A major qtl for regulating the number of tassel branches of maize, a candidate gene and application thereof

Abstract

The application belongs to the field of biological breeding, and relates to regulation of tassel branching of corn, in particular to a major QTL for regulating tassel branching of corn, a candidate gene thereof and application. A major QTL is screened by using whole genome composite interval mapping method, and is located in a physical interval of about 0.6M of 10 chromosome 127.81-128.37, the correlation interval contains 15 candidate genes with medium and high functional variation sites, and the candidate gene TBN-S is related to development of tassel branching number. It is verified by transgenic that the gene is positively related to tassel branching number, and a new corn variety with high tassel branching number can be cultivated by overexpression of the gene. TBN-S TBN-S TBN-S ​​

Description

Technical Field

[0001] This invention belongs to the field of biological breeding and relates to the regulation of tassel branching in maize, specifically a major-effect QTL for regulating the number of tassel branches in maize, its candidate genes, and their applications. Background Technology

[0002] Corn is my country's largest grain crop, an important feed source for the livestock industry, and a significant industrial raw material. Corn is a monoecious, separate-flowering crop, and during its growth, there is a clear competition between the male and female ears for photosynthetic products. Furthermore, due to apical dominance, the male ear receives more nutrients than the female ear (Czepak et al., 2019). Studies have reported that plants with removed male ears yield 11%-20% more than those without (Sangoi et al., 2006). In addition, Bódi et al. (2008), through a study on the correlation between male ear traits and yield traits, found a negative correlation between male ear weight and yield, suggesting that male ear size can affect corn yield. Selecting male ears of moderate size with fewer branches not only increases light transmittance and photosynthesis (Guei et al., 1996), but also reduces the consumption of nutrients by the male ear, allowing more nutrients to be transferred to the kernels, thus improving corn kernel yield (Xu et al., 2017). Maize tassels can be broken down into several related traits, such as the number of tassel branches, ear weight, and branching angle. Among these, the number of tassel branches is a key trait, serving as a major determinant of tassel size. Therefore, locating QTLs associated with the number of maize tassel branches and elucidating their mechanisms has significant guiding value for maize breeding and production. With the rapid development of maize breeding, the improvement of tassel branching traits has received increasing attention. Numerous reports, both domestically and internationally, have explored the locating of maize tassel branching numbers using different genetic populations. These QTLs have been located on different segments of multiple maize chromosomes, with phenotypic contributions ranging from 0.5% to 35.9%. Mickelson et al. (2002) used a recombinant inbred line (RIL) population constructed from B73 and Mo17 to locate six QTLs controlling the number of tassel branches. These QTLs were distributed on chromosomes 1, 2, 3, and 4, with three located on chromosome 2, and phenotypic contributions ranging from 6.5% to 35.9%. In 2006, UpadyayμLa and Silva located two QTLs controlling tassel branch number in a BC1S1 population, with the major QTL located on chromosome 4 explaining 11.7% of the phenotypic variation. Briggs et al. (2007) used a BC1 population constructed from a cross between W22 and wild teosinte to detect 31 QTLs controlling tassel branch number in two environments, distributed across all 10 chromosomes, explaining 0.5%–18.3% of the phenotypic variation. Gao Shibin et al. (2007) detected four QTLs controlling tassel branch number in maize under drought stress, and the two major QTLs located on chromosomes 5 and 7 were linked to drought-resistant QTLs detected in the same population, with the phenotypic contribution of each QTL ranging from 5.6% to 28.4%. Wang Di et al. (2011) used two F1 generation lines, Qi 319 × Huangzao 4 and Ye 478 × Huangzao 4, to determine the phenotypic contribution of each QTL. 2:3A total of 40 QTLs related to tassel branching were detected in the population under six different ecological environments, including 7 major QTLs. Brown et al. (2011) also identified 39 QTLs related to tassel branching using a NAM (nested association mapping) population containing 4892 individual plants, distributed across all 10 maize chromosomes. Du et al. (2018) used 10684 single nucleotide polymorphism (SNP) markers evenly distributed across the maize genome for association analysis, detecting 26 significantly associated SNP loci under both high and low density conditions, distributed across the remaining 9 chromosomes except chromosome 4. Wang et al. (2019) detected 24 tassel-related trait QTLs in a population of 10kb maize SNP chips and recombinant inbred lines from 177 families under two different environments, with a single QTL locus explaining up to 18.66% of the phenotypic variation. Li et al. (2019) finely mapped the recessive control gene of a maize inbred line LX1 without tassel branches to an 88.2 kb region at the end of the long arm of chromosome 6, predicting Zm00001d038546 as a candidate gene.

