Enzymatic assisted liquid chromatography-tandem mass spectrometry method for identification of 12alpha-hydroxy bile acids and application thereof

Abstract

The application discloses an enzyme-assisted liquid chromatography-mass spectrometry detection method for identifying 12alpha hydroxyl bile acid and application, and belongs to the technical field of biological detection. The application discloses a 12alpha-HSDH gene sequence which is codon-optimized, as shown in SEQ ID No: 1, and a target protein is obtained after recombination vector transformation, induction expression and protein purification. Kinetic analysis data show that 12alpha-HSDH can efficiently and specifically catalyze the dehydrogenation reaction of 12HBAs in vitro. Based on the above characteristics of the 12alpha-HSDH gene, combined with the analysis of the ultra-high performance liquid chromatography tandem mass spectrometry method, the conversion rate of BAs is defined as (1-Ab / Aa)%, the conversion rate index is established by using BAs standard products to identify 12alpha hydroxyl bile acid, and is used for identifying 12HBAs and non-12HBAs. In addition, the application is applied to mixed biological substrates of multiple sources, provides a BAs spectrum containing C12 site information, and can be used for diagnosing the change of BAs under pathological conditions.

Description

Technical Field

[0001] This invention belongs to the field of biological detection technology, specifically relating to an enzyme-assisted liquid chromatography-mass spectrometry detection method and its application for recognizing 12α-hydroxybile acids. Background Technology

[0002] The gut microbiota is closely related to glucose and lipid metabolism, with some bacteria influencing multiple bile acid (BA) receptor signaling pathways by regulating bile acid (BA) metabolism. Cholesterol in the liver is metabolized by hepatic enzymes to synthesize primary bile acids. Bile acids (BAs) possess diverse chemical structures and biological functions, with synthetic pathways including the classical pathway (primarily producing 12α-hydroxybile acids, bile acids) and the alternative pathway (primarily producing non-12α-hydroxybile acids, chenodeoxycholic acid). BA synthesis and excretion are major pathways in cholesterol and lipid metabolism, and are therefore associated with various metabolic diseases, including obesity, diabetes, and non-alcoholic fatty liver disease. Furthermore, both hydroxylated sterols and BAs can act as signaling molecules, activating multiple nuclear and membrane receptor-mediated signaling pathways in various tissues, regulating glucose, lipid homeostasis, inflammation, and energy expenditure. Regulating BA synthesis and composition to modulate BA signaling is a potential strategy for the treatment of metabolic diseases.

[0003] An elevated ratio of 12α-hydroxycholic acids (12HBAs) to non-12α-hydroxycholic acids (non-12HBAs) is generally associated with metabolic disorders such as insulin resistance and hepatic steatosis. Conversely, an increased proportion of non-12HBAs helps reduce lipid uptake and improve glucose tolerance. Furthermore, non-12HBAs medications such as ursodeoxycholic acid (UDCA) and lithocholic acid (LCA) have shown beneficial results in the clinical treatment of primary biliary cholangitis, liver fibrosis, and non-alcoholic fatty liver disease.

[0004] Given the numerous isomers and limited standards of BAs, accurately identifying and distinguishing 12HBAs from non-12HBAs in complex biological matrices presents a significant challenge. Currently, it is also impossible to globally distinguish 12HBAs from non-12HBAs without relying on standards. Jia Gangtian proposed a microenzymatic method for the determination of 12α-hydroxycholic acid in blood. His research used 12α-hydroxysteroid dehydrogenase (12α-HSDH) to determine 12α-hydroxycholic acid in blood. However, what he disclosed was actually a simplified enzymatic colorimetric method for bile acids (CA) and deoxycholic acids (DCA), which caused CA and DCA with 12α-hydroxy groups to show a specific reaction. The absorption intensity showed that the free form > glycine-bound form > taurine-bound form. The drawback of this method is that it can clearly identify free 12HBAs, but the accuracy in identifying bound 12HBAs is not ideal.

[0005] High-resolution mass spectrometry (HRMS) offers a wide detection range and provides rich structural information, making it a crucial technique for identifying basic alkanoates (BAs) in complex samples. Numerous studies have focused on characteristic fragmentation and chemical derivatization techniques to differentiate and detect BA isomers. However, it's important to note that only free 12HBAs can produce clearly defined characteristic fragments; many bound 12HBAs cannot be distinguished based on diagnostic fragmentation alone.

