Fungus medium aspergillus, its exopolysaccharide and application of the exopolysaccharide

CN118165131BActive Publication Date: 2026-09-25SOUTH CHINA AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202311019871.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-08-14
Publication Date
2026-09-25
Estimated Expiration
2043-08-14

Smart Images

  • Figure CN118165131B_ABST
    Figure CN118165131B_ABST
Patent Text Reader

Abstract

The application discloses a kind of fungi medium-sized aspergillus, its exocellular polysaccharide and the application of exocellular polysaccharide, the strain is inoculated in fermentation medium and is fermented to obtain fermentation liquor;Fermentation liquor is except bacteria, except protein, dialysis, and obtains exocellular polysaccharide crude extract;Exocellular polysaccharide crude extract is adsorbed pigment by macroporous resin column, and DEAE Fast Flow anion exchange column chromatography purification is carried out, and the exocellular polysaccharide with molecular weight of 9015Da is obtained.The structure formula of the exocellular polysaccharide is determined by analyzing the composition of monosaccharide, methylation, infrared spectrum analysis and nuclear magnetic resonance spectrum analysis.At cell level, preliminary experiment proves that it has significant immune activity to RAW264.7 macrophage cell, and its related action mechanism and key target are explored, and the potential action target and possible action mechanism of the related immune regulation mechanism of the exocellular polysaccharide of fungi medium-sized aspergillus are preliminarily proposed.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of microbial technology, polysaccharide technology, and natural product extraction technology, specifically to a fungus, Aspergillus medius SCAU236, isolated from the intestines of marine coral fish, and the extracellular polysaccharide produced by fermentation of this strain and its application in the preparation of immunomodulatory agents. Background Technology

[0002] In 2015, Leila Ebrahimi, a scholar at the University of Tehran in Iran, isolated *Venturia inaequalis* from apple leaves and fruits in the laboratory. Some fungi appeared as culture contaminants, from which *Aspergillus medius* was isolated (Leila Ebrahimi, Khalil-Berdi Fotouhifar, *Aspergillus medius*, a new record to the mycobiota of Iran, Rostaniha 16(2):212-214 (2015)). The authors of this paper identified this strain as *Aspergillus medius* through ITS DNA sequence analysis. The inventors of this application isolated and extracted the strain from intestinal samples collected from coral fish in the South China Sea. After identification of the ITS DNA gene sequence, it was determined that the strain had a 99% similarity to the ITS sequence of Aspergillus medius (KT832076.1), and was finally named Aspergillus medius SCAU236.

[0003] Simultaneously, the present invention inoculates the fungal strain Aspergillus medius SCAU236 into a fermentation medium for fermentation culture to obtain a fermentation broth. After removing bacterial cells and proteins from the fermentation broth, the broth is dialyzed to obtain a crude extracellular polysaccharide extract. The crude extracellular polysaccharide extract is purified by adsorbing pigments onto a macroporous resin column and by DEAE Fast Flow anion exchange column chromatography to obtain an extracellular polysaccharide with a molecular weight of 9015 Da. The inventors determined the structural formula of this extracellular polysaccharide by analyzing the monosaccharide composition, methylation, infrared spectroscopy, and nuclear magnetic resonance spectroscopy. Furthermore, the inventors of this invention have preliminarily demonstrated its significant immunomodulatory activity against RAW264.7 macrophages and proved that the extracellular polysaccharide of Aspergillus medius mediates ferroptosis to regulate immune activity targets.

[0004] Ferroprelation is a newly discovered iron-dependent cell death pathway characterized by iron metabolism-mediated lipid peroxidation and glutathione depletion, often accompanied by inflammatory responses. Macrophages are a class of immune cells widely distributed in our bodies for host defense. Under different polarizations, macrophages mediate inflammation and regulate iron, lipid, and amino acid metabolism through their unique phagocytic activity, cytokine secretion, and lipid peroxide production, playing a crucial role in tissue homeostasis. These shared characteristics of ferroptosis and macrophage function suggest a relationship between immune regulation and ferroptosis. In recent years, some studies have explored cancer treatment by altering macrophage polarization, regulating immune activity, disrupting the tumor microenvironment, and inducing ferroptosis in cancer cells.

[0005] Currently, there are no reports in existing technologies of isolating the fungus Aspergillus medius from marine coral fish, nor are there any reports of producing extracellular polysaccharides by fermentation of this fungus. Summary of the Invention

[0006] To address the aforementioned technical problems, this invention provides a fungus, Aspergillus medius SCAU236, isolated from the intestines of marine coral fish, as well as an extracellular polysaccharide produced by fermentation of this strain and its application in the preparation of immunomodulatory agents.

[0007] The solution of the present invention to the above-mentioned technical problems is as follows:

[0008] The first aspect of this invention provides a fungus, Aspergillus medius, isolated from the intestines of marine coral fish. The strain was identified as Aspergillus medius and deposited on January 12, 2023, at the Guangdong Provincial Microbial Culture Collection Center, located at 5th Floor, Building 59, Guangdong Institute of Microbiology, No. 100 Xianlie Middle Road, Tianhe District, Guangzhou, Guangdong Province, with accession number GDMCC NO: 63136.

[0009] The samples were sourced from Daya Bay, Shenzhen, Southern China. Coral reef fish, gut-like;

[0010] Furthermore, the intestinal sample was ground, diluted, and a certain amount was inoculated onto a PDA plate. The PDA plate composition was 46 g / L potato dextrose agar and 30 g / L sea salt. The plate was incubated at 26°C to obtain the fungal strain Aspergillus medius SCAU236. The PDA plate was purchased from Huankai Microbial Technology Co., Ltd.

[0011] Furthermore, the strain was identified based on its ITS DNA gene sequence. The genome of Aspergillus medius SCAU236 was extracted, and its ITS DNA gene was amplified by PCR. The ITS DNA gene sequence of the obtained strain was then compared with the NCBI database using BLAST. The results showed that the ITS sequence of the strain obtained in this invention had a 99% similarity to that of Aspergillus medius (KT832076.1), and it was ultimately named Aspergillus medius SCAU236.

[0012] A second aspect of the present invention provides an extracellular polysaccharide from the fungus *Aspergillus oryzae*, wherein the fermentation extracellular polysaccharide of *Aspergillus oryzae* has the following structural formula:

[0013] The invention described in this application involves inoculating the fungal strain Aspergillus medius SCAU236 into a fermentation medium for fermentation to obtain a fermentation broth. After removing bacterial cells and proteins from the fermentation broth, the mixture is dialyzed to obtain a crude extracellular polysaccharide extract. This crude extract is then purified by adsorbing pigments onto a macroporous resin column and by DEAE Fast Flow anion exchange chromatography to obtain an extracellular polysaccharide with a molecular weight of 9015 Da. The inventors determined the structural formula of this extracellular polysaccharide through analysis of its monosaccharide composition, methylation, infrared spectroscopy, and nuclear magnetic resonance spectroscopy.

[0014]

[0015] Furthermore, the extracellular polysaccharide of the fungus Aspergillus medium has a weight-average molecular weight of 9015 Da, and the monosaccharide composition of the extracellular polysaccharide of the fungus Aspergillus medium is 100% glucose.

[0016] Furthermore, the aforementioned Aspergillus medius fermentation extracellular polysaccharide is obtained by inoculating Aspergillus medius strain SCAU236 into a culture medium and fermenting it, and isolating it from the fermentation broth. It is understood that this Aspergillus medius extracellular polysaccharide is a polysaccharide with a novel structure. This polysaccharide can be isolated from the fermentation broth after Aspergillus medius is inoculated into a suitable fermentation medium, or it can be isolated from the extracellular polysaccharides of other microorganisms, such as bacteria, or it can be directly isolated from other natural products.

