Rice cadmium transporter encoding gene osmot2;2 and application thereof
Patent Information
- Application Number
- CN202410327653.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-03-21
- Publication Date
- 2026-09-08
- Estimated Expiration
- 2044-03-21
AI Technical Summary
[0004]本发明的目的是解决目前水稻生产中存在的上述稻米镉污染问题,提供水稻镉转运蛋白编码基因OsMOT2;2的应用
[0012] 1. Through systematic research, this invention provides for the first time a biological function of the cadmium transport protein encoding gene OsMOT2;2 in cadmium transport.
Smart Images

Figure CN118185988B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant genetic engineering technology, and relates to the rice cadmium transporter encoding gene OsMOT2;2 and its applications. Background Technology
[0002] Cadmium (Cd) is a highly biotoxic heavy metal. Cadmium in the soil is easily absorbed by crops and accumulates in large quantities in their bodies. This not only directly affects the normal growth and development of crops, leading to a significant decline in yield and quality (Ali et al., 2019; Imran et al., 2021), but cadmium accumulated in edible parts can also enter the human body through the food chain and gradually accumulate in the body, causing various diseases such as kidney failure and osteoporosis (Chen et al., 2020; Wang et al., 2021). For example, the "Itai-itai disease" that occurred in the Jinzu River basin of Toyama Prefecture, Japan in the last century was caused by the long-term consumption of cadmium-contaminated rice by local residents.
[0003] Rice is one of the world's three major staple crops, with about half of the global population relying on it as their primary food source. It not only provides the human body with ample carbohydrates but is also an important source of minerals. Analyzing the genetic mechanisms of cadmium absorption and transport in rice, identifying beneficial gene resources, and using molecular breeding techniques and genetic engineering to cultivate new rice varieties with low cadmium accumulation plays a crucial role in reducing cadmium intake and protecting human health. Summary of the Invention
[0004] The purpose of this invention is to address the aforementioned cadmium pollution problem in rice production by providing an application for the rice cadmium transporter encoding gene OsMOT2;2. The OsMOT2;2 gene has the accession number AB807476 in GenBank.
[0005] The first objective of this invention is to provide the application of knocking out the rice cadmium transporter encoding gene OsMOT2;2 in reducing the cadmium content of rice grains, the genomic nucleotide sequence of which is shown in SEQ ID NO.1.
[0006] Furthermore, the CDS sequence of the rice cadmium transporter encoding gene OsMOT2;2 is shown in SEQ ID NO.2.
[0007] The second objective of this invention is to provide a knockout vector for reducing cadmium content in rice grains, wherein the knockout vector is a recombinant expression vector containing the target sequence of the aforementioned rice cadmium transporter encoding gene OsMOT2;2.
[0008] Furthermore, the knockout vector is obtained by inserting the target sequence of the cadmium transporter gene OsMOT2;2, as shown in gcctagttgcgatcatcgct (SEQ ID NO.3), between the BsaI-BsaI restriction sites of the base vector, based on the pYLCRISPR / Cas9Pubi-H vector.
[0009] A third objective of this invention is to provide the application of the aforementioned knockout vector in reducing cadmium content in rice grains.
[0010] Furthermore, the application involves introducing the aforementioned knockout vector into rice to obtain rice lacking the cadmium transporter gene OsMOT2;2, thereby reducing the cadmium content in rice grains.
[0011] Beneficial effects of the present invention
[0012] 1. Through systematic research, this invention provides for the first time a biological function of the cadmium transport protein encoding gene OsMOT2;2 in cadmium transport.
[0013] 2. Heterologous expression of the cadmium transporter gene OsMOT2 in yeast significantly increased the cadmium content in yeast cells and the sensitivity of yeast to cadmium stress, indicating that the gene has cadmium transport activity.
[0014] 3. Knocking out the cadmium transporter gene OsMOT2;2 significantly reduced the cadmium content in rice grains.
[0015] 4. Knockout material for the cadmium transporter gene OsMOT2;2 was constructed.
