A molecular marker related to feed conversion ratio in sheep and use thereof

CN118222722BActive Publication Date: 2026-08-07LANZHOU UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
LANZHOU UNIV
Filing Date
2024-03-25
Publication Date
2026-08-07

AI Technical Summary

Technical Problem

目前,大多数指标是根据动物表型进行分析,从基因层面上对绵羊饲料转化率进行的系统分析还很少

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118222722B_ABST
    Figure CN118222722B_ABST
Patent Text Reader

Abstract

The application provides a molecular marker related to feed conversion rate of sheep and application thereof, the molecular marker is a nucleotide sequence on a FABP4 gene, as shown in SEQ ID NO.1, R at the 90th position represents G or A, due to the fact that the above sequence has a G / A mutation at the 90th base, thereby causing G / A polymorphism of the sheep FABP4 gene at the site. The molecular marker of the application can be used for selecting breeding of new varieties of grain-saving high-quality mutton sheep, and provides a genetic engineering means for genetic improvement of the feed conversion rate of sheep, and has great practical application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of sheep molecular marker screening and preparation technology, specifically involving the FABP4 gene as a molecular marker related to sheep feed conversion rate and its application. Background Technology

[0002] With the continuous improvement of living standards, people's demand for meat products is increasing. As one of the main types of meat consumed, improving the economic efficiency of mutton has become a top priority. In sheep production, feed costs account for a large proportion, so improving feed conversion ratio is of significant research importance. This research focuses on genetically modifying feed inputs and improving feed utilization rates in livestock and poultry, without affecting normal animal growth. Animal feed utilization rate refers to the efficiency of its use of ingested feed, mainly affected by both the feed diet and the animal's own characteristics. Feed efficiency (FE) is short for feed conversion ratio (FCR), also known as feed return. Generally, feed conversion ratio refers to the amount of feed consumed to gain 1 kg of body weight, i.e., the feed intake / gain (F / G) ratio, and has long been an important economic indicator used to measure the level of feed utilization. In addition, the gain / feed intake ratio (G / F) is an indicator that represents the relationship between weight gain and daily feed intake in livestock and poultry (Lancaster PA, Carstens GE, Jr CD, et al. Phenotypic and genetic relationships of residual feed intake with performance and ultrasound carcass traits in Brangus heifers. Journal of Animal Science, 2009, 87(12):3887-3896). Feed conversion ratio is widely used at home and abroad. In meat production, the feed-to-meat ratio is used, while in poultry egg production, the feed-to-egg ratio is used. To improve feed conversion ratio, we need to focus on two aspects: increasing the weight gain or meat and egg production of livestock and poultry and reducing feed consumption (Aggrey S E, Karnuah AB, Sebastian B, et al. Genetic properties of feed efficiency parameters in meat-type chickens. Genetics Selection Evolution, 2010, 42(1):1-5. Aggrey S E, Rekaya R. Dissection of Koch's residual feed intake: implications for selection. Poultry Science, 2013, 92(92):2600-2605).Studies have shown that the heritability of feed conversion ratio is 0.26–0.41, which is a moderately heritable trait. It is genetically controlled and can be improved through selection (Willems OW, Miller SP, Wood B J. Assessment of residual bodyweight gain and residual intake and body weight gain as feed efficiency traits in the turkey (Meleagris gallopavo). Genetics Selection Evolution, 2013, 45(1):1-8). Based on scientific data, selective breeding and genetic improvement of sheep flocks (Mo Futao. Study on production performance, body composition and digestive metabolism of fattening lambs with different RFI. Gansu Agricultural University, 2016) is one of the feasible methods. However, how to determine the scientific basis is one of the problems we need to solve. At present, most indicators are analyzed based on animal phenotypes, and there are very few systematic analyses of sheep feed conversion ratio at the genetic level.