[0017] A third aspect of the present invention provides a method for preparing extracellular polysaccharides from the fungus Aspergillus medium-sized, comprising the following steps:

[0018] (1) The fungus Aspergillus medius SCAU236 was isolated from the intestines of coral fish in the South China Sea.

[0019] (2) The above-mentioned Aspergillus medius SCAU236 strain was subjected to liquid fermentation, and the fermentation broth was collected;

[0020] (3) The polysaccharides in the above fermentation broth were separated to obtain crude extracellular polysaccharides of the fungus Aspergillus medium-sized;

[0021] (4) The above-mentioned extracellular crude polysaccharide of Aspergillus medium-sized fungus was subjected to DEAE Fast Flow anion exchange column chromatography, the elution peak was collected, and the mixture was freeze-dried to obtain the extracellular polysaccharide of Aspergillus medium-sized fungus.

[0022] In step (2) of this invention, the fungal strain *Aspergillus medius* SCAU236 is subjected to liquid fermentation, and the fermentation broth is collected. The liquid culture medium for liquid fermentation includes: 10.0 g / L maltose, 10.0 g / L glucose, 20.0 g / L mannitol, 0.5 g / L magnesium sulfate heptahydrate, 0.5 g / L potassium dihydrogen phosphate, 1.0 g / L corn steep liquor, 3.0 g / L yeast extract, 30.0 g / L sea salt, and 0.5 g / L L-cysteine, with water as the solvent; pH 6.0; and constant temperature fermentation at 25-30°C for 6-7 days to obtain the fermentation broth. This invention has also experimented with other fermentation media, such as:

[0023] Culture medium No. 1: Each 1L of culture medium contains: 20g glucose, 5g peptone, 3g sodium ammonia, 0.5g potassium dihydrogen phosphate, 30g sea salt, pH 7.0;

[0024] Culture medium No. 2: Each 1L of culture medium contains: 40g glucose, 10g yeast extract, 10g peptone, 30g sea salt, pH 6.5;

[0025] Culture medium No. 3: Each 1L of culture medium contains: mannitol 20g, glucose 10g, maltose 10g, yeast extract 3g, corn steep liquor 1g, magnesium sulfate heptahydrate 0.5g, potassium dihydrogen phosphate 0.5g, L-cysteine ​​0.5g, sea salt 30g, pH 6.0.

[0026] Fermentation was carried out using equal amounts of the three fermentation broths and inoculum amounts. The crude polysaccharide yields for media 1, 2, and 3 were 0.0289, 0.3228, and 1.4322 g / L, respectively. Therefore, media 3 is the more ideal culture medium for the fermentation of this strain.

[0027] In step (2) above, the Aspergillus medius SCAU236 strain of fungus is subjected to liquid fermentation. Collecting the fermentation broth is a commonly used technique in this field. For example, in a clean bench, the activated Aspergillus medius SCAU236 fungus is picked from the PDA solid medium using a high-temperature sterilized bamboo stick and inoculated into a sterilized liquid medium. The medium is gently shaken to distribute the strain evenly in the liquid medium. The medium is then fermented for 6-7 days at 25-27℃ and 140rpm using a vortex shaker to obtain the fermentation broth.

[0028] The Aspergillus medius SCAU236 strain was obtained through activation culture on PDA solid medium. Medium activation is known in the art; for example, in a clean bench, Aspergillus medius SCAU236 was inoculated into sterilized PDA solid medium culture dishes using a sterilized inoculation loop. The PDA solid medium consisted of 46 g / L potato dextrose agar and 30 g / L sea salt, purchased from Huankai Microbial Technology Co., Ltd. Activation was performed in a constant temperature incubator at 26-28℃ for 6-7 days, and repeated 2-3 times. The Aspergillus medius SCAU236 strain with excellent activation characteristics was extracted for large-scale fermentation.

[0029] Furthermore, a pH adjuster can be added to the culture medium to adjust the pH of the medium to approximately 6.0-7.0. The pH adjuster is known in the art and includes, for example, but not limited to, hydrogen chloride, sodium hydroxide, lactic acid, citric acid, ammonia, sodium lactate, sodium citrate, and sodium hydroxide, with hydrogen chloride and sodium hydroxide being preferred.

[0030] Furthermore, in step (3), the method for separating polysaccharides from the fermentation broth includes the following steps:

[0031] 1) Remove the bacterial cells from the fermentation broth, concentrate it, and obtain a concentrated solution;

[0032] 2) Use a mixture of ammonium sulfate and tert-butanol to remove proteins and impurities from the above concentrate, and collect the ammonium sulfate phase;

[0033] 3) Dialyze the above ammonium sulfate phase using a dialysis bag with a molecular weight cutoff of 3000 Da, collect the liquid trapped in the dialysis bag, freeze-dry it, and obtain the crude extracellular polysaccharide of the first fungus, Aspergillus medium-sized.

[0034] 4) The crude extracellular polysaccharide of the first fungus, Aspergillus medium-sized, was eluted with macroporous resin. The crude extracellular polysaccharide of the first fungus, Aspergillus medium-sized, was dissolved in water to a solution of 500 mg / ml. 5 ml of the solution was loaded onto the resin, and the elution buffer was primary water. The elution peak was collected and freeze-dried to obtain the crude extracellular polysaccharide of the second fungus, Aspergillus medium-sized.

[0035] The removal of bacterial cells from the fermentation broth in step (3) above is a known technique in the art. For example, a disc centrifuge or tubular centrifuge can be used at approximately 8000-10000 rpm for about 1-10 minutes. Alternatively, membrane separation filtration can be performed using ceramic or organic membranes. Filtration can also be performed using a vacuum filter pump. In this invention, a vacuum filter pump (double-ring qualitative filter paper) is preferably used to remove bacterial cells, resulting in a fermentation broth free of impurities.

[0036] The fermentation broth for removing bacteria in step (3) above is a known technology in the field. For example, it can be concentrated by ultrafiltration membrane, such as ceramic membrane, cellulose acetate membrane, hollow fiber polysulfone membrane, polyethersulfone membrane, etc. Alternatively, a rotary evaporator can be used to concentrate the filtrate under reduced pressure at 60-70℃ and 30 rpm until it reaches 1 / 4 of the original volume, and the concentrate is collected.

[0037] In step (3) above, a mixture of ammonium sulfate and tert-butanol is used to remove proteins and impurities from the concentrated solution. Collecting the ammonium sulfate phase is a known technique in the art. The volume ratio of the ammonium sulfate and tert-butanol mixture to the concentrated solution is (2-4):(4-6):(8-10). The mixture is magnetically stirred for 40-50 minutes, centrifuged at ultra-high speed (8000-12000 rpm, 10 minutes, room temperature), and allowed to stand for 20-40 minutes to form a three-phase system. The ammonium sulfate phase is then collected. Alternatively, hot water extraction, ethanol precipitation, or the Sevage method can be used to remove proteins. In this invention, a mixture of ammonium sulfate and tert-butanol is used to remove proteins and impurities from the concentrated solution.

[0038] In step (3) above, the elution of the crude extracellular polysaccharide of the first fungus, *Aspergillus medius*, using macroporous resin is a known technique in the art. The crude extracellular polysaccharide of the first fungus, *Aspergillus medius*, is dissolved in water to a solution of 500 mg / ml, 5 ml of which is loaded. The eluent is primary water, and the elution flow rate is 2-3 BV / h. The elution peak is collected and freeze-dried to obtain the crude extracellular polysaccharide of the second fungus, *Aspergillus medius*. Alternatively, using DEAE Fast Flow anion exchange column chromatography, the crude extracellular polysaccharide of the second fungus, *Aspergillus medius*, is dissolved in water to a solution of 500 mg / ml, 5 ml of which is loaded. The eluent is successively primary water, 0.1 M NaCl, 0.3 M NaCl, 0.6 M NaCl, 0.9 M NaCl, and 1.2 M NaCl solutions, with a flow rate of 1 ml / min. The eluent obtained from the primary water elution is collected and freeze-dried to obtain the extracellular polysaccharide of the fungus, *Aspergillus medius*.

