgenic is inserted into a safe harbor so that the antigen-binding receptor is expressed. In some embodiments, the transgenic is inserted into the PD1 and / or CTLA-4 locus. In other cases, the transgenic is delivered to the cell with a lentivirus for random insertion, and the PD1- or CTLA-4 specific nuclease can be provided as mRNA. In some embodiments, the transgenic is delivered by a viral vector system such as a retrovirus, AAV or adenovirus and mRNA encoding a nuclease (such as AAVS1, CCR5, albumin or HPRT) specific for the safe harbor. Cells can also be treated with mRNA encoding PD1 and / or CTLA-4 specific nuclease. In some embodiments, the polynucleotide encoding CAR is provided together with mRNA encoding HPRT specific nuclease and PD1- or CTLA-4 specific nuclease by a viral delivery system. The CAR that can be used with the methods and compositions disclosed herein can include all types of these chimeric proteins, including the first, second and third generation designs described herein.

[0221] In some embodiments, retroviral vectors (gamma-retrovirus or slow virus vectors) can be used to introduce transgenes into immunoreactive cells. For example, any receptor or variant or fragment encoding a CAR transgene or antigen-binding antigen can be cloned into a retroviral vector and can be driven by its endogenous promoter, retroviral long terminal repeats, or promoters specific to the target cell type. Non-viral vectors can also be used. Non-viral vector delivery systems can include DNA plasmids, naked nucleic acids, and nucleic acids compounded with delivery vectors such as liposomes or poloxamer.

[0222] Many virus-based systems have been developed for transferring genes into mammalian cells. For example, retroviruses provide a convenient platform for gene delivery systems. The selected gene can be inserted into a vector and packaged in retroviral particles using techniques known in the art. Vectors derived from retroviruses such as lentiviruses are suitable tools for achieving long-term gene transfer because they allow long-term stable integration of transgenes and their propagation in daughter cells. Lentiviral vectors have additional advantages over vectors derived from retroviruses such as murine leukemia viruses because they can transduce non-proliferating cells. They also have the additional advantage of low immunogenicity. The advantage of adenoviral vectors is that they do not fuse into the genome of the target cell, thereby bypassing negative integration-related events.

[0223] Can be with the transgenic transfection cell of the receptor of described binding antigen encoding.Transgenic concentration can be about 100 picograms to about 50 micrograms.In some embodiments, the amount of nucleic acid (for example, ssDNA, dsDNA or RNA) introduced into cell can be changed to optimize transfection efficiency and / or cell viability.For example, 1 microgram dsDNA can be added to each cell sample for electroporation.In some embodiments, the amount of nucleic acid (for example, double-stranded DNA) required for optimal transfection efficiency and / or cell viability is different according to cell type.In some embodiments, the amount of nucleic acid (for example, dsDNA) for each sample can directly correspond to transfection efficiency and / or cell viability.For example, a series of transfection concentrations.Transgenic encoded by vector can be integrated into cell genome.In some embodiments, transgenic forward integration by vector encoding.In other cases, by reverse integration of transgenic encoded by vector.

[0224] In some embodiments, the immunoreactive cells may be stem memory T cells composed of CD45RO(-), CCR7(+), CD45RA(+), CD62L+ (L-selectin), CD27+, CD28+, and / or IL-7Rα+. SCM The stem memory cells may also express CD95, IL-2Rβ, CXCR3 and / or LFA-1 and exhibit many functional attributes different from those of the stem memory cells. Alternatively, the immune reactive cells may also be central memory T cells containing L-selectin and CCR7. CM Cells, among which central memory cells can secrete, for example, IL-2, but not IFNγ or IL-4. Immunoreactive cells can also be effector memory T cells containing L-selectin or CCR7. EM cells and produce, for example, effector cytokines such as IFNγ and IL-4.

[0225] The vector is typically delivered to an individual patient by systemic administration (e.g., intravenous, intraperitoneal, intramuscular, subcutaneous, or intracranial infusion) or topical application, as described below. Alternatively, the vector can be delivered ex vivo to cells, such as cells removed from an individual patient (e.g., lymphocytes, T cells, bone marrow aspirates, tissue biopsies), which are then typically reimplanted into the patient after selecting cells that have incorporated the vector. Before or after selection, the cells can be expanded.

[0226] Suitable immunoreactive cells expressing a receptor that binds the antigen may be autologous or non-autologous to the individual in need thereof.

[0227] The source of suitable immune response cells can be obtained from an individual. In some cases, T cells can be obtained. The T cells can be obtained from many sources, including PBMC, bone marrow, lymph node tissue, umbilical cord blood, thymus tissue, and tissue from infection sites, ascites, pleural effusion, spleen tissue, and tumors. In some cases, any number of techniques known to those skilled in the art, such as Ficoll, can be used. TM Isolation, T cells are obtained from blood collected from the individual. In one embodiment, cells from the circulating blood of an individual are obtained by apheresis. Apheresis products typically contain lymphocytes, including T cells, monocytes, granulocytes, B cells, other nucleated white blood cells, red blood cells, and platelets. In one embodiment, cells collected by apheresis can be washed to remove the plasma fraction and the cells placed in a suitable buffer or culture medium for subsequent processing steps.

[0228] Alternatively, cells can be derived from healthy donors, from patients diagnosed with cancer, or from patients diagnosed with infection. In some embodiments, the cells can be part of a mixed cell population with different phenotypic characteristics. Cell lines can also be obtained from transformed T cells according to the aforementioned methods. Cells can also be obtained from a cell therapy library. Modified cells resistant to immunosuppressive therapy can be obtained by any of the methods described herein. Suitable cell populations can also be selected before modification. Engineered cell populations can also be selected after modification. Engineered cells can be used for autologous transplantation. Alternatively, cells can be used for allogeneic transplantation. In some embodiments, the cells are administered to the same patient whose sample is used to identify cancer-associated target sequences. In other cases, the cells are administered to a patient different from the patient whose sample is used to identify cancer-associated target sequences.

[0229] In some embodiments, suitable primary cells include peripheral blood mononuclear cells (PBMC), peripheral blood lymphocytes (PBL) and other blood cell subsets, such as but not limited to T cells, natural killer cells, monocytes, natural killer T cells, monocyte precursor cells, hematopoietic stem cells or non-pluripotent stem cells. In some embodiments, the cell can be any immune cell, including any T cell such as tumor infiltrating cells (TIL), such as CD3+T cells, CD4+T cells, CD8+T cells or any other type of T cells. T cells can also include memory T cells, memory stem T cells or effector T cells. T cells can also be selected from a large number of populations, such as selecting T cells from whole blood. T cells can also be expanded from a large number of populations. T cells may also tend to specific populations and phenotypes. For example, T cells can be inclined to phenotypes comprising CD45RO(-), CCR7(+), CD45RA(+), CD62L(+), CD27(+), CD28(+) and / or IL-7Rα(+). Suitable cells can be selected from one or more markers in the following list: CD45RO(-), CCR7(+), CD45RA(+), CD62L(+), CD27(+), CD28(+) and / or IL-7Rα(+). Suitable cells also include stem cells, for example, embryonic stem cells, induced pluripotent stem cells, hematopoietic stem cells, neuronal stem cells and mesenchymal stem cells. Suitable cells can include any number of primary cells, such as human cells, non-human cells and / or mouse cells. Suitable cells can be progenitor cells. Suitable cells can be derived from the subject to be treated (e.g., patient).

[0230] The amount of therapeutically effective cells required in a patient can vary according to the viability of the cells and the efficiency with which the cells are genetically modified (e.g., the efficiency with which the transgene is integrated into one or more cells, or the expression level of the protein encoded by the transgene). In some embodiments, the product of cell viability after genetic modification (e.g., multiplication) and the efficiency of transgene integration can correspond to the therapeutic amount of cells that can be used to administer to a subject. In some embodiments, an increase in cell viability after genetic modification may correspond to a reduction in the amount of cells necessary for administering a treatment that is effective for the patient. In some embodiments, an increase in the efficiency with which the transgene is integrated into one or more cells may correspond to a reduction in the number of cells necessary for administering a treatment that is effective in the patient. In some embodiments, determining the amount of therapeutically effective cells required can include determining a function associated with changes in the cells over time. In some embodiments, determining the amount of therapeutically effective cells required can include determining a function corresponding to changes in the efficiency with which the transgene is integrated into one or more cells according to time-related variables (e.g., cell culture time, electroporation time, cell stimulation time). In some embodiments, therapeutically effective cells can be a cell population comprising about 30% to about 100% expression of antigen-binding receptors on the cell surface. In some embodiments, therapeutically effective cells may express about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% or more of the antigen-binding receptor on the cell surface as measured by flow cytometry.

[0231] In some embodiments, when the antigen-binding receptor is present on the plasma membrane of a cell, and when activated by binding to a target, it is possible to cause the toxicity of a cell with a target that the antigen-binding receptor can bind to for its cell surface expression. For example, in some cases, when a cell is present in the plasma membrane of a cell, the cell can be a cytotoxic cell (e.g., NK cell or cytotoxic T lymphocyte), an antigen-binding receptor as described herein, and when it is activated by binding to its target, the cytotoxic activity of cytotoxic cells to target cells can be increased. For example, in some embodiments, an antigen-binding receptor as described herein, when activated by the combination of its target, can increase cytotoxicity by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 75%, at least 2 times, at least 2.5 times, at least 5 times, at least 10 times or more 10 times compared to the cytotoxicity of cells that do not have a target.

[0232] The immune response cells of the present invention can be used to prepare pharmaceutical compositions. In addition to an effective amount of the immune response cells, the pharmaceutical compositions can also include a pharmaceutically acceptable carrier. The term "pharmaceutically acceptable" means that when the molecules and compositions are appropriately administered to animals or humans, they do not produce adverse, allergic, or other untoward reactions.

[0233] Specific examples of some substances that can serve as pharmaceutically acceptable carriers or components thereof are sugars, such as lactose, glucose, and sucrose; starches, such as corn starch and potato starch; cellulose and its derivatives, such as sodium carboxymethylcellulose, ethylcellulose, and methylcellulose; tragacanth powder; malt; gelatin; talc; solid lubricants, such as stearic acid and magnesium stearate; calcium sulfate; vegetable oils, such as peanut oil, cottonseed oil, sesame oil, olive oil, corn oil, and cocoa butter; polyols, such as propylene glycol, glycerol, sorbitol, mannitol, and polyethylene glycol; alginic acid; emulsifiers, such as Wetting agents, such as sodium lauryl sulfate; coloring agents; flavoring agents; tableting agents, stabilizers; antioxidants; preservatives; pyrogen-free water; isotonic saline solution; and phosphate buffered saline.