[0003] Fatty acid binding protein 4 (FABP4) belongs to the fatty acid binding protein family (FABPs). FABPs can bind long-chain fatty acids and other biologically active ligands to promote their intracellular localization (McKillop IH, Girardi CA, Thompson KJ. Role of fatty acid binding proteins (FABPs) in cancer development and progression[J]. Cellular Signalling, 2019, 62:109336. doi:10.1016 / j.cellsig.2019.06.001.), and can also affect intracellular lipid flux, metabolism, and signal transduction (Amiri M, Yousefnia S, Seyed Forootan F, Peymani M, Ghaedi K, Nasr Esfahani MH. Diverse roles of fatty acid binding proteins (FABPs) in development and pathogenesis of Cancers[J].Gene, 2018, 676:171-183.doi:10.1016 / j.gene.2018.07.035.). Among them, FABP4 is often used as a marker gene for adipocyte differentiation and maturation. It plays a role in maintaining adipocyte homeostasis and regulating lipolysis and synthesis through interaction with hormone-sensitive triglyceride lipase (HSL) and peroxisome proliferator-activated receptor γ (PPARγ) (Prentice KJ, Saksi J, Hotamisligil GS. Adipokine FABP4 integrates energy stores and counterregulatory metabolic responses[J]. Journal of Lipid Research, 2019, 60(4):734-740.doi:10.1194 / jlr.S091793.).The FABP4 gene has been studied primarily for its fat deposition properties, with limited research on its feed conversion ratio trait and its relationship with sheep feed conversion ratio. This invention, through sequencing and analysis of the FABP4 gene, explores the correlation between its different genotypes and sheep feed conversion ratio, aiming to provide a reference for sheep breeding and offer genetic engineering methods for cultivating superior sheep breeds. Summary of the Invention

[0004] The purpose of this invention is to provide a molecular marker related to sheep feed conversion ratio and its application. The molecular marker of this invention is amplified from the sheep FABP4 gene. By amplifying and sequencing the DNA sequence of the sheep FABP4 gene, polymorphic sites in the FABP4 gene are screened. The specific nucleotide sequence is shown in SEQ ID NO.1. Furthermore, a detection method for the molecular marker related to sheep feed conversion ratio is established, and this molecular marker can be applied to the breeding of new feed-saving, high-quality meat sheep breeds.

[0005] To achieve the above objectives, the present invention adopts the following technical solution:

[0006] A molecular marker associated with sheep feed conversion ratio, the nucleotide sequence of which is shown in SEQ ID NO.1, wherein the R at position 90 represents G or A, and the G / A mutation at position 90 of the above sequence leads to the G / A polymorphism of the sheep FABP4 gene at this site.

[0007] Primer pairs for detecting molecular markers related to sheep feed conversion ratio as described above. Any primer that can specifically amplify the molecular markers of the present invention or fragments containing the above-mentioned polymorphic sites is suitable for detecting the molecular markers. Preferably, the nucleotide sequences of the primer pairs are as shown in SEQ ID NO.2 and SEQ ID NO.3.

[0008] More preferably, the KASPar primer pair for detecting molecular markers related to sheep feed conversion ratio as described above includes a forward primer A1 for detecting AlleleA, a forward primer A2 for detecting AlleleG, and a universal reverse primer C, wherein the nucleotide sequence of the forward primer A1 is shown in SEQ ID NO.4, the nucleotide sequence of the forward primer A2 is shown in SEQ ID NO.5, and the nucleotide sequence of the universal reverse primer C is shown in SEQ ID NO.6.

[0009] A kit for detecting molecular markers associated with sheep feed conversion ratio as described above, comprising primer pairs or KASPar primer pairs as described above.

[0010] A method for detecting molecular markers associated with sheep feed conversion ratio as described above, comprising detecting the sheep FABP4 gene using primer pairs or kits as described above, and the specific detection method includes the following steps:

[0011] S1. Amplify sheep genomic DNA using the primer pairs described above, KASPar primer pairs, or a kit containing the primer pairs described above;

[0012] S2. Identify the polymorphic sites in the amplification products obtained in step S1.

[0013] Furthermore, sheep genomic DNA is DNA extracted from sheep blood, and identification methods include direct sequencing, probe method, gene chip method, and high-resolution melting curve method.

[0014] As described above, in step S1, when the primer pair shown in SEQ ID NO.2 and SEQ ID NO.3 is used, PCR amplification is performed, and the obtained amplification product is directly sequenced to obtain the genotype of the molecular marker.

[0015] As described above, in step S1, when the primer pair used is the KASPar primer pair, specifically the nucleotide sequences shown in SEQ ID NO. 4, SEQ ID NO. 5, and SEQ ID NO. 6, high-throughput water bath PCR amplification is performed. After amplification, the fluorescence signal is detected using a BMG PHERAstar instrument, and the genotyping results are viewed. Correlation analysis was performed between the genotyping results and traits related to sheep feed efficiency. It was found that when the genotype is GG, the sheep corresponding to it have a lower feed conversion ratio, indicating that under the same feeding conditions, the feed cost of sheep with this genotype is lower than that of other genotypes, which can improve breeding efficiency to a certain extent.