[0016] The application of the cadmium transporter encoding gene OsMOT2;2 provided by this invention can effectively reduce the cadmium content of rice grains. Attached Figure Description
[0017] Figure 1 Heterologous expression of the cadmium transporter gene OsMOT2 in yeast increased the intracellular cadmium content and enhanced the yeast's sensitivity to cadmium stress.
[0018] A: In a medium containing 20 μM cadmium chloride, the cadmium content in yeast cells cultured for 4 hours was significantly higher in those transformed with OsMOT2;2 than in those transformed with the empty vector. Ev represents the yeast strain transformed with the empty vector pYES2.0, and OsMOT2;2 represents the yeast strain transformed with the recombinant vector pYES2.0-OsMOT2;2.
[0019] B: In solid culture medium containing 30 μM cadmium chloride, yeast cells transformed with OsMOT2;2 were more sensitive to cadmium stress than yeast cells transformed with the empty vector. Ev represents yeast strains transformed with the empty vector pYES2.0, and OsMOT2;2 represents yeast strains transformed with the recombinant vector pYES2.0-OsMOT2;2.
[0020] C: In liquid medium containing 20 μM cadmium chloride, yeast cells transformed with OsMOT2;2 were more sensitive to cadmium stress than yeast cells transformed with the empty vector. Ev represents yeast strains transformed with the empty vector pYES2.0, and OsMOT2;2 represents yeast strains transformed with the recombinant vector pYES2.0-OsMOT2;2.
[0021] Figure 2 Knocking out the cadmium transporter gene OsMOT2;2 reduced the cadmium content in rice grains by 41.8% compared to the wild type. WT represents the wild type, and osmot2;2 is a knockout mutant of OsMOT2;2. Detailed Implementation
[0022] The present invention will be further explained below with reference to the embodiments, but the embodiments do not limit the present invention in any way.
[0023] Example 1
[0024] The heterologous expression of the cadmium transporter gene OsMOT2 in yeast was carried out as follows:
[0025] 1) Using the cDNA library of the japonica rice variety Zhonghua 11 (ZH11) as a template, the full-length coding region sequence (CDS sequence) of OsMOT2;2 was amplified by PCR. The full-length CDS sequence of OsMOT2;2 is shown in SEQ ID NO.2. Then, the amplified full-length CDS sequence of OsMOT2;2 was ligated between the EcoRI-XhoI restriction sites of the pYES2.0 vector to construct the recombinant vector pYES2.0-OsMOT2;2 driven by the inducible promoter GAL1.
[0026] The amplification primers are as follows:
[0027] OsMOT2;2-F:5'-cagtgtgctggaattcatggaggtgttctactacctcgt-3'(SEQ IDNO.4);
[0028] OsMOT2;2-R:5'-tagatgcatgctcgagctatgggtttaacggctcatcttcc-3' (SEQ ID NO. 5).
[0029] 2) The recombinant vector and empty vector were transformed into *Saccharomyces cerevisiae* 31019b, respectively. Single clones were selected and incubated overnight at 30°C and 200 rpm in 2 mL of SD / -U liquid medium. Then, 1 mL of the bacterial culture was transferred to 50 mL of cadmium-free SD / -U liquid medium (using galactose as the carbon source) and cultured at 30°C and 200 rpm until the logarithmic growth phase. At this point, cadmium chloride solution was added to the bacterial culture to bring the cadmium concentration to 20 μM. The culture was continued for 4 hours, and then the culture was quickly transferred to 50 mL centrifuge tubes. The yeast cells were collected by centrifugation at 4°C and 4000 rpm, washed three times with pre-cooled EDTA-Na2 solution, and finally washed once with pre-cooled ultrapure water. The bacterial blocks were dried and weighed. After digestion of the samples using a graphite furnace, the cadmium content of the two groups of samples was determined by ICP-MS. Figure 1 A).