[0234] The compositions of the present invention can be prepared into various dosage forms as needed, and a physician can determine the dosage that is beneficial to the patient based on factors such as the patient's type, age, weight, general condition, and administration method. The administration method can be, for example, parenteral administration (e.g., injection) or other treatment methods.

[0235] "Parenteral" administration of the immunogenic composition includes, for example, subcutaneous (sc), intravenous (iv), intramuscular (im) or intrasternal injection or infusion techniques.

[0236] A formulation comprising a population of immunoreactive cells administered to an individual comprises a plurality of immunoreactive cells effective for treating and / or preventing a particular indication or disease. Thus, a therapeutically effective population of immunoreactive cells can be administered to an individual. Typically, administration comprises approximately 1×10 4 to about 1×10 10 In most cases, the preparation will contain approximately 1 × 10 5 to about 1×10 9 Immunoreactive cells, about 5×10 5 to about 5×10 8 immunoreactive cells, or approximately 1×10 6 to about 1×10 7 However, the number of CAR-immunoreactive cells administered to an individual will vary widely depending on the location, origin, identity, extent, and severity of the cancer, the age and physical condition of the individual to be treated, etc. The physician will ultimately determine the appropriate dosage to use.

[0237] In some embodiments, chimeric antigen receptors are used to stimulate immune cell-mediated immune responses. For example, a T cell-mediated immune response is an immune response involving T cell activation. Activated antigen-specific cytotoxic T cells are able to induce apoptosis in target cells that display foreign antigen epitopes on their surfaces, such as cancer cells that display tumor antigens. In another embodiment, chimeric antigen receptors are used to provide anti-tumor immunity in mammals. Due to the T cell-mediated immune response, the subject will develop anti-tumor immunity.

[0238] In some cases, a method for treating a subject with cancer may involve administering one or more immune response cells of the present invention to a subject in need of treatment. The immune response cells can bind to tumor target molecules and induce cancer cell death. As previously described, the present invention also provides a method for treating a pathogen infection in an individual, comprising administering to the individual a therapeutically effective amount of the immune response cells of the present invention.

[0239] The frequency of administration of the immunoreactive cells of the present invention will depend on the factors including the disease being treated, the elements of the specific immunoreactive cells, and the mode of administration. For example, administration can be 4 times, 3 times, 2 times a day, or once a day, every other day, every three days, every four days, every five days, every six days, once a week, every eight days, every nine days, every ten days, once a week, or twice a month. As described herein, because the immune response cells of the present application have improved viability, they can be administered not only in a therapeutically effective amount lower than similar immune response cells that do not express exogenous type I interferon, but also at a lower frequency to obtain at least similar, and preferably more significant, therapeutic effects.

[0240] In some embodiments, the immune response cells of the present invention can be administered in combination with another therapeutic agent. In some embodiments, the other therapeutic agent is a chemotherapeutic agent. Chemotherapeutic agents that can be used in combination with the immune response cells of the present invention include, but are not limited to, mitotic inhibitors (vinca alkaloids), including vincristine, vinblastine, vindesine, and novibin (TM) (vinorelbine, 5'-dehydrogen sulfide); topoisomerase I inhibitors, such as camptothecin compounds, including Camptosar; TM (Irinotecan HCL), Hycamtin TM(topotecan HCL) and other compounds derived from camptothecin and its analogs; podophyllotoxin derivatives, such as etoposide, teniposide, and midoxetine; alkylating agents cisplatin, cyclophosphamide, nitrogen mustard, trimethylenethiophosphamide, carmustine, busulfan, chlorambucil, brequizine, uracil mustard, cloprofen, and dacarbazine; antimetabolites, including cytarabine, fluorouracil, methotrexate, mercaptopurine, azathioprine, and procarbazine; antibiotics, including but not limited to doxorubicin, bleomycin, dactinomycin, daunorubicin, mycobacterium cyclin, mitomycin, sarcoma mycin C, and daunorubicin; and other chemotherapeutic agents, including but not limited to anti-tumor antibodies, dacarbazine, azacytidine, amoxazolidinone, melphalan, ifosfamide, and mitoxantrone.

[0241] In some embodiments, chemotherapeutic drugs that can be used in combination with the immune response cells of the present invention include, but are not limited to, anti-angiogenic agents, including anti-VEGF antibodies (including humanized and chimeric antibodies, anti-VEGF aptamers and antisense oligonucleotides) and other angiogenesis inhibitors, such as angiostatin, endostatin, interferon, interleukin 1 (including α and β) interleukin 12, retinoic acid and tissue inhibitors of metalloproteinases-1 and -2.

[0242] In some embodiments, compositions can be isotonic, that is, they can have the osmotic pressure identical with blood and tear fluid.The expectation isotonicity of the present composition can use sodium chloride or other pharmaceutically acceptable reagents such as glucose, boric acid, sodium tartrate, propylene glycol or other inorganic or organic solutes to realize.If necessary, the viscosity of compositions can use pharmaceutically acceptable thickening agent to maintain selected level.Suitable thickening agent includes, for example, methylcellulose, xanthan gum, carboxymethyl cellulose, hydroxypropyl cellulose, carbomer etc.The preferred concentration of thickening agent will depend on selected reagent.Obviously, the selection of suitable carrier and other additives will depend on the character of definite route of administration and specific dosage form, for example liquid dosage form.

[0243] The present invention also provides a kit comprising the immune response cells of the present invention. The kit can be used to treat or prevent cancer, pathogen infection, immune disorder or allogeneic transplantation. In one embodiment, the kit may include a therapeutic or preventive composition containing an effective amount of immune response cells comprising one or more unit dosage forms. In some embodiments, the kit comprises a sterile container that may contain a therapeutic or preventive composition; such a container may be a box, ampoule, bottle, vial, tube, bag, blister pack or other suitable container form known in the art. Such a container may be made of plastic, glass, laminated paper, metal foil or other material suitable for holding drugs. In some embodiments, immune reactive cells, such as CAR T cells, and instructions for administering CAR immune reactive cells to a subject at risk of developing cancer, pathogen infection, immune disorder or allogeneic transplantation may be provided. The instructions will generally include information about the use of the composition for treating or preventing cancer, pathogen infection, immune disease or allogeneic transplantation. In some embodiments, the kit may include approximately 1×10 4 cells to about 1×10 6 In some embodiments, the kit may include at least about 1×10 5 cells, at least about 1×10 6 cells, at least about 1×10 7 cells, at least about 4 × 10 7 cells, at least about 5×10 7 cells, at least about 6×10 7 cells, at least about 6×10 7 cells, 8×10 7 cells, at least about 9×10 7 cells, at least about 1×10 8 cells, at least about 2×108 cells, at least about 3×10 8 cells, at least about 4 × 10 8 cells, at least about 5×10 8 cells, at least about 6×10 8 cells, at least about 6×10 8 cells, at least about 8 × 10 8 cells, at least about 9×10 8 cells, at least about 1 × 10 9 cells, at least about 2×10 9 cells, at least about 3×10 9 cells, at least about 4 × 10 9 cells, at least about 5×10 9 cells, at least about 6×10 9 cells, at least about 8×10 9cells, at least about 9×10 9 cells, at least about 1×10 10 cells, at least about 2×10 10 cells, at least about 3×10 10 cells, at least about 4 × 10 10 cells, at least about 5×10 10 cells, at least about 6×10 10 cells, at least about 9 × 10 10 cells, at least about 9×10 10 cells, at least about 1×10 11 cells, at least about 2×10 11 cells, at least about 3×10 11 cells, at least about 4 × 10 11 cells, at least about 5×10 11 cells, at least about 8×10 11 cells, at least about 9×10 11 cells, or at least about 1 × 10 12 For example, approximately 5×10 10 In another example, the kit may include 3×10 6 cells; cells can be expanded to about 5×10 10 cells and administered to a subject.

[0244] In some embodiments, the kit may include allogeneic cells. In some embodiments, the kit may include cells that may include genomic modifications. In some embodiments, the kit may include "off-the-shelf" cells. In some embodiments, the kit may include cells that can be expanded for clinical use. In some cases, the kit may include contents for research purposes.

[0245] In some embodiments, the instructions include at least one of the following: a description of the therapeutic agent; dosage regimens and administration for treating or preventing tumors, pathogen infections, immune diseases, or allogeneic transplants or symptoms thereof; precautions, warnings, contraindications, overdose information, adverse reactions, animal pharmacology, clinical studies, and / or references. The instructions can be printed directly on the container (if any), or as a label on the container, or as a separate paper, brochure, card, or folder provided within or in the container. In some embodiments, the instructions provide methods for administering the immune response cells described herein for treating or preventing tumors, pathogen infections, immune diseases, or allogeneic transplants or symptoms thereof. In some cases, the instructions provide methods for administering the immune response cells of the present invention before, after, or simultaneously with the administration of a chemotherapeutic agent.

[0246] According to one aspect of the present invention, the present invention also provides a method for treating a tumor or pathogen infection in an individual, or for enhancing an individual's immune tolerance. In some embodiments, the method comprises administering the immune response cells of the present invention to an individual in need thereof, wherein the immune cells express the antigen-binding receptor and exogenous type I interferon. In some embodiments, the method comprises administering the antigen-binding receptor of the present invention and exogenous type I interferon to an individual in need thereof. In some embodiments, the exogenous type I interferon and the immune response cells expressing the antigen-binding receptor are administered sequentially or simultaneously. In some embodiments, the exogenous type I interferon is co-expressed in the immune response cells and administered to the patient simultaneously with the immune response cells.

[0247] The present invention provides a method for increasing the viability of immune response cells administered to an individual, wherein the immune response cells express the antigen-binding receptor described herein, and wherein the method comprises administering to the individual the immune response cells and an effective amount of exogenous type I interferon. In some embodiments, the exogenous type I interferon is administered sequentially or simultaneously with the immune response cells expressing the antigen-binding receptor. In some embodiments, the exogenous type I interferon is co-expressed in the immune response cells and administered to the patient simultaneously with the immune response cells.

[0248] In some embodiments, because the viability of the immune response cells of the present invention is improved, the immune response cells of the present invention can be administered at a lower dose and / or lower frequency compared to when exogenous type I interferon is not administered or when the immune response cells do not co-express the exogenous type I interferon.