[0016] The application of molecular markers related to sheep feed conversion ratio as described above in breeding is to screen sheep with low feed conversion ratio values ​​for the breeding of new feed-saving and high-quality meat sheep breeds. When the genotype of the polymorphic site of the molecular marker is GG, its feed conversion ratio value is low and it can be used to breed feed-saving and high-quality meat sheep breeds.

[0017] The beneficial effects of this invention are as follows:

[0018] The molecular marker provided by this invention is related to sheep feed conversion rate. The molecular marker is the 90th base of the fragment shown in SEQ ID NO.1 in the sheep FABP4 gene, which has G / A polymorphism. When the genotype at this site is GG, it has a lower feed conversion rate value. On the one hand, it saves production costs and improves the economic benefits of sheep farming; on the other hand, it can effectively save feed and make farming more environmentally friendly and low-carbon. Attached Figure Description

[0019] Figure 1 This is a gel electrophoresis image of the sheep FABP4 gene fragment used as a molecular marker in this invention; wherein, lane M: DL 3000 Marker, lanes 1-10: FABP4 gene amplification results.

[0020] Figure 2 The sequencing results are for the FABP4 gene mutation site in sheep in this invention.

[0021] Figure 3 The results of KASPar SNP typing of the g.90G>A mutation site in the sheep FABP4 gene in this invention are shown. The green dot near the left represents the GG genotype, the red dot near the middle represents the GA or AG genotype, and the blue dot near the right represents the AA genotype. Detailed Implementation

[0022] The following embodiments are used to further illustrate the present invention, but should not be construed as limiting the present invention. Any modifications or substitutions made to the present invention without departing from its spirit and essence are within the scope of the present invention.

[0023] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. Unless otherwise specified, all reagents used in the embodiments of the present invention are of analytical grade or higher.

[0024] Example 1: Amplification of the FABP4 gene

[0025] (1) Primer design

[0026] Using sheep FABP4 gene DNA (GenBank accession number: NC_056062.1) as a template, a pair of primers, MF and MR, were designed using Oligo 7.0 software. The primer sequences are as follows.

[0027] FABP4:

[0028] MF (SEQ ID NO.2): 5'-TGATAACTTGGAAATAAGCCTA-3', MR (SEQ ID NO.3): 5'-TCTCTCCCCAATTTGCAAC-3'

[0029] (2) Amplification and sequencing of the FABP4 gene

[0030] Blood samples were collected from the necks of 180-day-old sheep and frozen at -20°C. DNA was then extracted from the blood using a kit and used as a template for PCR amplification. The total PCR reaction volume was 35 μL, including 17.5 μL of 2×PCR Master Mix, primers diluted to 10 μmol / L, 1.1 μL of upstream primer MF, 1.1 μL of downstream primer MR, 1.3 μL of DNA template, and 14 μL of ddH2O. The PCR amplification program was: 94°C pre-denaturation for 3 min, 94°C denaturation for 30 s, 52.0°C annealing for 30 s, 72°C extension for 60 s, for 35 cycles, followed by a final extension at 72°C for 10 min. The PCR products were detected by 1% agarose gel electrophoresis, and the results are shown below. Figure 1 The results showed a specific amplified fragment. The amplified PCR stock solution was sent to the company for testing, and the sequencing result was 419 bp, with a bimodal pattern at the 90 bp site shown in the graph. Figure 2 As shown in SEQ ID NO.1, the specific nucleotide sequence of the amplified fragment contains a polymorphic site R at position 90 bp, indicating that the amplified FABP4 gene fragment exhibits G / A polymorphism at position 90 bp.

[0031] SEQ ID NO.1: TGATAACTTGGAAATAAGCCTATATTATTCCCTAGCATGTG ATAATTTCTGTTTGAAACTGAAAGCACTGTATTTATCATCTTAATGTRATTTTTGAGTAATGTATGTTAACCAATTATGTTATTGTTTTAAAGTCAGTCTGTTAAAATGTGTGGTTGTATTATAGAAGGAAAAATTCTGATTTCTGAAAATGTTTTCCTTAAAAGTCTTAGATATTTGTTTGACTTAC TATTACAAGGCATGACACAGAATTATTGATAATAGAGGCTTTCAGGTTTTGGGGATTCTGCTAAGATCACCTGTGTGTTTCCCCAGATAATTACAAAGGTAAAGCAAAGGAGCAGAGAGGCGGCAATTCAGTCAGGCAGCCACACCCATGCATGATGAAGATGCATCCACGGGTTGCAAATTGGGGAGAGA

[0032] (3) DNA sequence homology retrieval and identification:

[0033] The DNA sequence obtained after sequencing was compared with known physiologically functional genes published in the GenBank database using the BLAST (Basic Local Alignment Search Tool) software on the website of the National Center for Biotechnology Information (NCBI, http: / / www.ncbi.nlm.nih.gov) to identify and obtain functional information of the DNA sequence. The search results showed that the sequence obtained had 100% homology with a partial sequence of the sheep FABP4 gene DNA (GenBank accession number: NC_056062.1).