[0030] 3) The recombinant vector and empty vector were transformed into *Saccharomyces cerevisiae* Δycf1, respectively. Single clones were selected and cultured in 2 mL of SD / -U liquid medium at 30°C and 200 rpm until the logarithmic growth phase. The cells were enriched in 2 mL centrifuge tubes at 3000 rpm, and sterilized ddH2O was added to adjust the bacterial concentration so that the OD600nm of all strains was 1. Using a 96-well PCR plate, the cells were serially diluted 10-fold at 10-fold ratios to a final concentration. -4 Then, using a multi-pipette, 4 μL of the bacterial suspension was sequentially spotted onto SD / -U solid culture medium containing different concentrations of cadmium (0 μM, 30 μM) and different carbon sources. The culture medium was then incubated at 30°C for 4 days before photographing. Figure 1 B).
[0031] 4) Yeast clones transformed with the recombinant vector and empty vector in step 3) were added to 2 mL of SD / -U liquid medium and cultured at 30℃ and 200 rpm until the logarithmic growth phase. The OD600 nm of the two yeast strains was then measured. The culture was transferred to 50 mL of SD / -U liquid medium (with or without 20 μM cadmium, using galactose as the carbon source) to make the initial OD600 nm of both strains 0.02, and cultured continuously at 30℃ and 200 rpm, with three biological replicates for each strain. The OD600 nm of each strain was measured at 12 h, 24 h, 28 h, 32 h, 36 h, 40 h, 44 h, 48 h, 54 h, and 60 h after inoculation. Figure 1 C).
[0032] The results showed that heterologous expression of the cadmium transporter gene OsMOT2;2 in yeast significantly increased intracellular cadmium levels and increased sensitivity to cadmium stress. This example demonstrates that the cadmium transporter OsMOT2;2 possesses cadmium transport activity. Figure 1).
[0033] Example 2
[0034] The preparation of the OsMOT2;2 mutant, which encodes the rice cadmium transporter gene, is carried out as follows:
[0035] 1) The cadmium transporter gene OsMOT2;2 was knocked out using CRISPR / Cas9 gene editing technology. The sequence gcctagttgcgatcatcgct (SEQ ID NO.3) in the CDS region of OsMOT2;2 was selected as the editing target T1, and primers for the knockout vector were designed and constructed.
[0036] The primer sequences are as follows:
[0037] gRT1:5'-cctagttgcgatcatcgctgttttagagctagaaat-3' (SEQ ID NO.6);
[0038] OsU6aT1: 5'-agcgatgatcgcaactaggcggcagccaagccagca-3' (SEQ ID NO. 7).
[0039] 2) Using plasmid pYLsgRNA-OsU6a as a template, the sgRNA expression cassette fragment containing the target T1 was amplified by PCR.
[0040] The amplification system consisted of: 10 μL Mix buffer; 2 μL plasmid; 1 μL each of primers; and 6 μL ddH2O.
[0041] The amplification program is as follows: (1) 95℃, 3min; (2) 95℃, 15s; (3) 58℃, 15s; (4) 72℃, 20s; (5) 72℃, 5min; (6) 12℃, 2min; Steps (2)-(4) are repeated for 35 cycles.
[0042] 3) Using the sgRNA expression cassette fragment from 2) as a template, the complete sgRNA expression cassette OsU6a-T1-sgRNA was further amplified.
[0043] The amplification system consisted of: 10 μL Mix buffer; 2 μL expression cassette fragment; 1 μL each of primers; and 6 μL ddH2O.
[0044] The amplification program is as follows: (1) 95℃, 3min; (2) 95℃, 15s; (3) 58℃, 15s; (4) 72℃, 20s; (5) 72℃, 5min; (6) 12℃, 2min; Steps (2)-(4) are repeated for 35 cycles.
[0045] 4) Assemble the sgRNA expression cassette OsU6a-T1-sgRNA into the pYLCRISPR / Cas9 knockout vector. Specifically, insert the sgRNA expression cassette OsU6a-T1-sgRNA between the BsaI-BsaI restriction sites of the basic vector pYLCRISPR / Cas9Pubi-H to obtain the pYLCRISPR / Cas9 plasmid.