[0249] In some embodiments, the amount of the immune response cells of the invention administered to an individual in need thereof is reduced by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% compared to when no exogenous type I interferon is administered or when the immune response cells do not co-express the exogenous type I interferon. In some embodiments, the frequency of the immune response cells of the invention administered to an individual in need thereof is reduced by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% compared to when no exogenous type I interferon is administered or when the immune response cells do not co-express the exogenous type I interferon. Alternatively, where multiple administrations of the immune response cells of the present invention are required to an individual in need thereof, the time interval between each administration is extended by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 160%, 180%, 200%, 500%, 750%, 1000% compared to when exogenous type I interferon is not administered or when the immune response cells do not co-express the exogenous type I interferon.

[0250] In some embodiments, the methods of the invention result in an increase in the combined number of cytotoxic T cells and helper T cells in the peripheral blood of the individual by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 160%, 180%, 200%, 500%, 750%, 1000% following administration of the immune response cells to the individual, compared to the absence of the exogenous type I interferon. In some embodiments, the method is such that about 5 days after administering the immune response cells to the individual, the sum of the number of cytotoxic T cells and helper T cells in the individual's peripheral blood is greater than 5,000 cells / μL, 10,000 cells / μL, 15,000 cells / μL, 20,000 cells / μL, or 25,000 cells / μL; about 7 days after administering the immune response cells, the sum of the number of cytotoxic T cells and helper T cells in the individual's peripheral blood is greater than 100 cells / μL, 200 cells / μL, 300 cells / μL, 400 cells / μL, 500 cells / μL, 600 cells / μL, 700 cells / μL, or 800 cells / μL. / μL, 900 / μL, 1,000 / μL, 1,500 / μL, 2,000 / μL, 2,500 / μL, 3,000 / μL, 3,500 / μL, 4,000 / μL, 4,500 / μL, or 5,000 / μL; or about 10 days after administration of the immune response cells, the sum of the number of cytotoxic T cells and helper T cells in the individual's peripheral blood is greater than 10 / μL, 20 / μL, 30 / μL, 40 / μL, 50 / μL, 60 / μL, 70 / μL, 80 / μL, 90 / μL, or 100 / μL.

[0251] The present invention also provides a method for regulating an immune response in an individual, comprising administering to the individual an effective amount of any one of the immune response cells of the present invention.

[0252] The present invention also provides a method for enhancing immune tolerance in an individual, comprising administering to the individual an effective amount of an immune response cell of the present invention, wherein the cell comprises a receptor that binds to a tumor antigen and a vector encoding a type I interferon. Preferably, the method prevents or reduces autoimmune diseases or diseases associated with allogeneic transplantation.

[0253] The present invention also provides a method for treating or preventing pathogen infection in an individual, comprising administering an effective amount of immune response cells comprising a receptor that binds to a viral antigen and a vector encoding type I interferon.

[0254] Autologous lymphocyte infusion can be used for treatment. Autologous peripheral blood mononuclear cells (PBMC) can be collected from patients in need of treatment, and T cells can be activated and amplified using methods described herein and known in the art, and then injected into the patient. In other cases, allogeneic cells can be used to treat patients.

[0255] The methods disclosed herein may include transplantation. Transplantation may refer to adoptive transplantation of a cell product. Transplantation may be an autologous transplant, an allogeneic transplant, a xenotransplant, or any other transplant. For example, the transplant may be a xenotransplant. The transplant may also be an allogeneic transplant.

[0256] In some embodiments, the subject can be given immunoreactive cells, wherein the immunoreactive cells that can be administered can be about 1 to about 35 days old. For example, the cells administered can be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34 or up to about 40 days. The age of the CAR immunoreactive cells can be calculated from the time of stimulation. The age of the immunoreactive cells can be calculated from the time of blood collection. The age of the immunoreactive cells can be calculated from the time of transduction. In some embodiments, the immunoreactive cells that can be administered to the subject are about 10 to about 14 or about 20 days old. In some embodiments, the "age" of the immunoreactive cells can be determined by telomere length. For example, "young" immunoreactive cells can have longer telomere lengths than "exhausted" or "old" immunoreactive cells. Without being bound by a particular theory, it is believed that immunoreactive cells lose an estimated telomere length of approximately 0.8 kb per week in culture, and that young immunoreactive cell cultures may have telomeres that are approximately 1.4 kb longer than immunoreactive cells that are approximately 44 days old. Without being bound by a particular theory, it is believed that longer telomere length may correlate with positive objective clinical responses in patients and persistence of cells in vivo.

[0257] Before, after and / or during transplanting, cell (for example, engineering cell or the primary T cell of through engineering approaches) can be functional.For example, the cell of transplanting can be after transplanting at least about 1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,6,27,28,29,30,40,50,60,70,80,90 or 100 days work.Transplanted cell can work at least about 1,2,3,4,5,6,7,8,9,10,11 or 12 months after transplanting.Transplanted cell can work at least about 1,2,3,4,5,6,7,8,9,10,15,20,25 or 30 years after transplanting.In some embodiments, transplanted cell can work during the life span of recipient.

[0258] Furthermore, the transplanted cells can function at 100% of their normal intended function. The transplanted cells can also function at about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 , 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, , 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or up to about 100% functionality.

[0259] The transplanted cells can also function at more than 100% of their normal intended function. For example, the transplanted cells can function at about 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 400, 500, 600, 700, 800, 900, 1000, or up to about 5000% of their normal intended function.

[0260] Transplantation can be by any type of transplantation. Localized sites can include, but are not limited to, the subcapsular space of the liver, the subcapsular space of the spleen, the subcapsular space of the kidney, the omentum, the submucosa of the stomach or intestine, segments of small intestinal vessels, the sac of the vein, the testicles, the brain, the spleen, or the cornea. For example, the transplantation can be a subcapsular transplantation. The transplantation can also be an intramuscular transplantation. The transplantation can be a portal vein transplantation.

[0261] Compared to when one or more wild-type cells are transplanted into a recipient, transplant rejection can be improved after treatment with the immune response cells of the present invention. For example, transplant rejection can be hyperacute rejection. Transplant rejection can also be acute rejection. Other types of rejection may include chronic rejection. Transplant rejection can also be cell-mediated rejection or T-cell-mediated rejection. Transplant rejection can also be natural killer cell-mediated rejection.

[0262] Improving engraftment may mean alleviating hyperacute rejection, which may include reducing, alleviating or decreasing adverse effects or symptoms. Transplantation may refer to adoptive transplantation of a cell product.

[0263] Another indication of transplant success can be the number of days the recipient does not require immunosuppressive therapy. For example, after providing the immune response cells of the present invention, the recipient may not require immunosuppressive therapy for at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more days. This can indicate a successful transplant. This can also indicate that the transplanted cells, tissues, and / or organs were not rejected.

[0264] In some cases, the recipient has not required immunosuppressive therapy for at least 1 day. The recipient may also have not required immunosuppressive therapy for at least 7 days. The recipient may not have required immunosuppressive therapy for at least 14 days. The recipient may not have required immunosuppressive therapy for at least 21 days. The recipient may not have required immunosuppressive therapy for at least 28 days. The recipient may not have required immunosuppressive therapy for at least 60 days. Furthermore, the recipient may not have required immunosuppressive therapy for at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more years.

[0265] Another indication of transplant success may be the number of days the recipient requires reduced immunosuppressive therapy. For example, following the treatment provided herein, the recipient may require at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more days of reduced immunosuppressive therapy. This can indicate a successful transplant. This can also indicate minimal or no rejection of the transplanted cells, tissues, and / or organs.

[0266] For example, a recipient may require at least 1 day of reduced immunosuppressive therapy. A recipient may also require at least 7 days of reduced immunosuppressive therapy. A recipient may require at least 14 days of reduced immunosuppressive therapy. A recipient may require at least 21 days of reduced immunosuppressive therapy. A recipient may require at least 28 days of reduced immunosuppressive therapy. A recipient may require at least 60 days of reduced immunosuppressive therapy. In addition, a recipient may require at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more years of reduced immunosuppressive therapy.

[0267] Reduced immunosuppressive therapy can refer to less immunosuppressive therapy than is required when one or more wild-type cells are transplanted into a recipient.

[0268] Immunosuppressive therapy can include any treatment that suppresses the immune system. Immunosuppressive therapy can help alleviate, reduce, or eliminate transplant rejection in patients. For example, immunosuppressants can be used before, during, and / or after transplantation, including MMF (mycophenolate mofetil (Cellcept)), ATG (anti-thymocyte globulin), anti-CD154 (CD4OL), anti-CD40 (2C10), immunosuppressive drugs, anti-IL-6R antibodies (tocilizumab, Actemra), anti-IL-6 antibodies (sarilumab, olokizumab), CTLA4-Ig (Abatacept / Orencia), anti-IL-6 antibodies (ASKP1240, CCFZ533X2201), amphetamines (Campath), Anti-CD20 (rituximab), bevacizumab (LEA29Y), sirolimus (Rapimune), everolimus, tacrolimus (Prograf), dactylizumab (Ze-napax), basiliximab (Similect), infliximab (Remicade), cyclosporine, deoxyprotamine, soluble complement receptor 1, cobra toxin, anti-C5 antibody (eculizumab / Soliris), methylprednisolone, FTY720, everolimus, leflunomide, anti-IL-2R-Ab, rapamycin, anti-CXCR3 antibody, anti-ICOS antibody, anti-OX40 antibody and anti-CD122 antibody. In addition, one or more immunosuppressants / drugs can be used together or sequentially. One or more immunosuppressants / drugs can be used for induction therapy or maintenance therapy. The same or different drugs can be used in the induction and maintenance phases. In some cases, daclizumab (Zenapax) can be used for induction therapy, and tacrolimus (Prograf) and sirolimus (Rapimune) can be used for maintenance therapy. Non-drug regimens can also be used to achieve immunosuppression, including but not limited to total body irradiation, thymic irradiation, and total and / or partial splenectomy. These techniques can also be used in combination with one or more immunosuppressive drugs.

[0269] Example

[0270] The present invention will be further described below with reference to specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the invention. The experimental procedures in the following examples, for which specific conditions are not specified, were generally performed under conventional conditions, such as those described in J. Sambrook et al., Molecular Cloning Laboratory Manual, 3rd edition, Science Press, 2002, or according to the conditions recommended by the manufacturer.