[0034] Example 2: Establishment of a genotyping detection method

[0035] (1) Primer sequence design

[0036] KASPar primer pairs were designed for the G / A polymorphic site of the amplified fragment shown in SEQ ID NO.1 in Example 1, for the specific detection of this polymorphic site. The nucleotide sequence of the KASPar primer pairs is as follows:

[0037] Forward primer A1 (SEQ ID NO.4) used to detect AlleleA:

[0038] 5′-GAAGGTGACCAAGTTCATGCTAAAGCACTGTATTTATCATCT TAATGTG-3′;

[0039] Forward primer A2 (SEQ ID NO.5) used to detect AlleleG:

[0040] 5′-GAAGGTCGGAGTCAACGGATTGAAAGCACTGTATTTATCATCTTAATGTA-3′;

[0041] Universal reverse primer C (SEQ ID NO.6): 5'-CAATAACATAATTGGTTAA CATACATTACTC-3'.

[0042] The above primers were synthesized by Beijing Sangon Biotech Co., Ltd. Each primer in the KASPar primer pair was diluted to 10 μmol / L and mixed with the general reverse primer C in a volume ratio of 12:12:30.

[0043] (2) DNA quality control

[0044] Five ml of blood was collected from the neck of sheep and frozen at -20°C. DNA was extracted from the blood using a kit. The quality of the extracted genomic DNA was then assessed by 1% agarose gel electrophoresis and Nanodrop 2100, respectively. The extracted DNA was required to meet the following conditions: no obvious diffusion (i.e., a single DNA band on agarose gel electrophoresis); no protein contamination (A260 / 280 ratio between 1.8 and 2.0 as detected by Nanodrop 2100); low salt ion concentration (A260 / 230 ratio between 1.8 and 2.0); and no phenol contamination (i.e., no significant light absorption at 270 nm). Based on the KASP detection technology from LGC (UK) and the conversion of genome size, the required DNA volume was calculated to be 10–20 ng / sample, and the DNA concentration was diluted to 10–20 ng / μL for later use.

[0045] (3) Genotyping

[0046] First, using a K-pette dispensing workstation, 1.5 μL of diluted DNA template (10–20 ng / μL) and a blank control (No template control, NTC, i.e., sterile water) were added to separate wells of a 384-well reaction plate. The plates were then dried at 60°C for 30 min (using an LGC drying oven) until the DNA became a dry powder. Next, using a Meridian dispensing workstation under the Kraken operating system, 1×Master mix (part no. KBS-1016-011 for 1536-well microplates) and primer mixture were added to each well. Immediately after mixing, the microplates were sealed using a Kube heat sealer and a Fusion laser sealer. High-throughput water bath PCR amplification was then performed using a Hydrocycler. The PCR reaction was conducted in the Hydrocycler high-throughput water bath system, with the following procedure:

[0047] Pre-denaturation at 94℃ for 15 minutes;

[0048] 94℃, 20 seconds (denaturation) — 61℃-55℃, 1 minute (annealing & extension), amplify in touch-down order for 10 cycles, decreasing the temperature by 0.6℃ per cycle;

[0049] 94℃, 20 seconds (denaturation) — 55℃, 60 seconds, continue amplification for 26 cycles.

[0050] After amplification, fluorescence signals were detected and genotyping was performed using a BMG PHERAstar instrument. Specific results are as follows: Figure 3As shown in the figure, each dot represents a sample to be tested. The green dot near the left indicates a homozygous genotype "GG"; the blue dot near the right indicates a homozygous genotype "AA"; the red dot near the center indicates a heterozygous genotype "GA" or "AG"; and the black dot represents NTC (Necrozygous genotype). Figure 3 (Not shown in the image), which is the sterilized water control.

[0051] (4) Application of the molecular markers of the present invention in the association analysis of marker traits of sheep feed conversion rate

[0052] The experiment examined the polymorphism of 898 Hu sheep to determine their genotypes. The feed conversion rate was calculated using the formula (feed conversion rate = amount of feed consumed / increase in live weight), and a least squares model was established as described below to conduct a correlation analysis between genotype and feed conversion rate.