[0039] A fourth aspect of the present invention provides the use of the aforementioned fungal Aspergillus medium-sized extracellular polysaccharide in the preparation of immunomodulatory agents.

[0040] This invention uses the CCK-8 assay to detect the effect of extracellular polysaccharides from the fungus Aspergillus medium-sized on macrophage proliferation.

[0041] The effect of extracellular polysaccharide from Aspergillus medium-sized fungus on NO release from RAW 264.7 macrophages was detected using a NO kit, thereby determining the stimulatory effect of extracellular polysaccharide from Aspergillus medium-sized fungus on RAW 264.7 macrophages.

[0042] The effect of extracellular polysaccharide from Aspergillus medium-sized fungus on the release of immune factors from RAW 264.7 macrophages was detected using an ELISA kit, indicating that extracellular polysaccharide from Aspergillus medium-sized fungus has an immune response.

[0043] Experimental results show that the prepared fungal medium-sized Aspergillus extracellular polysaccharide exhibits significant immunomodulatory activity against RAW264.7 macrophages at the cellular level. Based on the immunomodulatory activity of the fungal medium-sized Aspergillus extracellular polysaccharide, its related mechanisms of action and key targets are explored, and potential targets and possible mechanisms of action related to the immunomodulatory mechanism of fungal medium-sized Aspergillus extracellular polysaccharide are preliminarily proposed. The fungal medium-sized Aspergillus extracellular polysaccharide prepared in this invention can be used as an immunomodulator with good application prospects. The construction and application of the fungal medium-sized Aspergillus extracellular polysaccharide-mediated ferroptosis mechanism model established in this invention can provide a preliminary analysis of the potential mechanism of the polysaccharide's immunomodulatory effect, which is beneficial to providing a reference for in-depth research on the immunomodulatory mechanism of marine fungal polysaccharides and providing new predictive models and analytical methods for the study of the activity mechanism of marine polysaccharides.

[0044] Biological Preservation Information:

[0045] The fungus *Aspergillus medius* SCAU236 is deposited at the Guangdong Provincial Culture Collection Center for Microbial Cultures, located at 5th Floor, Building 59, Guangdong Institute of Microbiology, No. 100 Xianlie Middle Road, Tianhe District, Guangzhou, Guangdong Province, with accession number GDMCC NO: 63136 and deposit date January 12, 2023. Attached Figure Description

[0046] Figure 1 Phylogenetic tree constructed from the ITSDNA sequence of the fungus Aspergillus medium-sized of this invention

[0047] Figure 2 DEAE Fast Flow elution curve of the extracellular polysaccharide of medium-sized Aspergillus fungus obtained in this invention.

[0048] Figure 3Gel chromatogram of molecular weight of extracellular polysaccharide of medium-sized Aspergillus fungus obtained in this invention

[0049] Figure 4 The monosaccharide composition ion chromatogram of the extracellular polysaccharide of medium-sized Aspergillus fungus obtained in this invention

[0050] Figure 5 Analysis diagram of methylated monosaccharide residues of the fungal medium-sized Aspergillus polysaccharide obtained in this invention

[0051] Figure 6 Infrared spectrum of the extracellular polysaccharide of medium-sized Aspergillus fungus obtained in this invention

[0052] Figure 7 Nuclear magnetic resonance image of the extracellular polysaccharide of medium-sized Aspergillus fungus obtained in this invention

[0053] Figure 8 Structural diagram of the fungal medium-sized Aspergillus extracellular polysaccharide obtained in this invention

[0054] Figure 9 The effect of the extracellular polysaccharide of medium-sized Aspergillus fungus prepared in this invention on the proliferation of RAW264.7 macrophage cells.

[0055] Figure 10 The effect of the fungal medium-sized Aspergillus extracellular polysaccharide prepared in this invention on NO release from RAW 264.7 cells is shown in the figure.

[0056] Figure 11 The effect of the extracellular polysaccharide of medium-sized Aspergillus fungus prepared in this invention on the release of immune factors from RAW 264.7 cells is shown in the figure.

[0057] Figure 12 Immunoblot image of the extracellular polysaccharide of Aspergillus medium-sized fungus prepared in this invention regulating the immunomodulatory activity of RAW 264.7 cells.

[0058] Figure 13 Immunoblot image of RAW 264.7 cell ferroptosis mediated by the extracellular polysaccharide of the fungus Aspergillus medium-sized obtained in this invention.

[0059] Figure 14 Flow cytometry diagram of lipid peroxidation mediated by extracellular polysaccharide of the fungus Aspergillus medium-sized in this invention in RAW 264.7 cells undergoing ferroptosis. Detailed Implementation

[0060] The present invention will be further described below with reference to the accompanying drawings and embodiments.

[0061] 1. Experimental materials: RAW264.7 macrophages

[0062] 2. Reagents and consumables:

[0063] Macroporous adsorption resin NKA-9 (Tianjin Haoju Resin Technology Co., Ltd.), agarose gel (Solog Biotechnology Co., Ltd.), potato dextrose agar-PDA (Huankai Microbial Technology Co., Ltd.), fetal bovine serum (Thermo Fisher Scientific), DMEM high-glucose medium (Pronosei Biotechnology Co., Ltd.), ATP cell viability assay solution (Promag Beijing Biotechnology Co., Ltd.), phosphate-buffered saline (PBS) (Solog Biotechnology Co., Ltd.), CCK-8 reagent, lipopolysaccharide (LPS) (Shanghai Maclean Biotechnology Co., Ltd.), NO reagent kit (Beyotime Biotechnology Co., Ltd.), ELISA kit (Beyotime Biotechnology Co., Ltd.)

[0064] 3. Instruments and equipment:

[0065] Carbon dioxide cell incubator (Thermo Fisher Scientific), vertical pressure steam sterilizer (Shanghai Boxun), large rotary evaporator (EYELA Tokyo, Japan), high-speed refrigerated centrifuge (Beckman & Coulter, USA), vortex mixer (Shanghai Huxi Analytical Instruments), freeze dryer (Thermo Fisher Scientific), BT-100 automatic peristaltic pump collector (Shanghai Huxi Analytical Instruments), vertical protein electrophoresis system (Bio-Rad, USA).

[0066] 4. Testing instruments:

[0067] ① Crude polysaccharide elution curve: Microplate reader (Thermo Varioskan LUX)

[0068] ② Polysaccharide and monosaccharide composition: Ion chromatography (ThermoFisher)

[0069] ③ Polysaccharide molecular weight: High-performance liquid chromatography (Shimadzu)

[0070] ④ Infrared spectroscopy of polysaccharides: Fourier transform infrared (Bruker, Germany)

[0071] ⑤ Ultraviolet absorption spectrum: Shimadzu UV-2550 UV-Vis spectrophotometer

[0072] ⑥ Polysaccharide methylation: Gas chromatography-mass spectrometry (SHIMADZU)

[0073] ⑦ Polysaccharide NMR spectrum: Nuclear magnetic resonance spectrometer (Bruker Biospin AG, Switzerland)

[0074] ⑧ Flow cytometry: Beckman CytoFLEX flow cytometer

[0075] ⑨ Fluorescence spectroscopy: Hitachi FL7000 fluorescence spectrophotometer

[0076] ⑩ Immunoblot: Amersham Imager 600 Ultra-Sensitive Multi-Functional Imaging System

[0077] Example 1 :

[0078] The specific steps for isolating and culturing medium-sized Aspergillus strains are as follows:

[0079] S1. Sample Collection and Processing: Collect 3-5 coral fish from the South China Sea, specifically from Daya Bay, Shenzhen, southern China. Intestinal samples were collected after anesthesia with triazine methanesulfonate (MS222, 100ppm). The samples were rinsed three times with sterile seawater to remove loosely attached microorganisms and intestinal contents. Approximately 100mg of intestinal sample was weighed and thoroughly ground with 1ml of sterile water.