[0003] Previous studies on the number of branches on maize tassels are numerous, and many QTLs have been mapped. However, these studies are primarily focused on QTL mapping, with few genes actually cloned. To further explore the QTLs for maize tassel branch number, bioinformatics software was used to analyze candidate gene segments and identify candidate genes. This will provide a theoretical basis for understanding maize tassel branch number development and for breeding varieties with fewer tassel branches. Summary of the Invention

[0004] To address the aforementioned technical problems, this invention proposes a major-effect QTL for regulating the number of branches on maize tassels, its candidate genes, and their applications.

[0005] The technical solution of this invention is implemented as follows:

[0006] This application used whole-genome complex region mapping to screen a major QTL located in a physical region of approximately 0.6M on chromosome 10, between 127.81 and 128.37. The associated region contains 15 candidate genes with intermediate to high functional variation sites, among which the candidate gene TBN-S is related to the development of the number of male spike branches.

[0007] The nucleotide sequence of the TBN-S gene described above is shown in SEQ ID No. 1.

[0008] Application of the aforementioned major QTLs or the aforementioned candidate gene TBN-S in breeding maize varieties with high tassel branch number.

[0009] The application of the aforementioned major-effect QTLs or the aforementioned candidate gene TBN-S in regulating the number of branches on maize tassels.

[0010] The application of the aforementioned major-effect QTLs or the aforementioned candidate gene TBN-S in regulating the formation and variation of determinate inflorescences in maize tassels.

[0011] Application of recombinant vectors containing the aforementioned TBN-S gene in regulating the number of male tassel branches in maize.

[0012] Application of recombinant vectors containing the above-mentioned TBN-S gene in regulating the formation and variation of determinate inflorescences in maize tassels.

[0013] The aforementioned recombinant vectors are overexpression vectors.

[0014] A method for increasing the number of branches on maize tassels comprises the following steps: constructing an overexpression vector containing the aforementioned TBN-S gene, and then transforming it into the target plant using Agrobacterium-mediated transformation to obtain new plants with increased branch numbers.

[0015] The sequences of the primer pairs for amplifying the TBN-S gene are shown in SEQ ID No. 2 and SEQ ID No. 3.

[0016] The present invention has the following beneficial effects:

[0017] 1. This application uses a combination of pooled sequencing and genetic mapping to locate the major QTL controlling the number of male spike branches in the interval 127.81-128.37M at the end of the long arm of chromosome 10, which includes 15 genes with medium to high variability. Among them, TBN-S is inferred to be a candidate gene controlling the number of male spike branches.

[0018] 2. The purpose of this invention is to provide a gene TBN-S that controls the number of branches on maize tassels. A pooled sequencing and genetic mapping method was used to accurately isolate the candidate gene. This gene has the DNA fragment shown in SEQ ID No. 1. Increased accumulation of this gene mRNA leads to an increase in the number of branches on maize tassels; therefore, cloning this gene helps to understand the molecular mechanism of the number of branches on maize tassels.

[0019] 3. The TBN-S gene regulating the number of tassel branches involved in this application is a protein of the ZeaCENTRORADIALIS (ZCN) family, consisting of 175 amino acids and a conserved functional domain. Its amino acid sequence is shown in SEQ ID No. 4. Its molecular biological function has not yet been reported in maize. This invention studies the molecular biological function of this gene in regulating the number of tassel branches in maize and provides a potential new gene resource for breeding superior high-yielding maize varieties with suitable tassel branch numbers.

[0020] 4. This application verified the positive correlation between the TBN-S gene and the number of tassel branches through transgenic technology. Specifically, the TBN-S gene was fused with other regulatory elements, such as constitutive promoters (e.g., the CaMV35S promoter) or organ-specific promoters, to construct an overexpression vector, and a maize inbred line with a high number of tassel branches was created through transgenic technology. Attached Figure Description

[0021] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0022] Figure 1 The distribution of ΔSNP-index values ​​on 10 chromosomes is shown in the figure.

[0023] Figure 2 Genetic maps of the SNM131 and HY813 F2 populations.