[0271] In the following examples of the present invention, when constructing the antigen-binding receptor or CAR, the CD28 costimulatory signaling domain is abbreviated as 28; CD3ζ is abbreviated as Z; and 4-1BB or CD137 is abbreviated as BB. For example, a chimeric antigen receptor constructed by combining the scFv code 85-2 with CD3ζ and the CD28 costimulatory signaling domain as the intracellular signaling domain can be denoted as 85-2-28Z. This is the same for the construction of CARs targeting different antigens.

[0272] 1. Experimental Materials

[0273] Hepatocellular carcinoma cell lines SK-HEP-1 and PLC / PRF / 5 were purchased from ATCC cell bank, and Huh-7 was purchased from RIKEN cell bank in Japan.

[0274] PBMCs were obtained from Shanghai Blood Center.

[0275] AIM V Medium: CTS, Cat#1665773.

[0276] Human T-Activator CD3 / CD28: Life technologies, Cat#11161D.

[0277] Fetal calf serum (FCS): Gibco, Cat# 10099-141.

[0278] IL-2: Shanghai Huaxin, recombinant human interleukin-2 for injection.

[0279] Goat anti-human F(ab')2 antibody: Jackson ImmunoResearch, Cat#109-066-006.

[0280] PE-Streptavidin: BD pharmingen, Cat#554061.

[0281] CytoTox Non-radioactive cytotoxicity assay: Promega, Cat#G1780.

[0282] 2. Experimental Methods

[0283] 2.1 Lentiviral vector construction

[0284] 2.1.1 Construction of pRRL-EF1α-92-CAR lentiviral vector

[0285] As an example, the vector system used to construct the lentiviral plasmid vector of the present invention belongs to the third generation self-inactivating lentiviral vector system. The system has four plasmids: the packaging plasmid pMDLg RRE (purchased from addgene) encoding the protein Gag / Pol, the packaging plasmid pRSV-REV (purchased from addgene) encoding the Rev protein, the envelope plasmid pCMV-VSV-G (purchased from addgene) encoding the VSV-G protein, and the recombinant expression vector encoding the target gene CAR based on the empty vector pRRLSIN-cPPT.PGK-GFP.WPRE (purchased from addgene). This system can effectively reduce the risk of forming replicable lentiviral particles.

[0286] In this system, the inventors first transformed the empty vector pRRLSIN-cPPT.PGK-GFP.WPRE by conventional molecular cloning technology, replaced the promoter of the original vector with the promoter of elongation factor-1α (EF-1α), and added an MluI restriction site between the promoter and the CD8αsp signal peptide. Specifically, the vector pWPT-EGFP (purchased from Addgene) was double-digested with ClaI / SalI (purchased from NEB), and a 1.1Kb DNA fragment was recovered. It was ligated to the ClaI / SalI double-digested vector pRRLSIN-cPPT.PGK-GFP.WPRE with T4 DNA ligase and transformed into the host bacteria TOP10. The positive clones were picked and identified by colony PCR and confirmed by sequencing to obtain the recombinant plasmid pRRLSIN-cPPT.EF-1α-EGFP.WPRE.

[0287] Chinese patent 201510481235.1 describes a humanized antibody 92 that can specifically recognize human GPC3 protein. To construct the 92-CAR lentiviral plasmid, a plasmid containing the 92 heavy chain variable region (SEQ ID NO: 80 in Patent 201510481235.1) was used as a template to amplify the heavy chain variable region fragment using the upstream primer 5'-ctccacgccgccaggccggaggtgcagctggtgcag-3' (SEQ ID NO: 1) and the downstream primer 5'-GCGGTGTCCTCGCTCCGCAGGCTGCTCAGCTCCATGTAGGCGGTG-3' (SEQ ID NO: 2). A plasmid containing the 92 light chain variable region (SEQ ID NO: 79 in Patent 201510481235.1) was used as a template to amplify the heavy chain variable region fragment using the upstream primer 5'-ctccacgccgccaggccggaggtgcagctggtgcag-3' (SEQ ID NO: 1) and the downstream primer 5'-GCGGTGTCCTCGCTCCGCAGGCTGCTCAGCTCCATGTAGGCGGTG-3' (SEQ ID NO: 2). The light chain variable region fragment was amplified using the primers 5'-CGGCGCTGGCGTCGTGGTACGTTTGATCTCCAGCTTGGTG-3' (SEQ ID NO: 4). The heavy and light chain variable region primers were used to amplify the 92 scFv fragment (SEQ ID NO: 5) containing the upstream CD8α signal peptide and downstream hinge region repeats through bridge PCR. This fragment, designated as fragment 1, was 765 bp in size. PCR amplification conditions included initial denaturation at 94°C for 4 minutes; denaturation at 94°C for 40 seconds; annealing at 58°C for 40 seconds; and extension at 68°C for 40 seconds for 25 cycles, followed by extension at 68°C for 10 minutes. The PCR amplified bands were confirmed to be consistent with the expected fragment size by agarose gel electrophoresis.

[0288] Using the upstream primer 5'-gcaggggaaagaatagtagaca-3' (SEQ ID NO: 6) and the downstream primer 5'-CGGCCTGGCGGCGTGGAG-3' (SEQ ID NO: 7), the vector plasmid pRRLSIN-cPPT.EF-1α-EGFP.WPRE constructed in this example was used as a template to amplify the EF-1α promoter (SEQ ID NO: 8) containing the CD8α signal peptide (containing an MluI restriction site), designated as fragment 2, with a size of 442 bp. PCR amplification conditions were pre-denaturation at 94°C for 4 min; denaturation at 94°C for 30 s; annealing at 53°C for 30 s; extension at 68°C for 30 s; 25 cycles, followed by a total extension at 68°C for 10 min. The PCR amplified bands were confirmed to be consistent with the expected fragment size by agarose gel electrophoresis.

[0289] Using the upstream primer 5'-accacgacgccagcgccg-3' (SEQ ID NO: 9) and the downstream primer 5'-aatccagaggttgattgtcgacctagcgagggggcagggcctgc-3' (SEQ ID NO: 10), pWPT-eGFP-F2A-GPC3-BBZ, pWPT-eGFP-F2A-GPC3-28Z, and pWPT-eGFP-F2A-GPC3-28BBZ were used as templates, respectively (see Chinese Patent CN 104140974 A for details). Fragment 3 containing Hinge-BBZ (SEQ ID NO: 11), fragment 4 of Hinge-28Z (SEQ ID NO: 12), and fragment 5 of Hinge-28BBZ (SEQ ID NO: 13) (all containing Sal I restriction sites) were amplified, with sizes of 694 bp, 703 bp, and 829 bp, respectively. PCR amplification conditions included 25 cycles of initial denaturation at 94°C for 4 minutes, denaturation at 94°C for 30 seconds, annealing at 60°C for 30 seconds, and extension at 68°C for 30 seconds, followed by a total extension at 68°C for 10 minutes. PCR amplified bands were confirmed to conform to the expected fragment size by agarose gel electrophoresis.

[0290] About 50 ng of equal moles of fragment 2, fragment 1 and fragment 3 were subjected to splicing PCR respectively. The splicing conditions were: initial denaturation at 94°C for 4 min; denaturation at 94°C for 40 s; annealing at 60°C for 40 s; extension at 68°C for 140 s, for 5 cycles, followed by a total extension at 68°C for 10 min. DNA polymerase and upstream primer 5'-gcaggggaaagaatagtagaca-3' (SEQ ID NO: 6) and downstream primer 5'-aatccagaggttgattgtcgacctagcgagggggcagggcctgc-3' (SEQ ID NO: 10) were supplemented and amplified by PCR for 25 cycles. The amplification conditions were: initial denaturation at 94°C for 4 min; denaturation at 94°C for 40 s; annealing at 60°C for 40 s; extension at 68°C for 140 s, and a total extension at 68°C for 10 min. The amplified DNA fragment of 92-BBZ (SEQ ID NO: 14) had a theoretical size of 1865 bp. The amplified product was confirmed to be consistent with the theoretical size by agarose gel electrophoresis.

[0291] Approximately 50 ng of Fragment 2, Fragment 1, and Fragment 4 were spliced ​​together using PCR under the same splicing reaction conditions as above. The resulting DNA fragments 92-28Z (SEQ ID NO: 15) were amplified with a theoretical size of 1874 bp. Agarose gel electrophoresis confirmed that the amplified products were consistent with the theoretical size.

[0292] Approximately 50 ng of Fragment 2, Fragment 1, and Fragment 5 were spliced ​​together using PCR under the same splicing reaction conditions as above. The resulting DNA fragments 92-28BBZ (SEQ ID NO: 16) were amplified with a theoretical size of 2000 bp. Agarose gel electrophoresis confirmed that the amplified products were consistent with the theoretical size.

[0293] The vector plasmid pRRLSIN-cPPT.EF-1α-EGFP.WPRE and fragments 92-BBZ, 92-28Z, and 92-28BBZ were digested with restriction endonucleases Mlu I and Sal I (purchased from NEB), respectively. They were ligated using T4 ligase (purchased from NEB), transformed into TOP10, and clones were selected for PCR identification of positive bacteria. The clones were sent to Invitrogen for sequencing to confirm the correct sequence, thereby obtaining pRRL-EF-1α-92-BBZ, pRRL-EF-1α-92-28Z, and pRRL-EF-1α-92-28BBZ.

[0294] 2.1.2 Construction of 92-CAR Lentiviral Vector Co-expressing 4-1BBL

[0295] In addition, to construct a plasmid for co-expression of 92-28Z and 41BBL, the pRRL-EF-1α-92-28Z plasmid constructed above was used as a template and fragment 6 was amplified by PCR using the upstream primer 5′-gcaggggaaagaatagtagaca-3′ (SEQ ID NO: 6) and the downstream primer 5′-TCAGAAGGTCAAAATTCAAAGTCTGTTTCACGCGAGGGGGCAGGGCCTGCA TGTGAA-3′ (SEQ ID NO: 17). To obtain the F2A-41BBL fragment, plasmid HG15693-G (purchased from Beijing Sino Biological Biotechnology Co., Ltd., the 562nd base of the 41BBL gene contains a mutation from G to A) was used as a template, and fragment 7 was amplified by PCR using the upstream primer 5'-gagacgttgagtccaaccctgggcccatggaatacgcctctgacgc-3' (SEQ ID NO: 18) and the downstream primer 5'-TCGGAGGAGGCGGGTGGCAGGTCCACGGTC-3' (SEQ ID NO: 19); the upstream primer 5'-ctgccacccgcctcctccgaggctcggaa-3' (SEQ ID NO: 20) and the downstream primer 5'-TGATTGTCGACTTATTCCGACCTCGGTGAAGGGA-3' (SEQ ID NO:21), fragment 8 was amplified by PCR. Fragments 7 and 8 were then spliced ​​in equal moles and amplified using primers (SEQ ID NO:18 and SEQ ID NO:21) to obtain fragment 9. Finally, equimolar fragments 6 and 9 were spliced ​​and amplified using primers (SEQ ID NO:6 and SEQ ID NO:21) to obtain 92-28Z-F2A-41BBL (SEQ ID NO:22). This fragment was digested with Mlu I and Sal I and inserted into the pRRLSIN-cPPT.EF-1α-EGFP.WPRE vector, which had been digested with the same enzymes as described above. Sequencing confirmed the correctness of the fragment to obtain the plasmid pRRL-EF-1α-92-28Z-F2A-41BBL.