[0080] S2. Sample inoculation: Dilute the crushed sample from step S1 by 10 times, measure 0.1 mL and inoculate it onto a pre-prepared PDA plate (components: 46 g / L potato dextrose agar, 30 g / L sea salt), and set up 3-5 parallel groups.

[0081] S3. Strains Isolation and Culture: Plates were incubated at 26°C for 2 days to observe bacterial morphology. Based on morphological characteristics, fungal growth characteristics, aerial hyphae, substrate hyphae, diffusible pigments, and spores were observed. Single fungal colonies were picked and transferred to PDA plates (composition: 46 g / L potato dextrose agar, 30 g / L sea salt) and incubated at 26°C to obtain fungal strains.

[0082] S4. Strain Identification: The genome of the obtained strain was extracted, and its ITS DNA gene was amplified by PCR. The PCR amplification conditions were: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 60 s, 55℃ annealing for 60 s, 72℃ extension for 90 s; and a final extension at 72℃ for 10 min. Based on the conservation of the ITS DNA gene sequence in microbial species, the ITS DNA gene of the obtained strain was submitted to the NCBI GenBank database to obtain an accession number for identification. The ITS DNA gene sequence of this strain is shown in SEQ ID NO.1 (see the nucleotide sequence listing in the appendix of this invention for details). BLAST comparison analysis of the ITS DNA gene sequence of the obtained strain in the NCBI database revealed that the ITS sequence of the strain obtained in this invention has a 99% similarity to that of Aspergillus medius (KT832076.1). A phylogenetic tree of the obtained strain's ITS DNA sequence was then constructed using MEGA software and the Neighbor-Joining method. The resulting phylogenetic tree is shown below. Figure 1 As shown. By Figure 1It is known that the sequence of this strain clusters with Aspergillus medius in the phylogenetic tree, and the strain isolated and cultured in this invention belongs to the genus Aspergillus medius. In this invention, this strain is named Aspergillus medius SCAU 236, and its ITSDNA gene sequence is as follows:

[0083] GGCCGTCGATGCAGGGTCGGACTCTGGGTCACCTCCCATCCGTGTCTATCTGTACCCTGTTGCTTCGGCG

[0084] TGGCCACGGCCCGCCGAAGACTAACATTTGAACACTGTCTGAAGTTTGCAGTCTGAGTTTTTAGTTAAAC

[0085] AATAATTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAA

[0086] TTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTTGGTATTCCGG

[0087] GGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCTTCCGTCCCTGGTA

[0088] ACGGGGACGGGCCCAAAAGGCAGTGGCGGCACCATGTCTGGTCCTCGAGCGTATGGGGCTTTGTCACCCG

[0089] CTCCCGTAGGTCCAGCTGGCAGCTAGCCTCGCAACCAATCTTTTTAACCAGGTTGACCTCGGATCAGGTA

[0090] GGGATACCCGCTGAACTTAAGCATATCAATAAGGCCGGAGGAA

[0091] Example 2:

[0092] Example 1 of this invention uses the isolated and cultured fungal strain Aspergillus medius SCAU236 to further prepare its extracellular polysaccharide. The preparation method includes the following steps:

[0093] S1. Aspergillus medius SCAU236 strain was inoculated into liquid culture medium (the composition of the liquid culture medium was: maltose 10.0 g / L, glucose 10.0 g / L, mannitol 20.0 g / L, magnesium sulfate heptahydrate 0.5 g / L, potassium dihydrogen phosphate 0.5 g / L, corn steep liquor 1.0 g / L, yeast extract 3.0 g / L and sea salt 30.0 g / L, pH 6.0), and fermented at 26℃ and 140 rpm for 7 days to obtain the fermentation broth;

[0094] S2. Filter the fermentation broth obtained in step S1 through a vacuum filter pump (double-circle qualitative filter paper) to remove the cells and collect the filtrate; use a rotary evaporator to concentrate the filtrate under reduced pressure (65℃, 30rpm) to 1 / 4 of the original volume and collect the concentrate.

[0095] S3. Add 30% and 50% of the concentrated liquid volume of ammonium sulfate and tert-butanol to the concentrate obtained in step S2, respectively. Stir magnetically for 30 min, centrifuge at ultra-high speed (12000 rpm, 10 min, room temperature), and let stand for 30 min to form a three-phase system. The upper phase is the tert-butanol phase, which mainly extracts pigments, lipids, and other substances with low polarity; the middle phase is the protein extraction layer; and the lower phase is the ammonium sulfate phase, which mainly contains water-soluble substances such as polysaccharides. Take the lower ammonium sulfate phase and dialyze it through a dialysis bag with a molecular weight cutoff of 3000 Da until the conductivity of the distilled water remains unchanged. Collect the liquid retained in the dialysis bag, freeze-dry it, and obtain the extracellular crude polysaccharide of the first fungus, Aspergillus medulata.

[0096] S4. The crude extracellular polysaccharide of the first fungus, *Aspergillus medius*, obtained in step S3. was eluted with primary water through a macroporous resin (500 mg / ml, 5 ml sample, elution flow rate 2-3 BV / h). The eluent was collected and freeze-dried to obtain the crude extracellular polysaccharide extract of the second fungus, *Aspergillus medius*. Then, DEAE Fast Flow anion exchange column chromatography was used for pigment adsorption and component separation. The crude extracellular polysaccharide extract of the second fungus, *Aspergillus medius*, was eluted with primary water, 0.1 M NaCl, 0.3 M NaCl, 0.6 M NaCl, 0.9 M NaCl, and 1.2 M NaCl solutions sequentially at a flow rate of 1 ml / min. 30 tubes (10 ml / tube) were collected for each eluent. A polysaccharide elution curve was plotted using the phenol-sulfuric acid method, as shown below. Figure 2 As shown. The eluent obtained from primary water elution was collected and freeze-dried to obtain the extracellular polysaccharide of the fungus Aspergillus medium-sized.

[0097] The extracellular polysaccharide of the fungus medium-sized Aspergillus obtained in Example 2 was analyzed for its composition and structural characteristics. The relative molecular weight, monosaccharide composition, monosaccharide residues, and structural characteristics were determined and analyzed. The specific experimental procedures are as follows:

[0098] 1. Relative molecular weight of polysaccharides

[0099] Experimental methods: The molecular weight (Mw: weight-average molecular weight) and purity of polysaccharides were determined by HPGPC;

[0100] Sample preparation: Prepare a precise 0.05M NaCl solution, filter through a 0.45μm filter membrane, sonicate for 10 min, and store at room temperature for later use. Accurately weigh the extracellular polysaccharide of Aspergillus medium-sized fungus obtained in Example 2 and the standard, prepare a 5 mg / ml solution, centrifuge at 12000 rpm for 10 min, filter the supernatant through a 0.22μm microporous membrane, and then transfer the sample to a 1.8ml vial.

[0101] Chromatographic column analysis conditions: The chromatographic column was a BRT105-104-102 tandem gel column (8×300mm); the mobile phase was 0.05M NaCl solution, the flow rate was controlled at 0.6ml / min, the column temperature was 40℃; the injection volume was 20μl; the detector was a differential detector RI-10A.

[0102] Peak molecular weight Mp: The molecular weight of the highest peak. Mp is also a way of expressing molecular weight distribution and is used to characterize polymers with extremely narrow molecular weight distribution, such as calibration polymer standards.

[0103] Number-average molecular weight (Mn): The number-average molecular weight is the statistical average of the molecular weights of all polymer chains in a sample. Mn can be predicted by the polymerization mechanism and determined by measuring the number of molecules in a given mass of sample, such as colligative methods like end-group analysis. If Mn is used to characterize the molecular weight distribution, then there are equal numbers of molecules distributed on both sides of Mn.