[0006] Furthermore, finding a specific chemical reagent targeting a particular site is extremely difficult. Wang Zhizhen, in his master's thesis "Codon Optimization, Expression, Affinity Purification, and Enzyme Properties of 3α-Hydroxysteroid Dehydrogenase," optimized the 3α-HSDH gene codons and synthesized the complete 3α-HSDH gene sequence, which uses nicotinamide adenine dinucleotide (NAD)... + () is a cofactor that can reversibly catalyze the oxidation and reduction of the hydroxyl group at the third position in steroid molecules. Although it is a specific chemical reagent targeting a specific site, it is mainly used clinically as a key enzyme to detect the total bile acid content in serum, and cannot be used to distinguish and identify 12HBAs and non-12HBAs.

[0007] With the rapid development of synthetic biology, the analysis of BA metabolic reactions has been expanded. In order to accurately distinguish between 12HBAs and non-12HBAs, it is essential to develop a bioenzyme-assisted mass spectrometry method to differentiate between 12HBAs and non-12HBAs. Summary of the Invention

[0008] The purpose of this invention is to solve the problems existing in the prior art and to provide a method and application for identifying 12HBAs using a liquid chromatography-mass spectrometry (LC-MS) method assisted by 12α-hydroxysteroid dehydrogenase (12α-HSDH) encoded by intestinal microorganisms, thereby distinguishing 12HBAs from non-12HBAs.

[0009] The technical solution of the present invention is: an enzyme-assisted liquid chromatography-mass spectrometry detection method for recognizing 12α-hydroxybile acids. The method is based on 12α-HSDH encoded by the delayed Egerte strain DSM 2243, and the 12α-HSDH gene sequence is codon optimized. The optimized 12α-HSDH specifically catalyzes the dehydrogenation reaction of 12HBAs in vitro. The nucleotide sequence of the optimized full-length 12α-HSDH gene is shown in SEQ ID No: 1.

[0010] The specific testing process is as follows:

[0011] (1) Two identical bile acid samples a and b were used. Sample b was added with 12α-HSDH solution and cofactor nicotinamide adenine dinucleotide (NAD+), while sample a was not added with 12α-HSDH and was used as a negative control. The reaction was carried out in neutral buffer.

[0012] (2) Add organic reagent to the reaction mixture for liquid-liquid extraction, allow to stand for layering, transfer the organic layer, blow dry, redissolve the residue in the internal standard solution, centrifuge, and enter the instrument for analysis.

[0013] (3) The supernatant was separated and detected by ultra-high performance liquid chromatography-tandem mass spectrometry: the samples a and b prepared in step (1) were separated by high performance liquid chromatography, and the mass-to-charge ratio of BAs in samples a and b was detected by mass spectrometry.

[0014] (4) The data collected in step (3) are quantified relative to the isotope internal standard to obtain the peak area A of BAs in samples a and b. The conversion rate of BAs is defined as (1-A). b / A a )%, of which A b For the peak area of ​​sample b, A a The peak area of ​​sample a is used to identify 12α-hydroxycholesterol acids by establishing conversion indexes using BAs standards.

[0015] Furthermore, (1-A b / A a The paired peaks with a value between 60% and 100% are 12 HBAs.

[0016] Furthermore, the neutral buffer used in step (1) is potassium dihydrogen phosphate buffer or Tris-HCl buffer with a pH of 6-10, and the reaction is carried out at 30-50°C for 6-24 hours.

[0017] Furthermore, the organic reagent used in step (2) is ethyl acetate, and the volume ratio of the reaction mixture to the organic reagent is 1:1 to 4.

[0018] Further, in step (3), the high performance liquid chromatography conditions are as follows: column: Waters ACQUITY C18 column (2.1×100mm, 1.7μm); mobile phase composition: water (A) containing 0.1% formic acid and acetonitrile (B); the linear gradient elution conditions of mobile phase B are: 5% (0.0-0.5min), 5% to 35% (0.5-2.0min), 35% to 65% (2.0-35.0min), 65% to 100% (35.0-36.0min), 100% (36.0-44.0min), 100% to 5% (44.0-45.0min), and then hold at 5% for 5.0min, the flow rate is set to 0.2mL / min, the column temperature is 35℃, and the injection volume is 2μL.

[0019] Further, in step (3), the mass spectrometry conditions are as follows: in electrospray ionization (ESI) mode, the DDA-MS acquisition period is 874ms, including MS1 accumulation time (100ms, mass scan range 150-800Da) and MS2 accumulation time (50ms, mass scan range 50-800Da). The ion source is operated in negative ion mode and is set as follows: Ion spray voltage float (ISVF) -4500V, ion source gas 1 (GS1) 55psi, ion source gas 2 (GS2) 55psi, curtain gas (CUR) 40psi, electrospray ion source temperature 550℃, impurity removal potential (DP) -90V, collision energy (CE) -45±15V.