[0024] Figure 3 This is a QTL distribution map of the number of male spike branches in the SNM131 and HY813 F2 populations obtained using the CCIM method.

[0025] Figure 4 This is a plasmid map of the pEGOEP2×35S-B vector.

[0026] Figure 5 The image shows the electrophoresis result of the vector digestion; where the markers are: 5000bp; 3000bp; 2000bp; 1000bp; 750bp; 500bp; 250bp.

[0027] Figure 6 This is a phenotypic diagram of the TBN-S gene transgene. Detailed Implementation

[0028] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0029] Example 1: Obtaining candidate genes

[0030] 1. Materials and Methods

[0031] 1.1 Test Materials

[0032] Test materials: SNM131 and HY813 are maize inbred lines that were obtained through 8 generations of self-pollination over 4 consecutive years in this study. Among them, inbred line SNM131 has only 1 tassel branch, while inbred line HY813 has 19 tassel branches.

[0033] 1.2 Field trials and trait surveys

[0034] All field trials were conducted at the Mingyang Base of the Maize Research Institute, Guangxi Academy of Agricultural Sciences. In the autumn of 2020, the F1 hybrid was bred using maize inbred line HY813 as the male parent and SNM131 as the female parent. In the spring of 2021, F1 seeds were sown and self-pollinated, with ears harvested per plant at maturity. In the autumn of 2021, one ear of F2 seed was raised to construct an F2 population containing 281 individual plants and two parental plants. The population was planted in single rows, 6m long, with 7 plants per row, and plant and row spacing of 1.0m and 0.7m respectively. Field management was the same as for ordinary maize field planting. Before tasseling, leaf samples were taken from all individual plants in the F2 population, the two parents, and the F1 plants and stored at -80℃. At the tasseling stage, the number of tassel branches on each individual plant in the F2 segregating population was counted.

[0035] In the autumn of 2021, male parent HY813, female parent SNM131, and their F1 and F2 populations were planted. Field identification of tassel branch number was conducted after tasseling for QTL mapping. Broadly heritable capacity (H) was calculated using the following formula. 2 =σg 2 / (σ g 2 +σ e 2 )×100%, where σ g 2 It is the genotype variance, σ e 2 It is the error variance.

[0036] The number of male spike branches in SNM131, HY813 and their F2 generation plants: Observation revealed that the average number of male spike branches in the maternal parent SNM131 was only 1.4, while the number of male spike branches in the paternal parent HY813 was as high as 19.1. The average number of male spike branches in the F2 population of the two parental pairs was 7.6. This indicates that the individual plants in the entire F2 population are biased towards the maternal parent SNM131, with fewer male spike branches, ranging from 1 to 21 branches. The skewness and kurtosis values ​​of the population are both in the range of -1 to 1, and the absolute values ​​are relatively small. This indicates that the distribution of male spike branch number in the F2 population is close to the standard normal distribution, which is suitable for QTL plotting (Table 1).

[0037] Table 1. Statistical analysis of maize tassel branch number in SNM131 and HY813 F2 populations.

[0038]

[0039] 1.3 Mixed-pool sequencing and marker genotyping of extreme traits

[0040] From the F2 population, 38 plants with 17 or more male spike branches and 33 plants with 2 or fewer male spike branches were selected. DNA was extracted from their leaves and adjusted to the same concentration. Extreme trait pools were constructed separately. Then, equal amounts of these pools were mixed to construct wild-type and mutant pools for the gene mapping of male spike branch number trait.

[0041] DNA from two parents and two pools was fragmented using sonication. Sequencing adapters were ligated, and approximately 400 bp genomic fragments were enriched using magnetic beads. These fragments were then amplified by PCR to form sequencing libraries. After library quality control, sequencing was performed using an Illumina Novaseq 6000 platform. Resequencing of the two parents yielded 30× coverage, while wild-type and mutant pools yielded 17× and 28× coverage, respectively. Low-quality data were removed during sequencing data quality control. The remaining high-quality data were aligned to the reference genome (https: / / www.ncbi.nlm.nih.gov / genome / ?term=Zea+mays) using BWA software (Li et al., 2009) to obtain sequence position BAM files. Single nucleotide polymorphisms (SNPs) and small insertion / deletion markers were detected using the Best Practices workflow of GATK 3.3 (McKenna et al., 2010). The functions of SNPs and InDels were annotated using SnpEff software (Cingolani et al., 2012) and gene prediction information from the reference genome B73.