[0104] Weight-average molecular weight (Mv): Weight-average molecular weight is defined relative to Mn. When determining the average molecular weight, the contribution of the single-chain molecular weight to Mw is also considered. The larger the chain mass, the greater its contribution to Mw. Mw is determined by sensitively measuring molecular size, not just its quantity. If Mw is used to characterize molecular weight distribution, then molecules of equal weight are distributed on both sides of Mw.

[0105] Experimental results: Correction curves for lgMp-RT (peak molecular weight), lgMw-RT (weight-average molecular weight), and lgMn-RT (number-average molecular weight) were obtained.

[0106] The equation for the lgMp-RT correction curve is: y = -0.1813x + 11.654R² = 0.9951;

[0107] The equation of the lgMw-RT correction curve is: y = -0.1932x + 12.211R² = 0.9929;

[0108] The equation of the lgMn-RT correction curve is: y = -0.1792x + 11.494R² = 0.9918

[0109] Based on the standard curve, a calculation formula was derived to calculate the molecular weight of each sample. The molecular weight (Mw) of the extracellular polysaccharide from the fungus *Aspergillus medium* was determined by HPGPC to be 9015 Da. The data results are as follows: Figure 3 As shown in Table 1.

[0110] Table 1. Molecular weight data of extracellular polysaccharides from Aspergillus medium-sized.

[0111]

[0112] 2. Monosaccharide composition of polysaccharides

[0113] Experimental methods: The monosaccharide composition of extracellular polysaccharides from the fungus Aspergillus medium-sized was determined by ion spectrometry;

[0114] Preparation and calculation method of standard solutions: Prepare approximately 10 mg / ml standard solutions using 16 monosaccharide standards (fucose, rhamnose, arabinose, galactose, glucose, xylose, mannose, fructose, ribose, galacturonic acid, glucuronic acid, galactosyl hydrochloride, glucosamine hydrochloride, N-acetyl-D-glucosamine, guluronic acid, and mannulic acid). Accurately prepare 5 mg / L standards from each monosaccharide standard solution as the standard. Determine the concentration of different monosaccharides using the single-standard method, and calculate the molar ratio based on the molar mass of the monosaccharides.

[0115] Sample preparation: Accurately weigh 10 mg of the extracellular polysaccharide from the fungus *Aspergillus oryzae* obtained in Example 2 and place it in an ampoule. Add 10 ml of 3M trifluoroacetic acid and hydrolyze at 120 °C for 3 h. Accurately pipette the acid-hydrolyzed solution into a tube and dry it under nitrogen. Add 5 ml of water and vortex to mix. Pipe 100 μL of the solution into 900 μL of deionized water and centrifuge at 12000 rpm for 5 min. Take the supernatant for IC50 analysis.

[0116] Chromatographic conditions: The column was a Dionex Carbopac™ PA20 (3*150), the mobile phase was A: H2O; B: 15mM NaOH; C: 15mM NaOH & 100mM NaOAC, the flow rate was set to 0.3 ml / min, the injection volume was 5 μL, the column temperature was set to 30℃, and the detector was an electrochemical detector.

[0117] Mixed standard solvent peaks: Sodium hydroxide peak at 2.0 min, sodium acetate peak at 41 min;

[0118] Experimental results: Ion chromatography analysis results, such as... Figure 4 As shown in Table 2, a comparison with monosaccharide standards revealed that the fungal Aspergillus medium-sized extracellular polysaccharide in this invention is a macromolecular compound polymerized from glucose (100%) monosaccharide.

[0119] Table 2. Monosaccharide composition of extracellular polysaccharides from medium-sized Aspergillus.

[0120]

[0121] 3. Methylation

[0122] The extracellular polysaccharide of Aspergillus medium-sized fungus obtained in Example 2 was methylated, hydrolyzed, and acetylated, and then measured by GC-MS and compared with a standard mass spectrum library.

[0123] Experimental Method: Weigh 2-3 mg of the extracellular polysaccharide from the fungus *Aspergillus oryzae* obtained in Example 2 and place it in a glass reaction flask. Add 1 mL of anhydrous DMSO, then quickly add methylation reagent A, seal the flask, and dissolve it under sonication. Add methylation reagent B. React in a magnetically stirred water bath at 30°C for 60 min. Finally, add 2 mL of ultrapure water to the mixture to terminate the methylation reaction. Take the methylated polysaccharide, add 1 mL of 2M trifluoroacetic acid (TFA) for hydrolysis for 90 min, and evaporate to dryness using a rotary evaporator. Add 2 mL of double-distilled water and 60 mg of sodium borohydride to the residues for reduction for 8 hours, neutralize with glacial acetic acid, rotary evaporate, dry in a 101°C oven, then add 1 mL of acetic anhydride for acetylation and react at 100°C for 1 h, then cool. Add 3 mL of toluene, concentrate under reduced pressure, and evaporate to dryness. Repeat 4-5 times to remove excess acetic anhydride. Dissolve the acetylated product in 3 mL of CH2Cl2 and transfer to a separatory funnel. Add a small amount of distilled water, shake thoroughly, and remove the supernatant. Repeat this process 4 times. The CH2Cl2 layer was dried with an appropriate amount of anhydrous sodium sulfate, and the volume was adjusted to 10 mL. The solution was then placed in a liquid chromatography vial.

[0124] Analytical instruments: A Shimadzu GCMS-QP 2010 gas chromatograph-mass spectrometer was used to determine the acetylation products in the samples;

[0125] GC-MS conditions: RXI-5SIL MS column 30m*0.25mm*0.25um, temperature program conditions: initial temperature 120℃, increase to 250℃ / min at 3℃ / min, hold for 5min, injection port temperature 250℃, detector temperature 250℃ / min, carrier gas helium, flow rate 1mL / min;

[0126] Experimental results: Results of methylated monosaccharide forms in the extracellular polysaccharides of the fungus Aspergillus medium-sized, such as... Figure 5As shown in Table 3, the sugar residues and their proportions were analyzed by GC-MS after methylation treatment. The results showed that there were four monosaccharide residue linkage modes in the extracellular polysaccharide of Aspergillus mesenteroides: 2,3,4,6-Me4-Glcp, 2,3,6-Me3-Glcp, 2,6-Me2-Glcp, and 2,3-Me2-Glcp, with molar ratios of 10.4, 77.5, 6.1, and 6.0, respectively. Based on this analysis, the main sugar residue linkage mode on the main chain of the extracellular polysaccharide of Aspergillus mesenteroides is glucose (1→4).

[0127] Table 3. Analysis of results of methylated sugar alcohol acetyl ester (PMAA) of the extracellular polysaccharide of medium-sized Aspergillus.

[0128] 17.483 2,3,4,6-Me4-Glcp 43,71,87,101,117,129,145,161,205 10.4 <![CDATA[ Glcp -(1→]]> 22.368 2,3,6-Me3-Glcp 43,87,99,101,113,117,129,131,161,173,233 77.5 <![CDATA[→4)- Glcp -(1→]]> 25.032 2,6-Me2-Glcp 43,87,97,117,159,185 6.1 <![CDATA[→3,4)- Glcp -(1→]]> 27.309 2,3-Me2-Glcp 43,71,85,87,99,101,117,127,150,161,201 6.0 <![CDATA[→4,6)- Glcp -(1→]]>

[0129] 4. Infrared spectroscopy analysis

[0130] The functional groups of the extracellular polysaccharide of Aspergillus fungus in Example 2 were determined by Fourier transform infrared spectroscopy.

