Microbial marker for acute pancreatitis and use thereof

CN118166131BActive Publication Date: 2026-09-11ZHEJIANG UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202410363559.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-03-28
Publication Date
2026-09-11
Estimated Expiration
2044-03-28

AI Technical Summary

Technical Problem

然而,这些方法存在局限性,尤其是在早期诊断方面存在不及时、不准确的情况,甚至在某些情况下可能导致误诊

Benefits of technology

[0020] This invention proposes *Prevotella* as a microbial biomarker for acute pancreatitis for the first time. Experimental results showed that the abundance of *Prevotella* in the intestines of mice with early-stage acute pancreatitis was significantly reduced compared to the healthy group (P<0.05). As the course of acute pancreatitis progressed, the abundance of *Prevotella* showed a significant negative correlation with the severity of acute pancreatitis in mice. These findings provide a theoretical basis for better prevention and treatment of acute pancreatitis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118166131B_ABST
    Figure CN118166131B_ABST
Patent Text Reader

Abstract

The present application belongs to the field of biomedicine, and particularly relates to a microbial marker for diagnosing and treating acute pancreatitis and application thereof. The present application provides a microbial marker for acute pancreatitis, which is Prevotella tricolor. The present application also simultaneously provides application of the Prevotella tricolor in preparation of a diagnostic reagent for acute pancreatitis. The present application first proposes the Prevotella tricolor as a microbial marker for acute pancreatitis. Experimental results show that the abundance of the Prevotella tricolor in the intestines of mice in the early stage of acute pancreatitis is significantly reduced compared with the healthy group. With the progression of the course of acute pancreatitis, the abundance of the Prevotella tricolor is significantly negatively correlated with the severity of acute pancreatitis in mice. The research results provide a theoretical basis for better prevention and treatment of acute pancreatitis.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedicine, and specifically relates to a microbial marker for the diagnosis and treatment of acute pancreatitis and its application. Background Technology

[0002] Acute pancreatitis is a serious inflammatory disease, usually caused by increased activity of pancreatic enzymes within the pancreas. Typical symptoms include severe upper abdominal pain, vomiting, nausea, and diarrhea; in severe cases, it can lead to multiple organ dysfunction syndrome and death. Early diagnosis of acute pancreatitis greatly aids in disease control, but it remains a challenging issue. Currently, the diagnosis of acute pancreatitis relies primarily on clinical symptoms, imaging studies, and biochemical indicators such as serum amylase levels. However, these methods have limitations, particularly in early diagnosis, where delays and inaccuracies are common, and misdiagnosis can occur in some cases. Therefore, a more accurate and reliable method for early diagnosis of acute pancreatitis is urgently needed to enable timely treatment and reduce the severity of the disease and patient suffering.

[0003] Microbial biomarkers have been widely used in the early diagnosis of many diseases. Studies have shown that alterations in the microbial community are closely related to the occurrence and development of certain diseases. Therefore, identifying microbial biomarkers associated with acute pancreatitis and using them for the early diagnosis and treatment of this disease has significant clinical implications.

[0004] Prevotella is a common pathogen that has received widespread attention in recent years. Its known uses mainly include the following:

[0005] 1. Pathogenicity: Prevotella is an important pathogen that can cause a variety of infections in immunocompromised humans and animals, including respiratory infections, urinary tract infections, and wound infections.

[0006] 2. Biodegradation: Some strains of Prevotella bacteria have biodegradation capabilities and can decompose various organic compounds, including petroleum hydrocarbons and polycyclic aromatic hydrocarbons. Therefore, they have potential application value in fields such as bioremediation and wastewater treatment.

[0007] 3. Production of biological surfactants: Prevotella bacteria can produce a variety of surfactants, such as bio-glue and pyranose glucan, which have emulsifying, emulsion stabilizing and surface-active properties, and therefore have certain application potential in industrial production.

[0008] 4. Genetic engineering vectors: Prevotella bacteria are widely used in genetic engineering research as vectors for the expression and production of exogenous genes due to their relatively simple genome and ease of manipulation. Summary of the Invention

[0009] The problem to be solved by the present invention is to provide a microbial marker for acute pancreatitis and its application.

[0010] To address the aforementioned technical problems, this invention provides a microbial marker for acute pancreatitis: Prevotella.