[0046] 5) Transform the verified pYLCRISPR / Cas9 plasmid into rice. The specific transgenic process is as follows: (1) Transform the pYLCRISPR / Cas9 plasmid into Agrobacterium (strain GV3101); (2) Use the seeds of the japonica rice variety ZH11 as material, remove the husk, disinfect and place them on the induction medium to induce callus tissue; (3) Infect the callus tissue with Agrobacterium bacterial solution, wash with sterilized ddH2O and place it on the selection medium to screen out resistant callus tissue; (4) Transfer the resistant callus tissue to the differentiation medium and the rooting medium in turn, and obtain transgenic T0 generation plants after induction differentiation and rooting.
[0047] 6) Plant T0 generation plants in the field to identify whether the coding region of the cadmium transporter gene OsMOT2;2 has mutated. Select homozygous mutant plants and harvest T1 generation seeds.
[0048] The identification primers are:
[0049] CRISPROs2; 2-F:5'-tcccttgattatctgttga-3' (SEQ ID NO.8);
[0050] CRISPROs2;2-R:5'-ttatgccctttgctatggt-3' (SEQ ID NO.9);
[0051] Upon testing, a knockout mutant of the cadmium transporter gene OsMOT2;2 was obtained in this embodiment.
[0052] Example 3
[0053] The pot experiment on cadmium-contaminated soil using the osmot2 mutant of the cadmium transporter gene OsMOT2;2 was conducted as follows:
[0054] 1) After germinating the seeds of wild-type WT and osmot2;2 at 37℃ for 2 days, sow them on a plastic black net suspended in tap water. After one week, transfer the seedlings to 1 / 2 Kimura B nutrient solution and continue to cultivate for two weeks, changing the nutrient solution every three days during this period.
[0055] 2) Transplant wild-type WT and osmot2;2 seedlings into 170L plastic boxes containing 20kg of soil with a cadmium content of 1.459mg / kg. Plant 10 wild-type WT seedlings and 14 osmot2;2 seedlings. Water and fertilizer management and pest and disease control are the same as in ordinary field.
[0056] 3) Harvest the grains of wild-type WT and osmot2 during the rice's maturity period;
[0057] 3) Dry the sample and weigh it. After digesting the sample in a graphite furnace, determine the cadmium content of the grains using ICP-MS.
[0058] This example demonstrates that mutations in the cadmium transporter gene OsMOT2;2 significantly reduce the cadmium content in rice grains. Figure 2 ).
[0059] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. Knockout of the gene encoding the cadmium transporter in rice OsMOT2;2 Its application in reducing cadmium content in rice grains is characterized by, The rice cadmium transporter protein encoding gene OsMOT2;2 The genomic nucleotide sequence is shown in SEQ ID NO.1, or the gene encoding the rice cadmium transporter. OsMOT2;2 The CDS sequence is shown in SEQ ID NO.
2.
2. Knockout of the gene encoding the cadmium transporter in rice OsMOT2;2 The application of the knockout vector in reducing cadmium content in rice grains is characterized by, The knockout vector contains the rice cadmium transporter encoding gene as described in claim 1. OsMOT2;2 The target sequence.
3. The application according to claim 2, characterized in that, Rice cadmium transporter protein encoding gene OsMOT2;2 The target sequence is shown in SEQ ID NO.
3.
4. The application according to claim 2, characterized in that, The knockout vector is based on the pYLCRISPR / Cas9Pubi-H vector, and contains the gene encoding the cadmium transporter protein shown in SEQ ID NO.
3. OsMOT2;2 The target sequence is inserted into the basic vector. Bsa I- Bsa Obtained between I restriction sites.
5. The application according to claim 2, characterized in that, The knockout vector was introduced into rice to obtain the gene encoding the knockout cadmium transporter protein. OsMOT2;2 This reduces the cadmium content in rice grains.