[0131] Experimental method: Weigh 1 mg of fully dried Aspergillus medium-sized fungal extracellular polysaccharide, mix and grind it evenly with 100 mg of dried potassium bromide under a heating lamp, place it in a tablet press and press it into a transparent tablet, then place the tablet on a VERTEX 70 infrared spectrometer and collect infrared data in the 4000-400 cm-1 interval;

[0132] Experimental results: Infrared spectral results of extracellular polysaccharides from the fungus Aspergillus medium-sized, such as... Figure 6 As shown in the figure, the infrared spectrum reveals the strongest signal at 3371.36 cm⁻¹, representing the absorption band of the OH stretching vibration. Simultaneously, the carbohydrate-related chemical bond CH (2929.50 cm⁻¹) was also detected. -1 C = O (1643.43cm) -1 ), COC (1415.04cm) -1 1153.77cm -1 ), 1200-1000cm -1 The absorption band indicates that the polysaccharide contains pyranose. In addition, at 930.78 cm⁻¹... -1 and 851.57cm -1 The presence of infrared signals indicates the existence of both β and α configurations in the extracellular polysaccharide of the fungus Aspergillus medium.

[0133] 5. Nuclear Magnetic Resonance Spectrum Analysis

[0134] The structure of the extracellular polysaccharide of the fungus Aspergillus medium-sized in Example 2 was deduced using superconducting nuclear magnetic resonance spectroscopy.

[0135] Experimental Methods: Approximately 40 mg of extracellular polysaccharide sample from the fungus *Aspergillus medium* was weighed, dissolved in 0.55 ml of D2O, and placed in a water bath to ensure complete dissolution. The solution was then centrifuged, and the supernatant was transferred to an NMR tube. One-dimensional NMR analysis was performed on a Bruker 600 MHz NMR spectrometer. 1 H NMR and 13 Determination of C NMR and two-dimensional (COSY, HSQC and HMBC) spectra;

[0136] Experimental results: NMR results of extracellular polysaccharides from the fungus Aspergillus medium-sized, such as... Figure 7 As shown, combining the results of methylation, from one-dimensional spectra ( 1 H and 13 In C), chemical migration signals for terminal hydrogen and terminal carbon belonging to four monosaccharide residues can be found: A (H / C = 5.26 ppm / 91.88 ppm): D-Glcp-(1→, B (H / C = 5.43 ppm / 99.55 ppm): →4)-D-Glcp-(1→, C (H / C = 4.68 ppm / 95.76 ppm): →3,4)-D-Glcp-(1→, D (H / C = 5.00 ppm / 98.57) The chemical migration signals (ppm) were used to determine the configurations of the four monosaccharide residues. Residues greater than or equal to 5 ppm were classified as α-configuration, and those less than 5 ppm as β-configuration. Then, the chemical migration signals of the remaining hydrogen and carbon residues in the four monosaccharide residues were determined using two-dimensional spectroscopy (COSY and HSQC), as shown in Table 5. Finally, the linkage of the four monosaccharide residues was determined using HMBC spectroscopy, yielding the structure of the extracellular polysaccharide from the fungus *Aspergillus oryzae*, as shown in Table 5. Figure 8 As shown.

[0137] Table 5. Chemical shift assignments of extracellular polysaccharide residues in Aspergillus medium-sized fungi.

[0138]

[0139] Example 3:

[0140] To verify the immunomodulatory activity of the fungal medium-sized Aspergillus extracellular polysaccharide prepared in Example 2 of the present invention, the experimental results are as follows:

[0141] S1. Culture of RAW 264.7 macrophage cells

[0142] Experimental Procedure: 10% (v / v) fetal bovine serum and 1% (v / v) penicillin antibiotics were added to DMEM medium to prepare complete culture medium for RAW 264.7 macrophages. After thawing frozen RAW 264.7 macrophages, they were resuspended in complete culture medium, mixed thoroughly, and placed in sterile culture flasks. The flasks were then incubated at 37°C with 5% CO2. Once the cells had adhered and almost completely covered the bottom of the flask, they were passaged or plated for further experiments.

[0143] Experimental procedure:

[0144] ① Thawing: Remove RAW 264.7 cells from the cryovials in liquid nitrogen. Thaw rapidly in a 37°C water bath by shaking. Transfer to a centrifuge tube containing 5 mL of complete culture medium. Mix well by pipetting and centrifuge at low speed (1000g, 3 min). Discard the supernatant. Resuspend the cells in 5 mL of fresh complete culture medium. Transfer the cell suspension to a cell culture flask and incubate overnight at 37°C with 5% CO2. Replace with fresh complete cell culture medium and continue culturing. Passage can be performed when the adherent cell density reaches approximately 80%.

[0145] ② Subculture: Discard the old culture medium, wash twice with PBS buffer, add 5 mL of fresh complete culture medium, pipette the cells off the flask wall, subculture the cell suspension into a new cell culture flask at a certain ratio, and place it in a cell culture incubator for continued culture.

[0146] ③ Cryopreservation: Centrifuge the well-mixed cell suspension at low speed (1000 r / min, 3 min), discard the supernatant, add cell cryopreservation solution, mix well by pipetting, transfer to sterile cryovials, and label with cell name and cryopreservation time. Incubate overnight at -80℃, and finally store in liquid nitrogen.

[0147] S2. Effects of extracellular polysaccharides from the fungus *Aspergillus medium* on RAW264.7 macrophage cells.

[0148] Experimental Content: The effect of Aspergillus medium-sized extracellular polysaccharide on the proliferation of RAW264.7 macrophages was detected using the CCK-8 assay. The effect of Aspergillus medium-sized extracellular polysaccharide on the release of NO and immunomodulatory factors (TNF-α, IL-6) from RAW264.7 macrophages was detected using a kit. Western blot imaging was used to detect the effect of Aspergillus medium-sized extracellular polysaccharide on the release of immunomodulatory proteins (Cox-) from RAW264.7 macrophages.

[0149] 2. The effect of iNOS expression level on the immune regulation activity was used to make a preliminary judgment.

[0150] Experimental procedure:

[0151] ① Effect on RAW264.7 macrophage proliferation: The effect of extracellular polysaccharide from the fungus *Aspergillus medium* on RAW 264.7 cell proliferation was determined using a CCK-8 assay kit. Cells were pipetted from culture flasks with complete culture medium, and the RAW 264.7 cell density was adjusted to 1.0 × 10⁶ cells / year using complete culture medium. 5 After mixing the culture medium at a concentration of 100 μL / mL, add 100 μL to each well of a 96-well plate and incubate for 24 h. After 24 h, discard the supernatant and add 50, 100, and 200 μg / mL of Aspergillus medium-sized fungal extracellular polysaccharide samples. A blank control group was also included, containing cells and complete culture medium, with six replicates per group. After 24 h of incubation, add 10 μL of CCK-8 reagent to each well and incubate in the dark for 2 h. Measure and record the absorbance at 450 nm using a microplate reader.

[0152] ② Effect on NO release from RAW 264.7 cells: The effect of extracellular polysaccharides from the fungus *Aspergillus oryzae* on NO release from RAW 264.7 cells was determined using a NO kit. Cells were pipetted from culture flasks with complete culture medium, and the RAW 264.7 cell density was adjusted to 2.0 × 10⁶ cells / year using complete culture medium. 5 After mixing the sample with the concentration of *Aspergillus oryzae* (50, 100, and 200 μg / mL) of the culture medium, 1 mL of the solution was added to each well of a 12-well plate and incubated for 24 hours. After 24 hours, the supernatant was discarded, and *Aspergillus oryzae* extracellular polysaccharide samples were added at concentrations of 50, 100, and 200 μg / mL. A blank control group and a positive control group were also set up. The blank control group received an equal volume of complete culture medium, while the positive control group received 2.5 μg / mL LPS solution. Each group had four replicates. The plates were then incubated for another 24 hours. The supernatant was collected, and NO release was detected using a NO kit according to the manufacturer's instructions.