[0020] Furthermore, the codon-optimized full-length 12α-HSDH gene was expressed and purified to obtain the target protein. The expression and purification process is as follows:

[0021] 1) The gene shown in SEQ ID NO.1 was cloned into an expression vector with an N-terminal 6×His tag to obtain a recombinant plasmid;

[0022] 2) The recombinant plasmid was transformed into E. coli BL21(DE3) cells to obtain the recombinant expression transformant;

[0023] 3) Induce expression of the recombinant expression transformant obtained in step 2) in the E. coli system;

[0024] 4) Purify the target protein using a Ni-NTA agarose column.

[0025] Further, in step (1), the expression vector is the pET-22b(+) plasmid vector.

[0026] Compared with the prior art, the present invention has the following advantages:

[0027] 1. This application develops an enzyme-driven liquid chromatography-high-resolution mass spectrometry method to identify 12HBAs and non-12HBAs using enzyme conversion rate as an indicator. This method has two main functions: the first function is global screening, which can identify 12HBAs from mixed biological samples; the second function is isomer differentiation, and the established BAs spectrum provides hydroxyl information at the C12 site.

[0028] 2. 12α-HSDH can be directly synthesized in the Escherichia coli heterologous expression system and is easy to obtain. Using 12α-HSDH encoded by the delayed Egerte strain DSM 2243 (NCBI number: WP_009306643) as a template, the sequence of the 12α-HSDH gene was analyzed, and codon optimization was performed based on the codon preference of the cloning recipient bacterium Escherichia coli to improve the exogenous expression level of the biological enzyme gene.

[0029] 3. The 12α-HSDH site synthesized in this application has high site specificity and reacts only with 12 hydroxyl groups. It can react with 12HBAs efficiently and specifically in vitro under mild conditions, providing a basis for determining the reaction conversion rate of BAs by combining liquid chromatography-mass spectrometry (LC-MS) technology. It can support high-throughput identification of 12HBAs from complex biological matrices.

[0030] 4. The enzyme catalytic reaction disclosed in this application has high efficiency, mild conditions, simple operation, and the enzyme reagent is non-toxic and environmentally friendly;

[0031] 5. The practicality of the enzyme-assisted liquid chromatography-mass spectrometry method provided in this application for identifying 12HBAs has been verified by monitoring the changes in 12HBAs and non-12HBAs in asthma. This shows that this application provides a new model for diagnosing the metabolic transformation of BAs under different pathophysiological states. This technology is expected to be applied to the diagnosis and monitoring of the ratio changes of 12HBAs and non-12HBAs in other metabolic diseases, thereby providing more accurate disease diagnosis and treatment plans for clinical practice, and has good clinical application prospects.

[0032] 6. The enzyme-driven liquid chromatography-high-resolution mass spectrometry method disclosed in this application is expected to be used to evaluate the effects of drugs on 12HBAs and non-12HBAs levels, and thus to evaluate the efficacy and safety of candidate drugs. Attached Figure Description

[0033] Figure 1 The Michaelis-Menten and Lineweaver-Burk plots show the initial velocities of four representative 12HBAs at different concentrations.

[0034] Figure 2 It is an overlay of ion chromatograms of a mixed standard of 31 BAs, a reaction sample of 12α-HSDH, and a control sample;

[0035] Figure 3 This is a conversion rate chart between 12HBAs and non-12HBAs;

[0036] Figure 4 The extracted ion chromatograms are of BAs with a mass-to-charge ratio of 407.2797 in mouse serum reacted with 12α-HSDH and control samples.

[0037] Figure 5 These are the second-order mass spectra of two 12HBAs with a mass-to-charge ratio of 407.2797;

[0038] Figure 6 This is a mass spectrometry characteristic fragmentation pattern of free 12HBAs;

[0039] Figure 7It is a second-order mass spectrum of non-12HBAs (αMCA) with a mass-to-charge ratio of 407.2797;

[0040] Figure 8 These are the results of HE staining of mouse lung tissue sections;

[0041] Figure 9 These are the results of the classification and counting of inflammatory cells in mouse bronchoalveolar lavage fluid;

[0042] Figure 10 This is a statistical graph showing the results of detecting the mRNA levels of IgE, IL-4 in mouse serum and IL-4, IL-5, and IL-13 in mouse lung tissue.

[0043] Figure 11 This is a statistical chart showing the average percentage of 12HBAs and non-12HBAs in the serum, liver, lungs, and feces of the control group and asthmatic mice.