[0042] Whole-genome resequencing was performed on a mixed pool consisting of 33 plants with few male spike branches and 38 plants with many male spike branches, along with two parents, yielding a total of 270.4 G of raw data. After filtering, the total number of high-quality bases in the four samples ranged from 47835.03 to 75636.15 M, with a total data volume of 253.5 G. The Q30 ranged from 90.23 to 94.04, the GC content from 45.42 to 46.23%, and 99.37% to 99.47% of the sequences were alignable to the reference genome. The actual sequencing depth ranged from 20.67 to 32.82 × 10⁻⁶. Therefore, the sequencing quality of this experiment met the standards, and the sequencing depth exceeded the initial experimental settings. Thus, the sequencing data can be used for further variation detection and trait association analysis.

[0043] Sequencing data from the two parents, SNM131 and HY813, were compared, revealing a total of 1,812,886 SNPs and 247,147 InDels. Combining the results of two pooled marker genotyping studies, 53,182 SNPs and 8,083 InDels were further selected for subsequent phenotypic association analysis. The distribution of polymorphic sites across the 10 maize chromosomes was uneven, with the highest number of polymorphic markers on chromosome 1 and the lowest on chromosome 10 (Table 2).

[0044] Table 2 shows the number distribution of SNPs and InDels on the 10 chromosomes.

[0045]

[0046] 1.4 Gene mapping of tassel branch number trait based on mixed ponds

[0047] Using the SNPs and InDel markers obtained above, homozygous markers with polymorphism between the father and mother were screened based on the sequence information of the reference genome B73. Following the method of Takagi et al. (Takagi et al., 2013), the index value of each SNP and InDel marker in the wild-type and mutant pools was calculated separately. The calculation formula is Index = Dep M / (Dep M +Dep W The numbers ΔSNP-index values ​​are plotted as follows: DepM and DepW represent the number of reads for the mutant and wild-type alleles in the mutant and wild-type pools, respectively. The difference between the two pool index values ​​is then calculated: ΔIndex = Index(mutant) - Index(wild-type). To eliminate random error, all ΔSNP-index values ​​on each chromosome are windowed at 1 Mb intervals and plotted with a step size of 5 kb. A 99.9% confidence level is used as the threshold; windows exceeding the threshold represent trait association intervals.

[0048] The ΔSNP-index values ​​between the two pools were calculated, and the data showed that the values ​​of 5 chromosomal segments exceeded the threshold. Figure 1 These associated regions are located on chromosomes 5, 8, and 10, with physical distances between them ranging from 1.03 to 2.36 Mb. The ΔSNP-index peak is highest in the 127.61–129.46 Mb region of chromosome 10, which may contain a major gene controlling the number of tassel branches in maize (Table 3).

[0049] Table 3. Statistical table of variant sites in associated regions

[0050]

[0051] 1.5 Construction of genetic maps

[0052] SNP marker polymorphism was detected in an F2 population of 267 plants and their paternal and maternal parents using the Affymetrix Maize SNP 10K Gene Chip. Marker genotyping data with numerical morphology of 0, 1, and 2 were obtained. The subset command in R (version 3.6.1) was used to remove markers without polymorphism between parents, and markers with deletions greater than 5% were also deleted. Next, the chi-square test was performed on all polymorphic markers using the chisq.test command to remove markers with highly significant partial segregation (p-value < 0.001). The remaining markers after the above processing were used to construct a genetic linkage map using the genetic mapping software JoinMap 4.0. First, the genotypes of each marker were transcoded according to the JoinMap file format: genotypes identical to the maternal parent were transcoded as "A", genotypes identical to the paternal parent were transcoded as "B", heterozygous genotypes were transcoded as "H", and deletions were transcoded as "-". Next, marker-based grouping was performed using the independence p-value as the grouping parameter, with a range starting at 103 and ending at 5 × 105. Maximum likelihood estimation was used for plotting, with a maximum of 200 iterations for multi-point estimation of recombination frequencies. The kosambi function was used to calculate the genetic distance between markers. The obtained phenotypic data was plotted using Mapchart 2.32 software (https: / / www.wur.nl / en / show / Mapchart.htm) to obtain a genetic map with a pattern of dense and sparse vertical stripes.