[0296] 2.1.3 Construction of 92-CAR Lentiviral Vector for Regulating IFN Co-expression

[0297] To construct a plasmid that can co-express 92-28Z and IFN beta (and simultaneously achieve controllable expression by inserting an NFAT element in front of IFN beta), fragment 10 was first synthesized using primers (SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35) by primer building. Then, using the pWPT-EGFP plasmid as a template, fragment 11 was amplified using an upstream primer (SEQ ID NO:36) and a downstream primer (SEQ ID NO:37). Fragments 10 and 11 were mixed in equal moles and amplified by bridge PCR using a primer pair (SEQ ID NO: 35 and SEQ ID NO: 38). The fragment was then digested with ClaI and SalI and inserted into the vector pRRLSIN-cPPT-PGK-EGFP.WPRE, which had been digested with the same enzymes as described above. The fragment was confirmed to be correct by sequencing to obtain the vector pRRLSIN-NFAT3-EGFP-PA2 containing three NFAT repeat sequences. Using pRRLSIN-NFAT3-EGFP-PA2 as a template, fragments 12 and 13 were amplified using primer pairs (SEQ ID NO:39 and SEQ ID NO:40) and (SEQ ID NO:41 and SEQ ID NO:42), respectively. Fragment 14 was then amplified using primer pairs (SEQ ID NO:39 and SEQ ID NO:42) by bridge PCR. This fragment was then digested with Mlu I and Sal I and ligated into pRRLSIN-NFAT3-EGFP-PA2, which had been digested similarly. Sequencing confirmed the resulting vector, pRRLSIN-NFAT6-EGFP-PA2, containing six NFAT repeat sequences. Fragment 15 was amplified using primer pairs (SEQ ID NO:43 and SEQ ID NO:44) using the pGMT-IFN-β vector (purchased from Sino Biological Biotech Co., Ltd.) as a template. Using this fragment as a template, PCR amplification was performed using a primer pair (SEQ ID NO: 43 and SEQ ID NO: 38). The amplified product was digested with Mlu I and Cla I and ligated into the vector pRRLSIN-NFAT6-EGFP-PA2 that had been digested with the same enzymes. The correctness was confirmed by sequencing to obtain the pRRLSIN-NFAT6-huIFNβ-PA2 plasmid.Using the constructed pRRLSIN-NFAT6-huIFNβ-PA2 plasmid as a template, the primer pair (SEQ ID NO:45 and SEQ ID NO:46) was used to amplify the EGFP fragment 16 with an NdeI restriction site. Using the constructed plasmid pRRLSIN-NFAT6-EGFP-PA2 plasmid as a template, the primer pair (SEQ ID NO:47 and SEQ ID NO:48) was used to amplify the NFAT6 fragment 17 with an NdeI restriction site (6 units of the fragment needed to be amplified while eliminating the SalI restriction site). Fragments 16 and 17 were mixed in equal moles and amplified using a primer pair (SEQ ID NO: 45 and SEQ ID NO: 48). This fragment was double-digested with EcoRI and KpnI and ligated into the pRRLSIN-cPPT.EF-1α-EGFP.WPRE vector, which had been digested with the same enzymes. Sequencing confirmed the correctness of the fragment to obtain the pRRLSIN-EF1α-EGFP-NFAT6-huIFNβ-PA2 plasmid. Finally, the plasmid pRRL-EF-1α-92-28Z was double-digested with MluI and SalI to obtain the 92-28Z fragment, which was ligated into the pRRLSIN-EF1α-EGFP-NFAT6-huIFNβ-PA2 vector, which had been digested with the same enzymes, to obtain the plasmid pRRLSIN-EF1α-92-28Z-NFAT6-hu IFNβ-PA2, which had been sequenced correctly.

[0298] The above five plasmids pRRL-EF-1α-92-BBZ, pRRL-EF-1α-92-28Z, pRRL-EF-1α-92-28BBZ, pRRL-EF-1α-92-28Z-F2A-41BBL and pRRL-EF-1α-92-28Z-NFAT6-huIFNβ-PA2 are collectively referred to as pRRL-EF-1α-92-CAR ( Figure 1 ). The amino acid sequences corresponding to 92-BBZ, 92-28Z, 92-28BBZ, and 92-28Z-F2A-41BBL are SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, and SEQ ID NO: 52, respectively. The amino acid sequence expressed by 92-28Z-NFAT6-IFN-β comprises two segments, namely, the CAR constructed as 92-28Z as shown in SEQ ID NO: 50 and the IFN as shown in SEQ ID NO: 53. The vector is constructed as shown in FIG. Figure 1B shown.

[0299] 2.2 Virus Preparation

[0300] 1) 4.5×10 6293T cells were seeded at a density of 100 μg / ml in a 10 cm dish and cultured overnight at 37°C in 5% CO2 to prepare for virus packaging. The culture medium was DMEM supplemented with 10% fetal bovine serum.

[0301] 2) Dissolve 5.2 μg of the lentiviral shuttle vector pRRL-92-28Z-NFAT6-IFN-β and 6.2 μg of the packaging plasmids pRsv-REV, 6.2 μg of pRRE-PMDLg, and 2.4 μg of VSVg in 800 μL of serum-free DMEM culture medium and mix thoroughly;

[0302] 3) Dissolve 60 μg of PEI (1 μg / μl) in 800 μl of serum-free DMEM, mix gently (or vortex at 1000 rpm for 5 seconds), and incubate at room temperature for 5 min;

[0303] 4) Formation of transfection complex: Add the plasmid mixture to the PEI mixture, vortex or gently mix immediately after addition, and incubate at room temperature for 20 minutes;

[0304] 5) Add 1.6 ml of the transfection complex dropwise into a 10 cm culture dish containing 11 ml of DMEM medium. After 4-5 hours, replace with fresh medium.

[0305] 6) After 72 hours, collect the virus supernatant.

[0306] 2.3 Virus Concentration

[0307] 1) Preparation of 5X PEG8000 NaCl: Dissolve 8.766 g of NaCl and 50 g of PEG8000 in 200 ml of Milli-Q water. Sterilize by moist heat at 121°C for 30 min. Cool to room temperature and store in a refrigerator at 4°C.

[0308] 2) Filter the collected viral supernatant using a 0.45 μm filter, add 7.5 ml of 1 / 4 5X PEG-8000 NaCl stock solution, and mix by inverting.

[0309] 3) Mix once every 20 to 30 minutes, for a total of 3 to 5 times;

[0310] 4) Place at 4°C overnight;

[0311] 5) Centrifuge at 4000 g for 60 min at 4°C.

[0312] 6) After removing the supernatant, add an appropriate amount of AIM V medium (containing 2% AB serum) to dissolve and resuspend the virus pellet;

[0313] 7) Aliquot the concentrated lentiviral suspension into 50 μl aliquots, store in finished tubes, and store at -80°C. Monotropic retroviruses are unstable and should be used as soon as possible after packaging. Freezing at -80°C is not recommended.

[0314] 2.4 Lentiviral titer determination

[0315] 1×10 5 Cell number 293T cells were seeded in 12-well culture plates;

[0316] The concentrated lentivirus was added to the cell suspension at 1uL, 0.2uL, and 0.04uL, respectively, and polybrene was added to a final concentration of 6ug / mL;

[0317] After overnight culture at 37°C and 5% CO2, fresh culture medium was replaced;

[0318] 72 h after infection, 293T cells were trypsinized and terminated by adding an equal amount of culture medium. After pipetting and mixing, the cell suspension was transferred into a 1.5 mL centrifuge tube.

[0319] Centrifuge at 400 g for 5 min, discard the supernatant, and wash once with PBS + 2% FBS solution;

[0320] 6) Take an appropriate amount of cells, add Biotin-labeled goat anti-human Fab antibody at a dilution ratio of 1:50, and incubate on ice for 30 minutes;

[0321] 7) After washing once with 1 mL of PBS + 2% FBS solution, add PE-labeled streptavidin at a dilution ratio of 1:50 and incubate on ice for 30 minutes;

[0322] 8) After washing twice with PBS + 2% FBS solution, add an appropriate volume of PBS + 2% FCS solution to resuspend the cells and transfer them to a flow cytometry tube;

[0323] 9) After flow cytometry detection, it is appropriate to take a cell sample with a positive rate of 5-20% and calculate the titer (TU / mL) = number of cells (10 5 )×positive rate / virus volume (mL).

[0324] 2.5 Preparation of lentiviral-transduced T lymphocytes-CAR-T lymphocytes

[0325] 1) T lymphocyte activation: Human PBMCs were obtained from Shanghai Blood Center. The culture medium was AIM V + 2% AB serum + IL-2 (500 U / mL). The PBMC density was adjusted to 1×10 6 / mL, magnetic beads coated with anti-human CD3 and CD28 antibodies were added at a ratio of 1:1 and activated for 48 h;

[0326] 2) Retronectin-coated 48-well plates: Add 160 μl of retronectin solution (5 μg / mL) to each well and incubate at 4°C overnight;

[0327] 3) Discard the Retronectin solution in the 48-well plate and wash twice with 1 ml of PBS;

[0328] 4) Cells were seeded in a 48-well plate coated with Retronectin, with 3×10 cells per well. 5 , add lentivirus at MOI = 10 and replenish the culture medium to 300 μL;

[0329] 5) Centrifuge at 32°C, 1800 rpm for 40 min, then transfer to a cell culture incubator and continue incubation for 24 h.

[0330] 6) Replace with fresh culture medium and adjust the cell density to 5×10 5 / mL, and passaged every 2-3 days.