[0053] Y ijkl =μ+Genotype i +P j +F k +M l +ε ijkl

[0054] Among them, Y ijkl Here are the observed trait values, μ is the population mean, and Genotype. i For genotype effect, P j Due to the batch effect, F k Due to the paternal effect, M l Maternal effect, ε ijkl Assuming random error, let ε ijlmk They are mutually independent and follow N(0, σ). 2 Distribution. Genotyping results showed that among 898 individuals, there were 227 individuals with the GG genotype, 449 individuals with the GA genotype, and 222 individuals with the AA genotype. The results are shown in Table 1.

[0055] Table 1. Association analysis between FABP4 gene polymorphism and feed conversion ratio in sheep.

[0056]

[0057] Note: Different superscript letters in the same row indicate significant differences (p<0.05), while the same superscript letter indicates no significant differences (p>0.05).

[0058] The results of genotype-trait association analysis showed that the FABP4 g.90G>A mutation site was significantly correlated with feed conversion ratio (FCR) in Hu sheep (p<0.05). Specifically, the FCR of individuals with the GG genotype was 6.317±0.057, significantly lower than that of individuals with the GA genotype (FCR=6.469±0.040) and AA genotype (FCR=6.493±0.057) (p<0.05). Individuals with the AA genotype consumed 0.024 kg more feed per kg of weight gain than those with the GA and GG genotypes, respectively. In conclusion, the GG genotype sheep have a lower FCR and can be selected for breeding feed-saving sheep. Artificial insemination using semen from GG genotype rams can greatly improve breeding efficiency, resulting in a superior flock of feed-saving sheep, which is of great significance for improving the economic benefits of sheep farming.

Claims

1. The application of primer pairs for detecting molecular markers related to feed conversion ratio in Hu sheep breeding, characterized in that, The nucleotide sequences of the primer pairs are shown in SEQ ID NO.2 and SEQ ID NO.3; the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, where R at position 90 represents G or A. Because there is a G / A mutation at position 90 of the above sequence, the FABP4 gene of Hu sheep has a G / A polymorphism at this site; the feed conversion ratio of sheep carrying the GG genotype is significantly lower than that of sheep carrying the GA and AA genotypes.

2. The application of KASPar primer pairs for detecting molecular markers related to feed conversion ratio in Hu sheep breeding, characterized in that, The nucleotide sequences of the KASPar primer pair are shown in SEQ ID NO.4, SEQ ID NO.5, and SEQ ID NO.6; the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, where R at position 90 represents G or A. Due to a G / A mutation at position 90 of the above sequence, the FABP4 gene of Hu sheep exhibits G / A polymorphism at this site; the feed conversion ratio of sheep carrying the GG genotype is significantly lower than that of sheep carrying the GA and AA genotypes.

3. The application of a kit for detecting molecular markers related to feed conversion ratio in Hu sheep breeding, characterized in that, The kit includes primer pairs with nucleotide sequences as shown in SEQ ID NO.2 and SEQ ID NO.3 and / or KASPar primer pairs with nucleotide sequences as shown in SEQ ID NO.4-6; the molecular marker has a nucleotide sequence as shown in SEQ ID NO.1, where R at position 90 represents G or A. Due to a G / A mutation at position 90 of the above sequence, the FABP4 gene of Hu sheep exhibits G / A polymorphism at this site; the feed conversion ratio of sheep carrying the GG genotype is significantly lower than that of sheep carrying the GA and AA genotypes.

4. The application of a method for detecting molecular markers related to feed conversion ratio in Hu sheep breeding, characterized in that, The method includes the following steps: S1. Amplify the genomic DNA of Hu sheep using primer pairs with nucleotide sequences as shown in SEQ ID NO.2 and SEQ ID NO.3 or KASPar primer pairs with nucleotide sequences as shown in SEQ ID NO.4-6; S2. Identify the polymorphic sites of the amplification products obtained in step S1. Among them, the feed conversion rate of sheep carrying the GG genotype is significantly lower than that of sheep carrying the GA and AA genotypes. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.

1. The R at position 90 represents G or A. Since there is a G / A mutation at position 90 of the above sequence, it leads to the G / A polymorphism of the FABP4 gene of Hu sheep at this site. The breeding program aims to screen for Hu sheep with low feed conversion rates for the purpose of breeding feed-saving Hu sheep.