[0053] A genetic linkage map was constructed based on 2944 markers. Figure 2 (Table 4). The total map distance was 3684.3 cM, with chromosome 1 (534.5 cM) having the longest and chromosome 10 (182.4 cM) having the shortest. The average marker distance ranged from 0.9 cM to 1.5 cM, with an average distance of 1.25 cM. The maximum distance between markers on each chromosome ranged from 4.6 to 9.4 cM, with chromosome 8 having the largest interval and chromosome 9 having the smallest interval (Table 4).

[0054] Table 4. Statistical analysis of genetic map data constructed from SNM131 and HY813 F2 populations.

[0055]

[0056]

[0057] 1.6 QTL Localization Analysis and Candidate Gene Prediction

[0058] QTL localization was performed using the R analysis software QTL.gCIMapping (Zhang et al., 2020). Parameters were set as follows: LOD value was set to the software default value of 2.5, a randomized model was used, a migration speed of 1 cM / scan was used during whole-genome scanning, and the restricted maximum likelihood function was selected.

[0059] The BLAST software was used to compare the gene sequences and their variant sites within the associated intervals with five functional databases: GO (Lewis et al., 2000), KEGG (Minoru et al., 2004), UniProt (Apweiler et al., 2004), NR (Deng et al., 2006), and EggNOG (Huerta-Cepas et al., 2017) to determine the function of the mutated genes. The number of high, medium, and low-degree variants in each gene were also indicated.

[0060] Based on a genetic map containing 2944 markers, and combined with phenotypic data on the number of male spike branches from the SNM131 and HY813 F2 populations, QTL analysis was performed using the software QTL.gCIMapping. At a LOD of 2.5, QTL.gCIMapping detected a total of 5 QTLs, of which 2 had relatively large effects, located on chromosomes 1 and 10 respectively, and the remaining 3 QTLs were located on chromosomes 4, 6, and 10 respectively. Furthermore, the peak values ​​of the two QTLs located on chromosomes 1 and 4 were precisely located on the two SNP markers AX86301640 and AX86246935, respectively. The two QTLs detected on chromosome 10 were located further apart, with the smaller QTL located at the end of the short arm of chromosome 10 (Table 5). Figure 3 ).

[0061] Table 5. QTL locations and effects of tassel branch number detected in SNM131 and HY813 F2 populations.

[0062]

[0063] Based on the combined results of BSA resequencing and QTL mapping, the major QTL controlling tassel branching in SNM131 was located in the region 127.81-128.37M from the end of the long arm of maize chromosome 10. Comparison of all gene sequences within this 0.56M region between the two parents revealed 24 genes with varying degrees of difference, including 10 genes with high functional influence on variant SNP sites and 5 genes with moderate functional influence on variant sites (Table 6). Comparison of 15 genes with significant variations using five functional databases (GO, KEGG, UniProt, NR, and EggNOG) revealed that, except for genes LOC100277333 and pco094349 which lacked annotation information, two of the remaining 13 genes, TBN-S and LOC103641791, were found to be related to flower development in the GO database (GO annotation numbers: 0009908 and 0048586, respectively).

[0064] Table 6. Statistical table of candidate genes within the localization interval.

[0065]

[0066] Note: "High" refers to the number of variant sites in a gene that have a high impact on function, "Medium" refers to the number of variant sites in a gene that have a moderate impact on function, and "Low" refers to the number of variant sites in a gene that have a low impact on function.

[0067] This study located the major QTL controlling the number of tassel branches in the maize inbred line SNM131 within the interval 127.8-128.4M on the long arm of chromosome 10. This result overlaps with the last segment of the location interval obtained by Wang Di and with the first segment of the major QTL identified by Dai Ziju. However, due to the use of high-density SNP markers, the location accuracy is much higher than the latter two.

[0068] The development of male flower branches in maize is a complex biological process involving many genes. Among them, the TFL1-like gene (Terminal Flower1-like) encodes a phosphatidylethanolamine-binding protein (PEBP), which is mainly expressed in the meristematic region. Its main function is to maintain the characteristics of the inflorescence meristem and prevent its transformation into a flowering meristem. In this study, bioinformatics analysis of major QTL segments revealed a TFL-like gene, TBN-S. Based on this, it is hypothesized that the TBN-S gene plays a crucial role in controlling the formation and variation of determinate inflorescences in maize.