[0331] 2.6 Expression of chimeric antigen receptor on T lymphocytes

[0332] 1) 7 days after infection, take 4×10 5 The T cells were centrifuged at 400 g for 5 min at 4°C, the supernatant was discarded, and the cells were washed once with PBS + 2% FCS;

[0333] 2) Resuspend the cells in 50 μL PBS + 2% FCS, add 1 μL Biotin-labeled goat anti-human Fab antibody, and incubate on ice for 30 min;

[0334] 3) After washing twice with PBS + 2% FCS, resuspend the cells in 50 μL PBS + 2% FCS, add 1 μL PE-labeled Streptavidin, and incubate on ice for 30 min;

[0335] 4) After washing twice with PBS + 2% FCS, the cells were resuspended in 400 μL PBS + 2% FCS, transferred to a flow cytometer, and the infection efficiency was detected by flow cytometry.

[0336] 2.7 In vitro toxicity test

[0337] target cells

[0338] The target cells corresponding to 92-CAR are SK-HEP-1 (GPC3-) and Huh-7 (GPC3+);

[0339] Adjust the target cell concentration to 1×10 6 / mL, 100 μL was inoculated into a 96-well plate;

[0340] Effector cells: CAR-T cells and control T cells were added to 96-well plates at effector-target ratios of 0.3:1, 1:1, and 3:1;

[0341] Each group was set up with 5 replicate wells, and the average value of the 5 replicate wells was taken.

[0342] The experimental groups and control groups are as follows:

[0343] Each experimental group: each target cell + CTL expressing different chimeric antigen receptors;

[0344] Control group 1: maximum LDH release from target cells;

[0345] Control group 2: target cells spontaneously released LDH;

[0346] Control group 3: effector cells spontaneously released LDH;

[0347] Detection method: After the effector cells and target cells were co-cultured for 18 hours, the CytoTox 96 non-radioactive cytotoxicity detection kit (Promega) was used for detection. This method is based on colorimetry and can replace 51 Cr release method. The degree of cell lysis can be reflected by detecting the content of lactate dehydrogenase (LDH). LDH is a stable cytoplasmic enzyme that is released when cells lyse. 51 Cr is released in essentially the same manner in radioactive assays. The released LDH in the culture supernatant can be detected in a 30-minute coupled enzymatic reaction, in which LDH converts a tetrazolium salt (INT) into a red formazan. The amount of red product produced is proportional to the number of cells lysed. For details, refer to the CytoTox 96 Non-Radioactive Cytotoxicity Assay Kit instructions.

[0348] The cytotoxicity calculation formula is:

[0349]

[0350] 3. Results

[0351] Example 1. Expression of 92-CAR on human T lymphocytes

[0352] Human T lymphocytes were stimulated with magnetic beads coated with anti-CD3 and CD28 antibodies for 48 hours and then infected with high-titer lentivirus at an MOI of 10 by centrifugation. Flow cytometry was used to determine the positive rate of lentivirus-infected T lymphocytes on day 7 after infection. T cells expressing 92-28Z (SEQ ID NO: 15, encoding nucleotide sequence as shown in SEQ ID NO: 57) ( Figure 2The infection efficiency of GPC3-CD28Z in the T cells was 35.1%, and the T cells expressing 92-28Z-NFAT6-IFN-β ( Figure 2 The infection efficiency of GPC3-CD28Z-IFN in the control vector MOCK was 19.2%, and the infection efficiency of the control vector MOCK was 49%. Figure 2 .

[0353] Example 2: In vitro anti-tumor activity of 92-CAR T cells

[0354] After the infection positive rate test, the 92-CAR T cells expressing 92-28Z-NFAT6-IFN-β, 92-28Z and empty vector MOCK were tested for the effect of T lymphocytes on the liver cancer cell line SK-HEP-1 (GPC3 - ) and Huh-7(GPC3 + ) and PLC / PRF / 5(GPC3 + ) in vitro cytotoxicity. After 18 hours of co-culture, the LDH content in the supernatant was measured. The results show that 92-28Z CAR-T cells specifically kill GPC3-positive Huh-7 and PLC / PRF / 5 cells, but not GPC3-negative SK-HEP-1 cells. CAR-T cells co-expressing huIFN-β have a higher cytotoxicity than 92-28Z CAR-T cells with the same target ratio (see Table 2).

[0355] Table 2. Detection of 92-CAR T cells' toxicity to target cells

[0356]

[0357] The present inventors further compared 92-28Z-NFAT6-IFN-β with other GPC3-BBZ, GPC3-28BBZ and GPC3-41BBL (co-expressed 4-1BBL on the basis of CD28Z) CAR-T cells constructed by the same exogenous antigen binding unit 92 (SEQ ID NO: 5). First, FACS was used to detect the expression of various CARs (see Figure 3 ), the expression ratio of various CARs is basically around 40%.

[0358] Then, the effects of these CAR-T cells and empty vector MOCK T lymphocytes on the liver cancer cell line SK-HEP-1 (GPC3 - ) and Huh-7(GPC3 + ) and PLC / PRF / 5(GPC3 +) in vitro cytotoxicity. After 18 hours of co-culture, the LDH content in the supernatant was measured. The results show that 92CAR-T cells specifically kill GPC3-positive Huh-7 and PLC / PRF / 5 cells, but not GPC3-negative SK-HEP-1 cells. At a 1:1 effector-target ratio, CAR-T cells co-expressing IFN-β exhibited a higher cytotoxicity against both GPC3-positive liver cancer cells than all other CAR-T cells (see Table 3).

[0359] Table 3. Toxicity detection of various GPC3 CAR-T cells on target cells

[0360]

[0361] These studies demonstrate that adding exogenously expressed IFN-beta to CD28-Z CAR T cells can enhance anti-tumor activity. Furthermore, CD28Z-expressing CAR-T cells co-expressing IFN-beta exhibit superior tumor-killing ability compared to immune cells expressing CD28Z-41BBL at certain effector-target ratios.

[0362] Example 3. In vitro cytokine release assay of GPC3 CAR-T cells containing and without IFN

[0363] The cytokines released by untransfected T cells, 92-28Z T cells, and 92-28Z-IFN T cells were detected. The three types of T cells that grew well within 1-2 weeks after lentiviral infection were collected and inoculated with 5×10 4 / 200 μL (positive cell count) in a 24-well plate, and then inoculate 5×10 4 / 200μL / 24-well huh7 cells were co-incubated with CAR T cells for 24 hours, and the supernatant was collected to detect the concentrations of IFN-β, IFN-γ, and IL-2. The results were as follows Figures 4A-4C shown.

[0364] according to Figure 4A IFNβ was expressed only when GPC3-28Z-IFN T cells were co-incubated with Huh7 cells, indicating that after GPC3-28Z-IFN T cells were activated by target antigens, IFNβ could be successfully induced to express and secreted outside the cells. Figure 4B and 4C The results of in vitro cytokine detection showed that GPC3-28Z-IFN T cells can be more effectively activated in a variety of GPC3-positive cells, such as Huh7, PLC\PRF\5, Hep-3B and other cells.

[0365] Example 4. In vitro cytokine release assay of CLD18A2 CAR-T cells containing and without IFN

[0366] Construction of chimeric antigen receptor 85-28Z and 85-2-28Z plasmids:

[0367] Using PRRLSIN-cPPT.EF-1α as the vector, lentiviral plasmids expressing the second-generation chimeric antigen receptors 85-28Z (SEQ ID NO:55) and 85-2-28Z (SEQ ID NO:54) for antibodies 85 and 85-2, respectively, were constructed. The 85-28Z sequence consists of the CD8α signal peptide, 85scFV, CD8 hinge, CD28 transmembrane and intracellular signaling domains, and the intracellular segment CD3ξ of CD3; the 85-2-28Z sequence consists of the CD8α signal peptide, hu8E5-2IscFV, CD8 hinge, CD28 transmembrane and intracellular signaling domains, and the intracellular segment CD3ξ of CD3.

[0368] Construction of chimeric antigen receptor 85-28Z-IFN and 85-2-28Z-IFN plasmids:

[0369] Based on 85-28Z and 85-2-28Z, an 85-28Z-IFNb CAR expressing IFNb cytokine was constructed (the encoding nucleotide sequence is shown in SEQ ID NO: 58). Based on 85-2-28Z CAR, an 85-2-28Z-IFNb CAR expressing IFNb cytokine was constructed (the encoding nucleotide sequence is shown in SEQ ID NO: 59).

[0370] To verify that the constructed 85-28Z T cells and 85-28Z-IFN T cells can also be effectively activated under target cell stimulation, we detected the secretion of cytokines by 85-28Z T and 85-28Z-IFN T cells after co-incubation with target cells.

[0371] Cytokine release from mock-transfected T cells (mock), 85-28Z T cells, and 85-28Z-IFN T cells was measured. Well-grown T cells from the three types of lentiviral-transfected cells were harvested within 1-2 weeks of lentiviral infection and seeded in 24-well plates at 5×10⁴ / 200μL (number of positive cells). Target cells were seeded at a 1:1 ratio of 5×10⁴ / 200μL per 24-well plate. Target cells included 293T-A1, 293T-A2, AGS, AGS-A2, BGC-823, and BGC-823-A2 cells. Supernatants were collected after 24 hours of co-culture. Interferon-γ (IFN-γ) cytokine release from the supernatants during co-culture of CAR T cells and target cells was measured using a sandwich ELISA.

[0372] The experimental results are as follows Figure 5 As shown, the presence of IFN led to increased IFN-γ cytokine secretion when 85-28Z CAR T cells were co-incubated with target cells.

[0373] Example 5. Cytotoxicity of GPC3 CAR-T (92-28Z) cells with and without IFN

[0374] SK-HEP-1 is a GPC3-negative human hepatocellular carcinoma cell line, PLC / PRF / 5 is a GPC3-positive human hepatocellular carcinoma cell line, HepG2 is a GPC3-positive human hepatocellular carcinoma cell line, and Hep3B is a GPC3-positive human hepatocellular carcinoma cell line, all of which were purchased from the American Type Culture Collection (ATCC); Huh-7 (also known as Huh7) is a GPC3-positive human hepatocellular carcinoma cell line purchased from the RIKEN Cell Bank in Japan.

[0375] Detection method: The CytoTox 96 non-radioactive cytotoxicity assay kit (Promega) was used for detection (for specific methods, please refer to the instructions of the CytoTox 96 non-radioactive cytotoxicity assay kit). The in vitro cytotoxic killing effect of CAR T lymphocytes on Huh 7, Hep 3B, PLC / PRF / 5, Hep G2 and SK-HEP-1 liver cancer cells was detected.