[0011] As an improvement to the microbial markers for acute pancreatitis of the present invention: the abundance of Prevotella bacteria in the feces of patients with acute pancreatitis is significantly reduced compared to healthy individuals.

[0012] This invention also provides the application of Prevotella in the preparation of diagnostic reagents for acute pancreatitis.

[0013] An improvement to the application of Prevotella in the preparation of diagnostic reagents for acute pancreatitis, as described in this invention: for early screening or prediction of acute pancreatitis.

[0014] Specifically:

[0015] This invention provides microbial markers for acute pancreatitis, including Prevotella bacteria with significantly reduced microbial abundance.

[0016] The present invention also provides a reagent for detecting the above-mentioned microbial markers of acute pancreatitis.

[0017] The aforementioned microbial markers or reagents for acute pancreatitis are used for constructing risk models of acute pancreatitis, preparing diagnostic reagents for acute pancreatitis, or preparing diagnostic kits for acute pancreatitis. The aforementioned kits contain the aforementioned reagents.

[0018] The present invention also provides a method for applying the above-mentioned acute pancreatitis microbial markers to prepare tools for early screening or prediction of acute pancreatitis.

[0019] Furthermore, the present invention provides a method for applying the above-mentioned acute pancreatitis microbial markers to prepare a kit for early screening of acute pancreatitis, the kit comprising detection reagents for the above-mentioned acute pancreatitis microbial markers.

[0020] This invention proposes *Prevotella* as a microbial biomarker for acute pancreatitis for the first time. Experimental results showed that the abundance of *Prevotella* in the intestines of mice with early-stage acute pancreatitis was significantly reduced compared to the healthy group (P<0.05). As the course of acute pancreatitis progressed, the abundance of *Prevotella* showed a significant negative correlation with the severity of acute pancreatitis in mice. These findings provide a theoretical basis for better prevention and treatment of acute pancreatitis.

[0021] In summary, this invention aims to provide a microbial biomarker and its application (a microbial biomarker for acute pancreatitis and its application) to improve the early diagnosis and treatment of acute pancreatitis. The application of these technologies is expected to provide the medical community with more accurate, sensitive, and reliable methods for earlier diagnosis of acute pancreatitis and timely treatment. That is, the method of this invention can improve the accuracy of early diagnosis of acute pancreatitis, thereby improving treatment outcomes. Attached Figure Description

[0022] The specific embodiments of the present invention will be further described in detail below with reference to the accompanying drawings.

[0023] Figure 1 A- Figure 1 E shows the changes in Prevotella abundance in a mouse model of acute pancreatitis induced by seven consecutive intraperitoneal injections of basilin. Among them, Figure 1 A presents a schematic diagram of a mouse model of acute pancreatitis induced by seven consecutive intraperitoneal injections of taurine. Figure 1 B shows a schematic diagram comparing HE staining of pancreatic tissue sections from PBS control (Ctrl) mice and acute pancreatitis (AP) mice collected after modeling. Figure 1 C and Figure 1 D corresponds to the comparison chart of serum amylase level and serum lipase level in mice. Figure 1 E shows a comparison of the abundance of Prevotella bacteria in mouse feces.

[0024] Figure 2 A- Figure 2 B shows the differential analysis of fecal microbiota in a mouse model of acute pancreatitis induced by taeniacin. Figure 2 A presents the fecal microbiota differences at the genus level between PBS control (Ctrl) mice and mice with acute pancreatitis (AP) induced by seven consecutive injections of taeniacin, as shown by LDAse analysis. Figure 2 B corresponds to a statistical comparison chart of fecal microorganisms at the genus level, where the dashed box indicates the most significant differences in Prevotella bacteria.

[0025] Figure 3 A- Figure 3 C shows the changes in Prevotella abundance in a mouse model of acute pancreatitis induced by intraperitoneal injection of 7 doses of basilol daily for 3 consecutive days. Figure 3 A shows a schematic diagram of a mouse model of acute pancreatitis induced by taurine for three consecutive days. Figure 3 B shows a schematic diagram comparing HE staining of pancreatic tissue sections from PBS control (Ctrl) mice and acute pancreatitis (3x cerulein) mice collected after modeling. Figure 3 C presents a statistical comparison of the abundance of Prevotella bacteria in mouse feces at different time points.