[0153] ③ Effect on the release of immune factors from RAW 264.7 cells: The effect of Aspergillus medium-sized extracellular polysaccharide on the release of cytokines from RAW 264.7 cells was determined using an ELISA kit. Cells in culture flasks were pipetted from the flasks with complete culture medium, and the RAW 264.7 cell density was then adjusted to 2.0 × 10⁶ cells / year using complete culture medium. 5 After mixing the sample with the culture medium, add 1 mL of the culture medium to each well of a 12-well plate and incubate for 24 h. After 24 h, discard the supernatant and add 50, 100, and 200 μg / mL of Aspergillus medium-sized fungal extracellular polysaccharide samples, respectively. A blank control group was also set up. After incubation for 24 h, collect the supernatant and detect the secretion of the corresponding immune factors using TNF-α and IL-6 kits, respectively.

[0154] ④ Effect on protein expression in RAW 264.7 cells: The effect of Aspergillus medium-sized exopolysaccharide on protein expression in RAW 264.7 cells was detected by Western blotting. Cells in culture flasks were pipetted off with complete culture medium, and the RAW 264.7 cell density was adjusted to 2.0 × 10⁶ cells / year using complete culture medium. 5 Cells were cultured at a concentration of 100 μg / mL and mixed thoroughly. 2 mL of the mixture was added to each well of a 6-well plate and incubated for 24 h. After 24 h, the supernatant was discarded, and 50, 100, and 200 μg / mL of Aspergillus medium-sized fungal extracellular polysaccharide were added to each sample. A blank control group was also included, with four replicates per group. Cells were incubated for another 24 h, the supernatant was discarded, and cells were washed with PBS. 60 μL of RIPA lysis buffer (containing PMSF) was added to each well and lysed on ice for 15 min. Cells were gently scraped off with a cell scraper and collected into 1.5 mL centrifuge tubes. The cells were centrifuged at 12000 rpm at 4°C for 10 min, and the supernatant was collected. Loading buffer was added and the cells were subjected to protein denaturation in a boiling water bath. Gel electrophoresis was performed at 120 V for 45 min, followed by transfer using a PVDF membrane at 165 mA for 80 min, and blocking with 5% BSA for 1 h. Primary antibodies (GAPDH, cox-2, iNOS) were incubated at room temperature for 1.5 h, followed by TBST washing three times for 5 min each time. Secondary antibodies were incubated at room temperature for 1 h, followed by TBST washing three times for 10 min each time. A luminescent solution was then added to the PVDF membrane, and the membrane was developed using a gel imaging system.

[0155] Experimental results:

[0156] ① This invention uses the CCK-8 assay to detect the effect of Aspergillus medium-sized extracellular polysaccharides on macrophage proliferation. The results are as follows: Figure 9 As shown, at concentration gradients of 50 μg / mL, 100 μg / mL, and 200 μg / mL, the extracellular polysaccharide from *Aspergillus medium* promoted the proliferation of RAW 264.7 macrophages in a gradient-dependent manner. The cell count increased by more than 150% after the addition of *Aspergillus medium* extracellular polysaccharide, indicating that the extracellular polysaccharide from *Aspergillus medium* did not have cytotoxicity against RAW 264.7 macrophages within the specified concentration range.

[0157] ② This invention uses a NO reagent kit to detect the effect of Aspergillus medium-sized extracellular polysaccharide on NO release from RAW 264.7 cells, thereby determining the stimulatory effect of Aspergillus medium-sized extracellular polysaccharide on macrophages. The results are as follows: Figure 10As shown, compared with the blank control group, all treatment groups treated with extracellular polysaccharides from the fungus *Aspergillus medium* at concentration gradients of 50-200 μg / mL significantly promoted NO release (p<0.01). The dose-dependent effect on the promoting effect was observed, but the NO release was still less than that in the positive control LPS treatment group, indicating pro-inflammatory activity. The promoting effect on NO release suggests that the extracellular polysaccharides from *Aspergillus medium* have a strong immunostimulatory effect on RAW 264.7 macrophages.

[0158] ③ This invention used an ELISA kit to detect the effect of Aspergillus medium-sized extracellular polysaccharide on the release of immune factors from RAW 264.7 cells, indicating that Aspergillus medium-sized extracellular polysaccharide evokes an immune response. The results are as follows: Figure 11 As shown, compared with the blank control group, the secretion of cellular immune factors (TNF-α, IL-6) was upregulated by treatment with Aspergillus medium-sized fungal extracellular polysaccharide at doses of 50, 100, and 200 μg / mL. These results indicate that Aspergillus medium-sized fungal extracellular polysaccharide can promote the release of immune-related factors from RAW 264.7 macrophages, suggesting that Aspergillus medium-sized fungal extracellular polysaccharide can elicit an immune response.

[0159] ④ This invention uses Western blotting to verify the effect of extracellular polysaccharide from the fungus *Aspergillus medium* on the expression of immune-related proteins in RAW264.7 cells, indicating that the extracellular polysaccharide from *Aspergillus medium* is involved in an immune response. The results are as follows: Figure 12 As shown, compared with the blank control group, the expression of cell-related immune proteins (cox-2, iNOS) increased in a dose-dependent manner after treatment with Aspergillus medusae extracellular polysaccharide at doses of 50, 100, and 200 μg / mL. These results indicate that Aspergillus medusae extracellular polysaccharide can upregulate the expression of immune-related proteins in RAW 264.7 macrophages, suggesting that Aspergillus medusae extracellular polysaccharide has significant immunomodulatory activity.

[0160] Example 4:

[0161] To verify the immune activity mediated by the extracellular polysaccharide of Aspergillus medium-sized fungus of the present invention, based on the immune activity measured in Example 3, ferroptosis-related indicators were detected to reflect the experimental results.

[0162] S1. Effects of extracellular polysaccharides from the fungus *Aspergillus medium* on RAW264.7 macrophage cells.

[0163] Experimental content: The effect of extracellular polysaccharide from Aspergillus medium-sized fungus on the expression levels of immunomodulatory proteins (cox-2, iNOS) in RAW264.7 macrophages was detected by Western blotting imaging. The effect of extracellular polysaccharide from Aspergillus medium-sized fungus on the lipid peroxidation level of RAW264.7 macrophages was detected by flow cytometry to further determine its immunomodulatory activity through the mediation of ferroptosis mechanism.

[0164] Experimental procedure:

[0165] ① Effect on protein expression in RAW 264.7 cells: The effect of Aspergillus medium-sized exopolysaccharide on protein expression in RAW 264.7 cells was detected by Western blotting. Cells in culture flasks were pipetted off with complete culture medium, and the RAW 264.7 cell density was adjusted to 2.0 × 10⁶ cells / year using complete culture medium. 5 Cells were cultured at a concentration of 200 μg / mL and mixed thoroughly. 2 mL of the mixture was added to each well of a 6-well plate, and the plates were incubated for 24 h. After 24 h, the supernatant was discarded. Two groups were treated with 200 μg / mL of Aspergillus medium-sized exopolysaccharide, with one group receiving 1 μM of the ferroptosis inhibitor Fer-1. A blank control group was also included, containing an equal volume of complete culture medium. Each group had four replicates. Cells were incubated for another 24 h. The supernatant was discarded, and cells were washed with PBS. 60 μL of RIPA lysis buffer (containing PMSF) was added to each well, and cells were lysed on ice for 15 min. Cells were gently scraped off with a cell scraper and collected into 1.5 mL centrifuge tubes. Centrifugation was performed at 12000 rpm at 4°C for 10 min. The supernatant was collected, and loading buffer was added for protein denaturation in a boiling water bath. Gel electrophoresis was performed at 120 V for 45 min, followed by transfer using a PVDF membrane at 165 mA for 80 min, and blocking with 5% BSA for 1 h. Primary antibodies (GAPDH, cox-2, iNOS) were incubated at room temperature for 1.5 h, followed by TBST washing three times for 5 min each time. Secondary antibodies were incubated at room temperature for 1 h, followed by TBST washing three times for 10 min each time. A luminescent solution was then added to the PVDF membrane, and the membrane was developed using a gel imaging system.