[0376] Untransfected T cells, 92-28Z T cells, and 92-28Z-IFN T cells were co-cultured with tumor cells at effector-target ratios of 1:3, 1:1, and 3:1 for 18 hours. The experimental and control groups were set up as follows:

[0377] Experimental group settings: each target cell + T lymphocytes expressing different chimeric antigen receptors;

[0378] Control group 1: spontaneous LDH release from effector cells;

[0379] Control group 2: spontaneous LDH release from target cells;

[0380] Control group 3: Maximum LDH release of target cells

[0381] Control group 4: volume-corrected control;

[0382] Control group 5: culture medium background control.

[0383] Calculation of experimental results: Subtract the mean absorbance of the culture medium background absorbance from the absorbance of all experimental groups, target cell spontaneous LDH release groups, and effector cell spontaneous LDH release groups; subtract the mean absorbance of the volume correction control from the absorbance of the target cell maximum LDH release control; substitute the corrected values ​​obtained in the above steps into the following formula to calculate the cytotoxicity (%) produced by each effector-target ratio:

[0384] Calculation formula: % cytotoxicity = (experimental group - effector cell spontaneous group - target cell spontaneous group / target cell maximum - target cell spontaneous) * 100

[0385] The results are as follows Figures 6A-6E As shown, the above data indicate that CAR-GPC3 T cells expressing IFN can not only specifically kill GPC3-positive cells, but also improve the killing activity of CAR-T cells expressing IFN (GPC3-28Z-IFN).

[0386] Example 6. Cytotoxicity of CLD18A2 CAR-T cells with and without IFN

[0387] 293T-A1 and 293T-A2 cells are human renal epithelial cell lines stably expressing CLD18A1 and CLD18A2 in vitro. AGS and BGC-823 are human gastric cancer cell lines, from which AGS-A2 and BGC-823-A2 cell lines stably expressing CLD18A2 were constructed.

[0388] Detection method: The CytoTox 96 Non-Radioactive Cytotoxicity Assay Kit (Promega) was used for detection (for specific methods, please refer to the instructions of the CytoTox 96 Non-Radioactive Cytotoxicity Assay Kit). The in vitro cytotoxic killing effect of CAR T lymphocytes on 293T-A1, 293T-A2, AGS, AGS-A2, BGC-823, and BGC-823-A2 cells was detected.

[0389] To compare the killing effects of 85-2-28Z and 85-2-28Z-IFN T cells on target cells, we

[0390] Mock T cells, 85-28Z T cells, and 85-28Z-IFN T cells were co-cultured with CLD18A2-positive 293T-A2, AGS-A2, and BGS-823A2 cells at effector-target ratios of 1:3, 1:1, and 3:1, respectively, for 18 h. CLD18A2-negative 293T-A1, AGS, and BGC-823 cells were used as controls.

[0391] Experimental group: each target cell + CAR T expressing different chimeric antigen receptors;

[0392] ① Spontaneous LDH release from effector cells: Correction of LDH spontaneously released from effector cells;

[0393] ② Spontaneous LDH release from target cells: Correction of LDH spontaneously released from target cells;

[0394] ③ Maximum LDH release of target cells: This control is required to determine 100% LDH release during calculation;

[0395] ④ Volume correction control: correct for volume changes caused by the addition of lysis buffer (10×);

[0396] ⑤ Culture medium background control: Correct the LDH activity produced by the serum in the culture medium and the background absorption caused by phenol red.

[0397] Calculation formula: % cytotoxicity = [(experimental group – effector cell control – target cell control) / (maximum target cell lysis – target cell control)] × 100. Before calculation, the effector cell control, target cell control, and experimental group were subtracted from the medium control; the maximum target cell lysis was subtracted from the volume control.

[0398] In vitro toxicity experiments were conducted using CAR T lymphocytes expressing Mock, 85-2-28Z, and 85-2-28Z-IFN and tumor cells at effector-target ratios of 1:3, 1:1, and 3:1, respectively. The cells were co-cultured for 18 hours. The results of the cytotoxicity of the two CAR T cells against CLD18A2-positive target cells were as follows: Figure 7 shown.

[0399] Example 7. Determination of GPC3 CAR-T cell survival time in vivo

[0400] Referring to the experimental procedures of steps 1) to 3) in Example 3, CAR-T (GPC3-28Z T cells or GPC3-28Z-IFN T cells) cells were infused through the tail vein for 7 days, and the survival of CAR-T cells (GPC3-28Z T cells or GPC3-28Z-IFN T cells) in vivo was detected. The results are shown in Table 4. The number of T cells (CD3+) and CAR-T cells per μl of peripheral blood in the GPC3-28Z-IFN T cell group was higher than that in the GPC3-28Z T cell group and the Mock group.

[0401] Table 4. Number of surviving T cells in peripheral blood

[0402] CD3+ (cells / μL) CAR-T (cells / μL) Mock 193.1453 0 GPC3-28Z 375.802 232.2 GPC3-28Z-IFN 1034.315 439.5

[0403] Example 8. Determination of CLD18A2 CAR-T cell survival time in vivo

[0404] Establishment of Gastric Cancer PDX Model:

[0405] Gastric cancer PDX tumors of approximately 2×2×2 mm in size were inoculated subcutaneously in the right axilla of NOD / SCID mice. The day of tumor cell inoculation was designated as day 0.

[0406] Adoptive transfer of T cells:

[0407] When the tumor volume is 100 mm 3 At 100 mg / kg of cyclophosphamide was injected intraperitoneally, and 1.0×10 7 CAR-T cells (85-2-28Z T cells or 85-2-28Z-IFN T cells), and the mock T cell group was used as a control.

[0408] Peripheral blood was drawn from the saphenous vein of mice on days 5, 7, and 10 after CAR-T cell infusion to detect the survival of CAR-T cells (empty T cells (Mock), 85-2-28Z T cells, or 85-2-28Z-IFN T cells) in vivo.

[0409] The results are as follows Figures 8A-8C As shown, the number of surviving T cells in the 85-2-28Z-IFN T cell treatment group was significantly higher than that in the 85-2-28Z T cell treatment group.

[0410] Example 9 In vivo cytotoxicity of GPC3 CAR-T (92-28Z) cells with and without IFN

[0411] The anti-tumor therapeutic effects of untransfected T cells (Mock), GPC3-28Z T cells and GPC3-28Z-IFN T cells on Huh7 subcutaneous transplanted tumors were determined.

[0412] 1) Experimental groups: 21 NOD-SCID mice aged 6-8 weeks were randomly divided into three groups, with 7 mice in each group, including untransfected T cell group, GPC3-28Z T cell group, and GPC3-28Z-IFN T cell group.

[0413] 2) Inoculation of subcutaneous transplanted tumors: Huh7 cells in the logarithmic growth phase and in good growth condition were collected and the density was adjusted to 1×10 7 / mL, and inoculated NOD-SCID mice to establish the mouse model, with an injection volume of approximately 200 μL (2×10 6 / mouse), and the day of tumor cell inoculation was designated as day 0.

[0414] 3) Adoptive transfer of T cells: When the tumor volume is 200-300mm 3At 14:00 pm, 200 mg / kg of cyclophosphamide was injected intraperitoneally, and 1.4 × 10 7 CAR-T cells (GPC3-28Z T cells or GPC3-28Z-IFN T cells), while the untransfected T cell group was used as a control to observe and measure the growth of subcutaneous transplanted tumors ( Figure 9A ), and wait until the tumor size of the mice in the control group reaches 2000mm 3 When the experiment was over, the animals were killed and the tumors were separated and photographed ( Figure 9B ).

[0415] The results are as follows Figure 9A and 9B As shown in the results, GPC3-28Z-IFN T cells were able to significantly inhibit the growth of tumor cells. On the 13th day after CART cell infusion, the tumor inhibition rate of GPC3-28Z CART cells was 66.5%, and the tumor inhibition rate of GPC3-28Z-IFN CART cells was 82.3%, indicating that GPC3-28Z-IFN T cells further enhanced the ability of CAR-T cells to inhibit tumor growth.

[0416] Example 10 In vivo killing activity of CLD18A2 CAR-T cells with and without IFN

[0417] The anti-tumor therapeutic effect of untransfected T cells (Mock), 85-28Z T cells and 85-2-28Z-IFN T cells on BGC-823-A2 cell subcutaneous transplanted tumors was determined.

[0418] 1) Inoculation of BGC-823-A2 subcutaneous transplanted tumors: BGC-823-A2 cells in the logarithmic growth phase and in good growth condition were collected and the density was adjusted to 2.5×10 7 / mL, the injection volume of cell suspension was 200 μL (5×10 6 The day of tumor cell inoculation was designated as day 0.

[0419] 2) Experimental Grouping: Eleven days after tumor inoculation, the volume of BGC-823-A2 xenografts was measured, and NOD-SCID mice were randomly divided into four groups, six mice each: an untransfected T cell group, an 85-28Z T cell group, an 85-2-28Z cell group, and an 85-2-28Z-IFN T cell group.

[0420] 3) Adoptive transfer of T cells: When the tumor volume is 100-150mm 3 At day 11, 100 mg / kg of cyclophosphamide was injected intraperitoneally, and 1×10 7CAR T cells (Mock cells, 85-28Z T, 85-2-28Z T cells or 85-2-28Z-IFN cells), and the untransfected T cell group (Mock group) as a control, observed and measured the growth of subcutaneous transplanted tumors.

[0421] The results of animal experiments are as follows Figure 10A and Figure 10B As shown in the figure, the results showed that 85-2-28Z-IFN CAR T cells had a better therapeutic effect on BGC-823-A2 transplanted tumors than 85-2-28Z CAR T cells.

[0422] Example 11 Anti-tumor test of CLD18A2 CAR-T cells with and without IFN in subcutaneous transplanted tumors of gastric cancer PDX model

[0423] The anti-tumor treatment experiments of untransfected T cells (UTD), 85-2-28Z T cells and 85-2-28Z-IFN T cells on subcutaneous transplanted tumors in gastric cancer PDX model were observed.

[0424] 1) Establishment of gastric cancer PDX model: A gastric cancer PDX tumor mass of approximately 2×2×2 mm was inoculated subcutaneously in the right axilla of 6-8 week-old female NOD / SCID mice. The day of tumor cell inoculation was designated as day 0.