[0026] Figure 4 A- Figure 4 D shows the changes in Prevotella abundance in a mouse model of acute pancreatitis induced by pancreatic duct ligation. Figure 4 A shows bright-field images of the mouse abdomen dissected at different time points after pancreatic duct ligation modeling. Figure 4 B and Figure 4 C represents a comparison of serum lipase and serum amylase levels in mice at different time points after modeling. Figure 4 D shows the statistical comparison of Prevotella abundance in mouse feces at different time points after catheter ligation.

[0027] Figure 5 A- Figure 5 F presents the results of gavage administration of Prevotella bacteria in improving acute pancreatitis in mice. Figure 5 A shows a schematic diagram of administering Prevotella bacteria via gavage to wild-type mice after antibiotic treatment. Figure 5 B and Figure 5 C represents the comparison of serum amylase and serum lipase levels in antibiotic-treated (ABX) mice and antibiotic-treated mice administered Prevotella via gavage (ABX+Prevo), respectively. Figure 5 D shows the expression level of the inflammatory factor IL-1β in mouse pancreatic tissue. Figure 5 E and Figure 5 F corresponds to the expression levels of the inflammatory factors TNF-α and IL-6, respectively. Detailed Implementation

[0028] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto:

[0029] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0030] Unless otherwise specified, the experimental materials used in the following examples are commercially available, for example:

[0031] Experimental strains: The fecal Prevotella (number: BNCC337399) used in this example was purchased from BeiNa Biotechnology Co., Ltd.; the C57 / BL6 mice used were purchased from Shanghai Slack Biotechnology Co., Ltd.; the 16S rDNA sequencing of mouse feces was performed by Novogene Co., Ltd.

[0032] Method 1. Induction of acute pancreatitis in mice by consecutive intraperitoneal injection of 7 doses of basilin: Basilin powder (Sigma; 17650-98-5) was weighed and dissolved in PBS buffer (pH 7.2-7.4) to a concentration of 10 μg / ml. Mice weighing 20-30g were fasted and then randomly assigned to groups according to the experimental design. Each mouse received 7 intraperitoneal injections of basilin, with each injection spaced 1 hour apart, at a dose of 1 μg / g of mouse body weight. After injection, the mice's behavior and appetite were closely observed. Serum and tissue samples were collected 12 hours after the first injection for subsequent analysis of biochemical indicators such as amylase and lipase.

[0033] Method 2. Induction of an acute pancreatitis model in mice by intraperitoneal injection of 7 doses of baicalein daily for 3 consecutive days: Baicalein was dissolved in PBS buffer (pH 7.2-7.4) and diluted to a concentration of 5 μg / ml. Mice were fasted for 16 hours and then randomly assigned to groups according to the experimental design. Subsequently, mice were intraperitoneally injected with 7 doses of baicalein daily for 3 consecutive days, with each injection spaced 1 hour apart. The dose per injection was 0.5 μg / g of mouse body weight. After injection, the behavior and appetite of the mice were closely observed, and serum and tissue samples were collected at 24, 48, and 72 hours after the first injection for subsequent biochemical analysis.

[0034] Method 3. Pancreatic duct ligation-induced acute pancreatitis model in mice: First, prepare the necessary instruments and anesthetic drugs before surgery. Then, randomly divide the mice into experimental and sham-operated groups, and anesthetize them with appropriate anesthetic drugs. The experimental group will undergo pancreatic duct ligation surgery, specifically involving locating and exposing the pancreas through an abdominal incision, followed by ligation of the pancreatic duct to ensure a secure and accurate ligation. The sham-operated group will undergo a similar procedure but without ligation. Postoperatively, mice require good care, and their behavior and appetite should be closely monitored. Serum and tissue samples will be collected at 4, 24, and 48 hours after ligation for subsequent biochemical analysis. All procedures must be performed under strict aseptic conditions and in accordance with relevant ethical guidelines to ensure the accuracy of the experiment and protect the welfare and rights of the experimental animals.

[0035] Method 4. Extraction of fecal microbiota DNA and 16S rDNA sequencing from mice: Sample processing is required first. When collecting fecal samples from laboratory mice, aseptic conditions must be ensured to avoid exogenous contamination. Subsequently, total DNA is extracted from the fecal samples using a commercially available fecal DNA extraction kit, ensuring purity and integrity during the extraction process. The extracted fecal microbiota DNA is then sent to a company for subsequent streamlined library construction and high-throughput sequencing, followed by standardized bioinformatics analysis of the data.