[0069] Example 2: Transgenic Function Verification of Candidate Gene TBN-S

[0070] 1. Primers designed with the TBN-S gene as the target gene are as follows:

[0071] TBN-SF: Actag ggtctcG ACCG TTATCTAATATATCGTCTGCCTCCACACCCA

[0072] TBN-SR: Actag ggtctcT CACC ATGTCAAGGGATCCACTAGTGGTAGG

[0073] The intermediate vector primers are as follows:

[0074] 2×35S-F:CTCAAGCAATCAAGCATTCTAC

[0075] NOS-R: ATCATCGCAAGACCGGCAAC

[0076] 2. Amplification and recovery of the target fragment

[0077] PCR reaction system:

[0078]

[0079] PCR reaction conditions:

[0080]

[0081] The 528bp electrophoretic fragment was cut out and the target fragment was recovered using the agarose gel DNA recovery kit (DP209-03) from Tiangen Biotech Co., Ltd. The procedure was performed according to the kit instructions.

[0082] 3. Enzyme digestion-ligation reaction

[0083] Reaction system:

[0084]

[0085] Reaction parameters:

[0086]

[0087] 4. Transformation of recombinant plasmids

[0088] (1) Take a tube of 100 μL LDH5a competent E. coli cells and mix with 2-5 μL of ligation product, and incubate on ice for 30 min;

[0089] (2) Quickly place it in a 42℃ constant temperature water bath, heat shock for 90s, then ice bath for 2min;

[0090] (3) Add 500 μL of LB liquid culture medium and mix well;

[0091] (4) Incubate at 37℃ and 200rpm for 45min to allow the cells to return to normal growth.

[0092] (5) Spread the bacterial culture evenly on Kana-resistant LB solid medium plates;

[0093] (6) After 30 minutes, place in a 37°C constant temperature incubator and incubate overnight.

[0094] 5. Microbial testing

[0095] Colony PCR was performed using primers 2×35S-F / NOS-R, and the band size was approximately 711 bp. Positive colonies were picked and shaken for further inoculation.

[0096] Colony PCR amplification system:

[0097]

[0098] Reaction parameters:

[0099]

[0100] 6. Plasmid extraction

[0101] (1) Pick single clones from LB solid medium plates and inoculate them into LB liquid medium with a final concentration of 50 μg / mL for kanamycin resistance, and incubate overnight at 37°C;

[0102] (2) Take 4 mL of activated bacterial solution, centrifuge at 10,000 rpm for 2 min at room temperature, and completely discard the supernatant;

[0103] (3) Take 250 μL of Solution I reagent containing ribonuclease A and thoroughly resuspend the bacterial block;

[0104] (4) Take 250 μL of Solution II reagent to lyse the bacterial block, and gently invert it several times until the bacterial cells become transparent;

[0105] (5) Take 350 μL of Solution III reagent, invert it several times until a white, firm flocculent substance is formed;

[0106] (6) Centrifuge at 12,000 rpm for 10 min at room temperature and collect the supernatant;

[0107] (7) Remove the nucleic acid purification column from the kit and place it on the collection tube;

[0108] (8) Take the clear supernatant from step 6 above into a nucleic acid purification column, centrifuge at 12,000 rpm for 1 min at room temperature, and discard the filtrate;

[0109] (9) Add 500 μL of Buffer W1 to the nucleic acid purification column, centrifuge at 12000 rpm for 30 s at room temperature, and discard the filtrate;

[0110] (10) Add 700 μL of Buffer W2 to the nucleic acid purification column, centrifuge at 12000 rpm for 30 s at room temperature, and discard the filtrate;

[0111] (11) Repeat step 10 above;

[0112] (12) Place the nucleic acid purification column on the collection tube and incubate at room temperature for 2 minutes at 12,000 rpm to remove residual liquid as much as possible;

[0113] (13) Discard the collection tube, take the nucleic acid purification column and place it in a 1.5 mL EP tube, and add 50 μL of elution buffer to elute the DNA attached to the nucleic acid purification column membrane (the elution buffer can be preheated in a 65℃ constant temperature water bath to help elute the DNA), and let it stand at room temperature for 2 min;

[0114] (14) Centrifuge at 12,000 rpm for 2 min at room temperature to wash off the DNA attached to the nucleic acid purification column membrane, and store at -40℃ for later use.

[0115] (15) Take a small amount of the recovered product and use 1% agarose gel electrophoresis to detect the plasmid extraction quality.