[0425] 2) Experimental grouping: 15 days after tumor inoculation, NOD-SCID mice were randomly divided into three groups, with 7 mice in each group, namely, the untransfected T cell group, the 85-2-28Z T cell group, and the 85-2-28Z-IFN T cell group.

[0426] 3) Adoptive T cell transfer: When the tumor volume reached 30 mm³, 100 mg / kg of cyclophosphamide was injected intraperitoneally. 24 hours later, 1.0 × 107 CAR-T cells (85-2-28Z T cells or 85-2-28Z-IFN T cells) were infused via the tail vein. An untransfected T cell group served as a control. The growth of gastric cancer PDX subcutaneous xenografts was measured.

[0427] The results are as follows Figure 11 As shown, the tumor completely regressed in one of the seven mice in the 85-2-28Z-IFN treatment group.

[0428] Example 12 Effects of GPC3 CAR-T (92-28Z) cells with and without IFN on tumor infiltration in vivo

[0429] Referring to the animal model established in Example 9, 14 days after the infusion of GPC3-28Z and GPC3-28Z-IFN CAR-T cells, tumor tissues were collected and CD3+ cells were detected by histochemical analysis. The results were as follows: Figure 12A and 12B As shown: 4-7 fields of view were taken for each sample, and the number of CD3-positive T cells was counted. The results showed that there was no obvious infiltration of CD3+ cells in the tumor tissue of the control group, and the number of CD3+ T cells in the INFβ-CAR-T treatment group was higher than that in the 28ZCART group.

[0430] Example 13. Effects of CLD18A2 CAR-T cells with and without IFN on tumor infiltration in vivo

[0431] Referring to the animal model established in Example 10, 17 days after the infusion of Mock, 85-28Z, 85-2-28Z and 85-2-28Z-IFN cells, tumor tissues were obtained and CD3+ cells were detected by histochemical analysis.

[0432] The results are as follows Figure 13 As shown in the figure, almost no T cell infiltration of mock T cells was observed around the tumor tissue, 85-28Z and 85-2-28Z CAR T cells were seen at the edge of the tumor tissue, and 85-2-28Z-IFN T cells could be observed to have a certain infiltration inside the tumor tissue.

[0433] Example 14. Construction of EGFR CAR with and without IFN

[0434] The structures of EGFR-CAR (806-28Z, SEQ ID NO: 56) and EGFR-CAR-IFN (encoded by the nucleic acid shown in SEQ ID NO: 60) are as follows: Figure 14 As shown in .

[0435] The retrovirus packaging system was used to package the EGFR-CAR and EGFR-CAR-IFN into retrovirus and then infected mouse T lymphocytes. The infection positive rates were 65.1% and 35.2%, respectively. Figure 15 ).

[0436] Example 15. Determination of the ability of EGFR CAR (806-28Z) T cells containing IFN and without IFN to secrete mIFNβ in vitro

[0437] In order to detect the function of EGFR-CAR-IFN inducing the secretion of mIFNβ, we co-cultured CAR-T cells with target cells CT26-VIII at a ratio of 1:1 and 3:1 for 24 hours, took the supernatant, and detected the expression of mIFNβ by ELISA. At the same time, CT26 cells without targets were used as negative controls, and concanavalin A (ConA) was used as a positive control. The results showed that after stimulation of target cells, mCAR-806-mIFNβ was successfully activated and induced the expression of mIFNβ, while no mIFNβ expression was detected in the control group ( Figure 16 ).

[0438] Example 16. Cytokine Release by EGFR CAR (806-28Z)-T Cells with and without IFN

[0439] In order to verify that the constructed EGFRCAR and EGFR-CAR-IFN can also be effectively activated under the stimulation of target cells, we detected the secretion of muCAR-T cytokines after co-incubation with target cells. Untransfected UT cells, EGFR-CAR and EGFR-CAR-IFN were co-incubated with target-positive CT26-VIII cells at a ratio of 1:1 for 24 hours, and the culture supernatant was taken to detect the secretion of cytokines mIL-2, mIFN-γ, and mTNF-α. Target-negative CT26 cells were used as controls. The results showed that EGFR-CAR and egfr-CAR-IFN had higher concentrations of mIL-2, mIFN-γ, and mTNF-α secretion after co-incubation with target cells ( Figure 17A 、 17B , 17C), indicating that both EGFR-CAR and EGFR-CAR-IFN muCAR-T cells can be effectively activated under the stimulation of target antigens.

[0440] Example 17 In vitro toxicity test of EGFR CAR (806-28Z)-T cells with and without IFN

[0441] To compare the in vitro cytotoxicity of EGFR-CAR and EGFR-CAR-IFN against target cells, we co-incubated EGFR-CAR and EGFR-CAR-IFN with EGFR-positive CT26VIII cells at a ratio of 1:3, 1:1, or 3:1 for 18 h. Untransfected mouse UT cells served as isotype controls, and CT26 served as an EGFR-negative control.

[0442] The results showed that EGFR-CAR and EGFR-CAR-IFN had a strong killing effect on target-positive CT26VIII cells compared with UT cells, and the difference was significant (***P < 0.001). The killing percentage was dose-dependent. However, untransfected UT cells had no killing effect on CT26 and CT26VIII. EGFR-CAR and EGFR-CAR-IFN CAR-T cells had no killing effect on target-negative CT26 cells ( Figure 18 ).

[0443] Example 18 In vivo toxicity test of EGFR CAR (806-28Z)-T cells with and without IFN

[0444] Using the mouse colon cancer CT26 cell line stably transfected with the human EGFRvIII-806 site, subcutaneous tumors were inoculated in Babl / c mice, and then EGFR-CAR T cells were administered. The results were as follows Figure 19 As shown in the data, the tumor size of the EGFR-CAR-T cells was basically the same as that of the control group, and no inhibitory effect was observed. However, after the EGFR-CAR-IFN cells were reinfused, the tumor growth began to be inhibited on the 7th day, with a tumor inhibition rate of 5.9%. It reached the highest point on the 10th day, which was 18.5%. By the 17th day, the tumor inhibition rate could still reach 12.4%, which was significantly better than the EGFR-CAR-T cell group.

[0445] All documents mentioned in this application are incorporated herein by reference, just as if each document were incorporated herein by reference individually. It should also be understood that after reading the above teachings of the present invention, those skilled in the art may make various changes or modifications to the present invention, and that such equivalents also fall within the scope of the claims appended hereto.

[0446] Table 5. Sequences used in this article

[0447]

[0448]

[0449]

[0450]

[0451]

[0452]

[0453]

[0454]

[0455]

[0456]

[0457]

[0458]

[0459]

[0460]

[0461]

[0462]

[0463]

[0464]

[0465]

[0466]

[0467]

[0468]

Claims

1. An antibody that binds to GPC3, characterized in that The antibody has the amino acid sequence shown at positions 1 to 243 of SEQ ID NO: 49, 50 or 51.

2. A receptor comprising the antibody according to claim 1, characterized in that The receptor comprises the antibody according to claim 1, a transmembrane region and an intracellular signal region connected in sequence.

3. The receptor according to claim 2, wherein The intracellular signaling region comprises: a T cell stimulating signal molecule or a combination of a T cell stimulating signal molecule and a T cell activation costimulatory molecule.

4. The receptor according to claim 2, wherein The transmembrane region is selected from the transmembrane region of CD8 or CD28 or a protein that is at least 85, 90, 95, 96, 97, 98, 99 or 100% identical to the native transmembrane region of CD8 or CD28.

5. The receptor according to claim 3, wherein The intracellular signaling region is selected from: CD3ζ, or CD137 and CD3ζ, or CD28 and CD3ζ, or the intracellular signaling region of CD28, CD137 and CD3ζ.

6. A nucleic acid encoding the antibody according to claim 1 or the receptor according to any one of claims 2 to 5.

7. A carrier, characterized in that The vector comprises the nucleic acid of claim 6. The vector according to claim 7 , which is an expression vector.

9. A virus comprising the nucleic acid of claim 6 or the vector of claim 7 or 8.

10. An engineered cell, characterized in that The engineered cells comprise the antibody of claim 1, the receptor of any one of claims 2-5, the nucleic acid of claim 6, and / or the vector of claim 7 or 8; or the cells are prepared by viral transduction of claim 9.

11. The engineered cell according to claim 10, wherein The engineered cells are immune response cells.

12. The engineered cell according to claim 10 or 11, wherein The engineered cells are T cells, natural killer cells, cytotoxic T lymphocytes, and / or DNT cells.

13. The engineered cell according to claim 12, wherein The engineered cells are natural killer T cells and / or regulatory T cells.

14. The engineered cell according to claim 12, wherein The engineered cells also carry the coding sequence of an exogenous cytokine; or also express another receptor that binds to an antigen; or also express a chemokine receptor; or also express siRNA that can reduce PD-1 expression or a protein that blocks PD-L1.

15. The engineered cell according to claim 12, wherein The engineered cells also constitutively express or inducibly express exogenous interferon beta.

16. A pharmaceutical composition, characterized in that The pharmaceutical composition comprises the antibody of claim 1, the receptor of any one of claims 2-5, the nucleic acid of claim 6, the vector of claim 7 or 8, the virus of claim 9, and / or the engineered cell of any one of claims 10-15, and a pharmaceutically acceptable carrier or excipient.

17. Use of the receptor according to any one of claims 2 to 5, the nucleic acid according to claim 6, the vector according to claim 7 or 8, the virus according to claim 9, the engineered cell according to any one of claims 10 to 15, and / or the pharmaceutical composition according to claim 16 in the preparation of a drug for treating a disease, characterized in that: The disease is selected from the group consisting of liver cancer, lung cancer, stomach cancer, prostate cancer, colon cancer, breast cancer, gallbladder cancer, kidney cancer, ovarian cancer, cervical cancer, or glioma.

Citation Information

Patent Citations

  • Nucleic acid for coding GPC-3 (glypican-3) chimeric antigen receptor protein and T lymphocytes for expression of GPC-3 chimeric antigen receptor protein

    CN104140974A

  • Antibodies which bind to molecules containing at least one peptide sequence carrying one or several epitopes characteristic of a liver stage antigen produced by P. falciparum in hepatocytes

    US5589343A

  • Nucleic acid sequences and methods for detecting candida tropicalis in blood

    US5645992A

  • Hepatitis C virus-derived peptides capable of inducing cytotoxic T lymphocyte responses

    US5709995A

  • Recombinant virus vectors encoding human papillomavirus proteins

    US5719054A