[0044] Figure 12 This is a statistical graph showing the relative expression levels of Cyp7a1, Cyp8b1, Cyp27a1, and Cyp7b1 mRNA in the livers of control and asthmatic mice. Detailed Implementation

[0045] The technical solution of the present invention will be further described below with reference to the accompanying drawings, but it is not limited thereto. Any modifications or equivalent substitutions to the technical solution of the present invention that do not depart from the spirit and scope of the technical solution of the present invention should be covered within the protection scope of the present invention.

[0046] Experimental materials and instruments

[0047] (1) Instruments: Shimadzu LC-30AD ultra-high performance liquid chromatography system, AB SCIEX X500B quadrupole time-of-flight mass spectrometer; Cary 300 UV-Vis spectrophotometer (Agilent); Milli-Q purification system.

[0048] (2) Reagents and consumables: Unless otherwise specified, all reagents used in the following examples are commercial reagents, including 31 BAs standards and cholic acid-d4 (internal standard) (Steraloids, USA; Yuanye, Shanghai; TRC, Canada; Sigma-Aldrich, USA); β-nicotinamide adenine dinucleotide (NAD, 10mM) (Aladdin, Shanghai); mass spectrometry grade solvents and formic acid (Merk, Germany).

[0049] Example 1

[0050] I. Preparation and Kinetic Analysis of the Bioenzyme 12α-HSDH

[0051] (1) Construction of recombinant expression vector: The 12α-HSDH gene sequence (NCBI number: WP_009306643) from Eggerthella lenta strain DSM 2243 was codon optimized. The nucleotide sequence of the codon-optimized full-length 12α-HSDH gene is shown in SEQ ID NO: 1, which is 765 nucleotide bases in length.

[0052] SEQ ID No. 1:

[0053] GATATGGGCCTGAAAGATAAAGTTGTTCTGATCACCGGCGGTGGCGGCGGCATCGCGCGTGGTATCGAACGTGCGTTCGCGACCGAAGGTGCGAAATTCATCCTGACCGACCTGTTCCCAGGCGGCCTGGAAGCGGCGAAAGAAGAACTGGAACGTGATTTCGGCAGCGAAGTTTTCACCATCCTGGCGAA CGGTTCTGTTGAAGAAGAAGTTCGTGCGGCGGTTGAAGCGGGTGCGGAACACTTCGGCGGTCGCATCGATGTTCTGATCAACAACGCGCAGGCGAGCGCGTCTGGCCTGACCCTGGTTCAGCACAGCGAAGAAGATTTCGATCTGGCGGTGCGTTCCGGTCTGTACGCGACCTTCTTCTACATGAAACACG CGTACCCGTACCTGAAAGAAACCGCGGGTAGCGTTATCAACTTCGCGAGCGGCGCGGGTATCGGTGGTAACCCAGGTCAGTCTAGCTACGCGGCGGCGAAAGAAGGCATCCGTGGCATGAGCCGTGTTGCGGCGTCTGAATGGGGCCCGGATAACATCAACGTTAACATCGTTTGCCCGATCGTTATGACC AAAGCGCTGGAAGAATGGCGTGAACGTGAACCGGAAATGTACGAGAAAAACGTTAAAGCTATCCCGCTGGGCCGTTTCGGTGATGCGGAAAAAGATGTTGGCCGTGTTTGCGTTTTCCTGGCGAGCCCGGATGCGAGCTTCGTTACCGGTGATACCATCATGGTTCAGGGCGGTAGCGGCATGAAACCGTAA

[0054] Based on the open reading frame of 12α-HSDH, upstream and downstream primers were designed:

[0055] Upstream primer: 5'-GA CATATG AGAAGAAGTTCGTGCGGC-3' (SEQ ID NO: 2)

[0056] Downstream primer: 5'-CG CTCGAG CGTAGCTAGACTGACCTG-3' (SEQ ID NO: 3)

[0057] The underlined sequence in the upstream primer is the NdeI restriction site, and the underlined sequence in the downstream primer is the XhoI restriction site.

[0058] Overlap PCR was used to assemble single-stranded primers into a double-stranded gene fragment. The target gene fragment and the empty pET-22b(+) plasmid were then digested with restriction endonucleases NdeI and XhoI for 4 hours. After purification by agarose gel electrophoresis and recovery using a DNA kit, the fragments were ligated at 4°C for 12 hours using T4 DNA ligase to obtain recombinant pET-22b(+)-12α-HSDH.