[0116] 7. Sequencing

[0117] The plasmids extracted from the above positive plaques were subjected to Sanger sequencing using the sequencing primers NOS-R / 2×35S-F. The plasmids were then digested with EcoRI / HindIII, yielding a 1733bp and 8376bp band, respectively. Figure 5 (As shown); if the sequencing result sequence matches the target fragment sequence, the overexpression vector has been successfully constructed. The plasmid map of the overexpression vector is shown below. Figure 4 As shown.

[0118] 8. Agrobacterium-mediated genetic transformation in maize immature embryos

[0119] (1) Sterilization and separation of the embryo

[0120] Cut off 1 cm from the top of the ear. Insert the tip of forceps into the upper apical axis to facilitate aseptic handling of the young ear. Place the ear with the forceps into a sterile wide-mouth bottle on a laminar flow hood. First, soak it in 70% alcohol for 10 minutes, then soak it in a sterile solution [50% commercial bleach (5.25% sodium hypochlorite)] for 15-20 minutes, and then rinse the young ear three times with plenty of sterile water. Drain the water and let it air dry. On the laminar flow hood, carefully and gently attach the young ear to the tip of a blade and peel 50-100 embryos into a 2ml centrifuge tube containing sterile culture medium.

[0121] (2) Agrobacterium infection

[0122] Agrobacterium strain EHA105 was cultured on YEP medium at 28°C for 1-2 days. Colonies cultured for two days were scraped using an inoculation loop and suspended in 5 ml of sterile infection medium. The absorbance (OD550) was measured to be 0.5 using a spectrophotometer. The exfoliated embryos were transferred to the Agrobacterium suspension, and the centrifuge tube was gently inverted 20 times. The embryos were then immersed in the centrifuge tube vertically for 10 minutes, indicating that the embryo infection was complete.

[0123] (3) Co-culture of Agrobacterium and immature embryos

[0124] After infection, transfer the embryos and infection solution to a co-culture medium, and remove any remaining Agrobacterium suspension from the surface of the medium. Seal the culture dish with sealing film and incubate in the dark for 2-3 days.

[0125] (4) Subsidiary training

[0126] After co-culture, all immature embryos (including untreated controls and those overexpressing the TBN-S gene) were transferred to selection medium I. After 10-15 days, the immature embryos were transferred to selection medium II. After the selection culture was completed, the obtained resistant type II immature embryo callus was transferred to regeneration medium and cultured under light. Two weeks later, positive transgenic seedlings began to appear from the resistant callus.

[0127] (5) Regeneration of transgenic plants

[0128] The differentiated transgenic seedlings were transferred to rooting culture bottles for root promotion and seedling strengthening. When the taproot grew to about 1 cm, the seedlings were transferred to sterilized culture soil and cultured under light in a greenhouse.

[0129] (6) Field management of transgenic plants

[0130] The obtained transgenic plants were transplanted to the field and registered there. Field management and harvesting of the transgenic plants were carried out in accordance with the relevant regulations for the safety management of genetically modified organisms in agriculture.

[0131] Results of genetic modification such as Figure 6 As shown, by Figure 6 It can be seen that the number of male tassel branches in maize after TBN-S gene overexpression was significantly greater than that in the control, with the number of male tassel branches increasing by nearly 50%.

[0132] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A candidate gene for a major-effect QTL regulating the number of branches on a maize tassel, characterized in that: The major-effect QTL is located in the region 127.81-128.37M from the end of the long arm of chromosome 10; The candidate gene is the TBN-S gene, and its nucleotide sequence is shown in SEQ ID No.

1.

2. The application of the candidate gene described in claim 1 in the breeding of maize varieties with high tassel branch number.

3. The application of the candidate gene described in claim 1 in regulating the number of branches on maize tassels.

4. The application of the recombinant vector containing the candidate gene of claim 1 in regulating the formation and variation of determinate inflorescences of maize tassels.

5. The application according to claim 4, characterized in that: The recombinant vector is an overexpression vector.

6. A method for increasing the number of branches on a maize tassel, characterized in that, The steps are as follows: construct an overexpression vector containing the TBN-S gene as described in claim 1, and then transform it into the target plant using Agrobacterium-mediated transformation to obtain new plants with increased branching number.

7. The method for increasing the number of branches on a maize tassel according to claim 6, characterized in that: The sequences of the primer pairs for amplifying the TBN-S gene are shown in SEQ ID No. 2 and SEQ ID No. 3.

Images