[0166] ② Flow cytometry was used to detect cellular lipid peroxidation levels and to verify the correlation between the immunoreactivity of exopolysaccharides from the fungus *Aspergillus oryzae* and ferroptosis. Cells in the culture flasks were pipetted from the flasks with complete culture medium, and the RAW 264.7 cell density was adjusted to 2.0 × 10⁻⁶ cells using complete culture medium. 5Cells / mL were mixed and added to each well of a 12-well plate, and incubated for 24 h. After 24 h, the supernatant was discarded, and extracellular polysaccharides of Aspergillus medium-sized fungi were added at concentrations of 50, 100, 200 μg / mL and 200 μg / mL, respectively. One group with 200 μg / mL was supplemented with 1 μM ferroptosis inhibitor Fer-1. A blank control group was also set up, with an equal volume of complete culture medium added. Each group was divided into three replicates, and the plates were incubated for another 24 h. After 24 h, the supernatant was discarded, and 10 μM C11 BODIPY 581 / 591 lipid peroxidation fluorescent probe was added and incubated for 1 h. The cells were washed three times with PBS, and 50 μL of trypsin was added to each well to digest the cells. After complete digestion, 1 mL of PBS containing 5% FBS was added, and the cells were collected into centrifuge tubes for flow cytometry analysis.

[0167] Experimental results:

[0168] ① This invention uses Western blotting to verify the effect of extracellular polysaccharide from the fungus *Aspergillus medium* on the expression of immune-related proteins in RAW264.7 cells, indicating that the extracellular polysaccharide from *Aspergillus medium* is involved in an immune response and may be related to ferroptosis. The results are as follows: Figure 13 As shown, the addition of the ferroptosis inhibitor Fer-1 (1 μM) significantly downregulated the upregulation of immune proteins (cox-2, iNOS) induced by treatment with Aspergillus medulata extracellular polysaccharide at a dose of 200 μg / mL. These results indicate that Aspergillus medulata extracellular polysaccharide can upregulate the expression of immune-related proteins in RAW 264.7 macrophages, and this upregulation can be inhibited by the ferroptosis inhibitor, suggesting that Aspergillus medulata extracellular polysaccharide may induce an immune response by mediating ferroptosis.

[0169] ② This invention uses flow cytometry to verify the effect of extracellular polysaccharides from the fungus *Aspergillus medium* on lipid peroxidation levels in RAW264.7 cells, thereby inducing ferroptosis. The results are as follows: Figure 14 As shown, compared with the blank control, the degree of cellular lipid peroxidation was dose-dependently upregulated by treatment with *Aspergillus medius* extracellular polysaccharide at doses of 50, 100, and 200 μg / mL. However, the addition of the ferroptosis inhibitor Fer-1 (1 μM) significantly downregulated lipid peroxidation induced by *Aspergillus medius* extracellular polysaccharide treatment at a dose of 200 μg / mL. These results indicate that *Aspergillus medius* extracellular polysaccharide promotes lipid peroxidation in RAW264.7 cells, inducing ferroptosis and thereby modulating their immune activity.

[0170] The above are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above content. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. Extracellular polysaccharide of the fungus Aspergillus medium-sized, characterized in that: The structural formula of the extracellular polysaccharide fermented by the fungus Aspergillus medium-sized is: 。 2. The fungal aspergillus extracellular polysaccharide according to claim 1, characterized in that: The extracellular polysaccharide of the fungus Aspergillus medium has a weight-average molecular weight of 9015 Da, and its monosaccharide composition is 100% glucose by molar percentage.

3. The fungal aspergillus extracellular polysaccharide according to claim 1 or 2, characterized in that: The extracellular polysaccharide fermented by Aspergillus medius was obtained by inoculating Aspergillus medius strain SCAU236 into a culture medium and fermenting it, and then isolating it from the fermentation broth. The fungal strain Aspergillus medius SCAU236 is deposited at the Guangdong Provincial Center for Microbial Culture Collection, with accession number GDMCC 63136 and deposit date of January 13, 2023.

4. The method for preparing extracellular polysaccharides from the fungus *Aspergillus oryzae* according to claim 1, 2, or 3, characterized in that: Includes the following steps: (1) The fungus Aspergillus medius SCAU236 was isolated from the intestines of coral fish in the South China Sea. (2) The above-mentioned Aspergillus medius SCAU236 strain was subjected to liquid fermentation, and the fermentation broth was collected; (3) The polysaccharides in the above fermentation broth were separated to obtain crude extracellular polysaccharides of the fungus Aspergillus medium-sized; (4) The above-mentioned extracellular crude polysaccharide of Aspergillus medium-sized fungus was subjected to DEAE Fast Flow anion exchange column chromatography, the elution peak was collected, and the mixture was freeze-dried to obtain the extracellular polysaccharide of Aspergillus medium-sized fungus. The liquid culture medium for liquid fermentation in step (2) includes: 10.0 g / L maltose, 10.0 g / L glucose, 20.0 g / L mannitol, 0.5 g / L magnesium sulfate heptahydrate, 0.5 g / L potassium dihydrogen phosphate, 1.0 g / L corn steep liquor, 3.0 g / L yeast extract, 30.0 g / L sea salt, and 0.5 g / L L-cysteine, with water as the solvent; In step (3), the method for separating polysaccharides from the fermentation broth includes the following steps: 1) Remove the bacterial cells from the fermentation broth, concentrate it, and obtain a concentrated solution; 2) Use a mixture of ammonium sulfate and tert-butanol to remove proteins and impurities from the above concentrate, and collect the ammonium sulfate phase; 3) Dialyze the above ammonium sulfate phase using a dialysis bag with a molecular weight cutoff of 3000 Da, collect the liquid trapped in the dialysis bag, freeze-dry it, and obtain the crude extracellular polysaccharide of the first fungus, Aspergillus medium-sized. 4) The crude extracellular polysaccharide of the first fungus, Aspergillus medium-sized, was eluted with macroporous resin. The eluent was primary water. The elution peak was collected and freeze-dried to obtain the crude extracellular polysaccharide of the second fungus, Aspergillus medium-sized. In step 4), the crude extracellular polysaccharide of the second fungus Aspergillus medium-sized is chromatographically analyzed by DEAE Fast Flow anion exchange column chromatography, with the eluent being water and NaCl solution in sequence. The eluent obtained by elution with water is collected and freeze-dried to obtain the extracellular polysaccharide of Aspergillus medium-sized fungus.

5. The method for preparing extracellular polysaccharide from the fungus Aspergillus medium-sized according to claim 4, characterized in that: To remove the bacterial cells from the fermentation broth, a vacuum filter pump is used to remove the bacterial cells, the filtrate is collected, and the filtrate is concentrated under reduced pressure using a rotary evaporator at 60-70°C to obtain a concentrated solution. The volume ratio of the ammonium sulfate and tert-butanol mixture to the concentrate is (2-4):(4-6):(8-10). The mixture is magnetically stirred for 40-50 min, centrifuged at ultra-high speed (8000-12000 rpm, 10 min, room temperature), and allowed to stand for 20-40 min to form a three-phase mixture. The ammonium sulfate phase is then collected.

6. The method for preparing extracellular polysaccharide from the fungus Aspergillus medium-sized according to claim 4, characterized in that: In step (2), the Aspergillus medius SCAU236 strain of fungus is activated in PDA medium before liquid fermentation.

7. The use of the fungal Aspergillus medium-sized extracellular polysaccharide as described in claim 1, 2 or 3 in the preparation of immunomodulatory agents.