[0036] Method 5. Abundance determination of Prevotella in mouse feces: Total DNA was extracted from mouse feces and amplified by real-time polymerase chain reaction PCR using Prevotella-specific primer pairs. The obtained data were then analyzed.

[0037] The Prevotella-specific primers are: forward primer: CCAGCCAAGTAGCGTGCA; reverse primer: TGGACCTTCCGTATTACC; the universal bacterial primers are: forward primer: ACTCCTACGGGAGGCAGCAGT; reverse primer: ATTACCGCGGCTGCTGGC

[0038] The amplification system consisted of: 0.6 μL forward primer, 0.6 μL reverse primer, 10 μL 2×SuperReal PreMix Plus, 2 μL DNA template, 2 μL 50×Reference Dye, and distilled water to a final volume of 20 μL.

[0039] The amplification program was: 95℃ for 15 min, followed by 40 cycles of (95℃ for 10 s, 55℃ for 30 s, 72℃ for 32 s). STBR Green was used as the fluorescent label, and PCR reactions were performed on a Roche quantitative PCR instrument (LightCycler 480II). Melting curves were analyzed according to standard 2... -△△CT The method is used for relative quantification.

[0040] Method 6. Measurement of serum lipase and amylase levels:

[0041] Blood was collected from the orbital cavity of mice using anticoagulated blood collection tubes. The cells were centrifuged at 5000 rpm for 3 minutes, and the supernatant was collected. Serum amylase levels were measured using a mouse serum amylase kit (Quark Biotech) and serum lipase levels were measured using a mouse lipase kit (Quark Biotech).

[0042] Method 7. Antibiotic treatment in mice: Mice were administered a mixture of antibiotics orally by gavage daily for 5 consecutive days. These antibiotics included ampicillin 33.2 mg / kg / day, neomycin 33.2 mg / kg / day, metronidazole 33.2 mg / kg / day, and vancomycin 16.7 mg / kg / day. Mice had free access to water throughout the experiment.

[0043] Method 8. Gavage administration of Prevotella to mice:

[0044] Prevotella bacteria were cultured in an incubator at 37°C for 24-48 hours until a sufficient bacterial suspension was obtained. Then, under aseptic conditions, the cultured Prevotella bacteria suspension was diluted to 10^8-10^9 CFU / ml. Using a gavage syringe, 200 μL of the bacterial suspension was slowly and evenly administered into the stomach of mice. After gavage, the mice were held upright for a few seconds to prevent backflow of the bacterial suspension. Mice were administered Prevotella bacteria via gavage for two consecutive days using the above procedure.

[0045] The specific experimental results and analyses corresponding to the experiments conducted using the above method are as follows:

[0046] Example 1: Changes in Prevotella abundance in a mouse model of acute pancreatitis induced by 7 injections of basil.

[0047] 1. Establishment of acute pancreatitis model in mice (following method one above): Eight-week-old wild-type C57 / BL6 mice were intraperitoneally injected with bacitracin for seven consecutive times, with an interval of one hour between each injection. The control group was injected with PBS. Figure 1 A).

[0048] Twelve hours after the start of injection, pancreatic tissue was collected for HE staining, mouse blood samples were collected to detect lipase and amylase levels (according to method six above), and mouse feces were collected to detect Prevotella abundance (according to method five above). Results are as follows... Figure 1 As shown in B-1D, compared to the PBS-injected control mice, the pancreatic tissue of the mice injected with bacitracin showed more severe edema and greater immune cell infiltration in HE staining. Figure 1 B). Meanwhile, the serum amylase level in the *Lymphadenum globulin* group mice ( Figure 1 C) and serum lipase levels ( Figure 1 D) was higher, and the abundance of Prevotella in feces was also higher ( Figure 1 D).

[0049] 2. Sequencing of gut microbiota in mice with acute pancreatitis (following method four above). Collect mouse feces from step 1 above and perform 16S rDNA sequencing of the fecal microbiota using the aforementioned method. Results are as follows... Figure 2 As shown in A-2B, in mice with acute pancreatitis, bacteria with decreased abundance included Clostridium, Brontë, and Peptococcus; bacteria with increased abundance included Prevotella, Akkermansia, and Lactobacillus. Figure 2 A). Among them, the most significant changes were observed in Prevotella ( Figure 2 B) indicates that taurine-induced acute pancreatitis in mice can significantly upregulate the abundance of Prevotella bacteria in feces.

[0050] Example 2: Changes in Prevotella abundance in a mouse model of acute pancreatitis induced by intraperitoneal injection of 7 doses of basilol daily for 3 consecutive days.

[0051] Following method two above, 8-week-old wild-type C57 / BL6 mice were intraperitoneally injected with bacitracin seven times daily, with one-hour intervals between injections, for three consecutive days; the control group was injected with PBS (…). Figure 3 A).

[0052] Pancreatic tissue was then collected for HE staining, and mouse feces were collected to detect the abundance of Prevotella bacteria. Results are as follows: Figure 3 As shown in B-3C, compared to the control group mice, the pancreatic tissue inflammation was more severe in the taurine group mice. Figure 3 B). Meanwhile, the abundance of Prevotella bacteria in the feces of mice in the *Phyllostachys* group was significantly higher at 24, 48, and 72 hours after modeling. Figure 3 C) indicates that the abundance of Prevotella bacteria in the feces of mice with acute pancreatitis induced by taurine was significantly increased over three consecutive days.

[0053] Example 3: Changes in Prevotella abundance in a mouse model of acute pancreatitis induced by pancreatic duct ligation

[0054] To further verify the changes in Prevotella abundance in the acute pancreas, another acute pancreatitis model, namely the pancreatic duct ligation model (following method three above), was used. Under aseptic conditions, the pancreatic region was exposed, and the pancreatic duct was ligated through an abdominal incision. After ensuring complete and accurate ligation, the incision was sutured. Blood and fecal samples were collected from mice at 0, 4, 24, and 48 hours post-ligation for further analysis. Figure 4 A). The result is as follows Figure 4 As shown in B-4D, 4 hours after catheter ligation, the serum lipase level in mice was... Figure 4 B) and serum amylase levels ( Figure 4 C) significantly increased, indicating acute pancreatitis in mice. Simultaneously, the abundance of Prevotella bacteria in the feces of mice after duct ligation was significantly higher. Figure 4 D).

[0055] Example 4: Effects of oral administration of Prevotella bacteria on acute pancreatitis in mice

[0056] The above experiments show that the abundance of Prevotella bacteria in feces is significantly increased in different mouse models of acute pancreatitis.

[0057] Next, this invention investigated the therapeutic effect of *Prevotella* on acute pancreatitis. First, mice were administered a combination antibiotic via gavage for 5 days to eliminate intestinal flora (according to method seven above). Then, mice were administered commercially available *Prevotella* and *Parostella sulcata* (a control group, both being Gram-negative anaerobic bacteria like *Prevotella*) via gavage for 2 days, while the control group was administered PBS via gavage (according to method eight above). Finally, an acute pancreatitis model was established by intraperitoneal injection of spirulinaxin (according to method one above). Figure 5 A).

[0058] The results are as follows Figure 5 As shown in B-5F, compared to the PBS gavage group, the serum amylase level in the Prevotella treatment group was significantly lower. Figure 5 B) and serum lipase levels ( Figure 5 C) was significantly reduced, and at the same time, IL-1β in pancreatic tissue was significantly reduced. Figure 5 D), TNF-α Figure 5 E), IL-6 Figure 5 The expression levels of inflammatory factors such as F were also significantly reduced, indicating that gavage administration of Prevotella bacteria can significantly alleviate the symptoms of acute pancreatitis in mice.

[0059] It should also be noted that, in the detection of the above indicators, there were no significant changes in the parasitoid bacteria treatment group mice compared to the PBS gavage group mice.

[0060] Finally, it should be noted that the above examples are merely some specific embodiments of the present invention. Obviously, the present invention is not limited to the above embodiments and many variations are possible. All variations that can be directly derived or conceived by those skilled in the art from the disclosure of the present invention should be considered within the scope of protection of the present invention.

Claims

1. The use of Prevotella in the preparation of drugs for treating acute pancreatitis, characterized in that: The Prevostii bacterium is numbered BNCC337399.