[0059] (2) Transformation with recombinant vector: E. coli competent DH5α cells were incubated on ice for 5 minutes, then 50 ng of the recombinant pET-22b(+)-12α-HSDH was added. After gentle shaking, the cells were incubated on ice for 20 minutes, followed by heat shock transformation at 42°C for 2 minutes. The transformed competent cells were plated on LB agar plates containing 60 μg / mL ampicillin and cultured at 37°C for 16 hours. Colony PCR was performed to verify the growth of the colonies, and positive clones with successfully amplified target bands were picked. After sequencing verification, the plasmid was extracted and further transformed into E. coli BL21(DE3) to form the recombinant expression transformant E. coli BL21(DE3) / pET-22b(+)-12α-HSDH.

[0060] (3) Induction of expression: The recombinant expression transformant E. coli BL21(DE3) / pET-22b(+)-12α-HSDH was inoculated into LB medium containing 60 μg / mL ampicillin and cultured at 37℃ and 220 rpm until the OD600 reached 0.8-1.0. Then, 1% (v / v) was inoculated into a flask containing 1 L of LB medium (60 μg / mL ampicillin) and placed in a shaker and cultured at 37℃ and 180 rpm. When the OD600 of the culture medium reached 0.6, isopropyl-β-D-thiogalactoside (IPTG) was added to a final concentration of 0.2 mmol / L for induction. After induction at 16℃ for 24 hours, the culture medium was centrifuged at 8000 rpm and the cell pellet was collected.

[0061] (4) Protein purification: The cell pellet was resuspended in lysis buffer (50 mM Tris-HCl, 100 mM NaCl, 2 mM EDTA, 0.1% Triton X-100, pH 8.0), and sonicated in an ice-water bath. The supernatant was collected by centrifugation, which was the crude enzyme solution of recombinant 12α-HSDH. The obtained crude enzyme solution was analyzed by polyacrylamide gel electrophoresis, and the recombinant 12α-HSDH was found to be in a soluble form. The obtained crude enzyme solution of recombinant 12α-HSDH was freeze-dried to obtain crude enzyme powder with a specific activity of 20 U / mg. The target protein was then purified using a Ni-NTA agarose column. The purified protein was detected by SDS-PAGE and analyzed by [missing information - likely a specific method or method]. UltraCen centrifugal filter (Millipore, Watford, UK) for concentration.

[0062] Kinetic analysis: In 0.1 M phosphate buffer (pH 8.0), 50 μg / mL of 12α-HSDH solution and 1 mM NAD were used. + Kinetic analysis was performed on four different 12HBAs (cholic acid CA, deoxycholic acid DCA, taurocholic acid TCA, and glycocholic acid GCA) at different concentrations. The reaction was monitored spectrophotometrically, and the formation of NADH was measured continuously for 2 minutes at a wavelength of 340 nm.

[0063] like Figure 1 As shown, the dynamic parameters are fitted using the Michaelis-Menten equation with nonlinear regression.

[0064] The dynamic parameters are statistically analyzed as follows:

[0065]

[0066] The above parameters indicate that 12α-HSDH exhibits high reaction efficiency (KL) in the in vitro catalysis of 12HBAs. m=49.22±1.55μM to 74.98±2.16μM; k cat =28.86±2.29s -1 up to 35.88±1.68s -1 ).

[0067] II. Development of a 12α-HSDH-driven LC-MS method for identifying 12HBA and non-12HBA

[0068] (1) Preparation of standards: The reaction substrate is a mixture of 31 BAs. The following standards were accurately weighed: 13 types of 12HBAs (cholic acid CA, deoxycholic acid DCA, glycocholic acid GCA, glycodeoxycholic acid GDCA, taurocholic acid TCA, taurodeoxycholic acid TDCA, nordeoxycholic acid NDCA, isodeoxycholic acid IsoDCA, β-cholic acid βCA, ursodeoxycholic acid UCA, allocholic acid AlloCA, 3-ketodeoxycholic acid 3-ketoDCA, 7-ketodeoxycholic acid 7-ketoDCA) and 18 types of non-12HBAs (chenodeoxycholic acid CDCA, ursodeoxycholic acid UDCA, lithocholic acid LCA). Glycine-chenodeoxycholic acid (GCDCA), glycoursodeoxycholic acid (GUDCA), glycolithocholic acid (GLCA), taurololithocholic acid (TLCA), taurolsodeoxycholic acid (TCDCA), taurolsodeoxycholic acid (TUDCA), 12-ketolithocholic acid (12-ketoLCA), 7-ketolithocholic acid (7-ketoLCA), porcine deoxycholic acid (HDCA), glycoursodeoxycholic acid (GHDCA), taurolsodeoxycholic acid (THDCA), epideoxycholic acid (EpiDCA), dehydrocholic acid (DHCA), primary bile acid (αMCA), and β-mouse bile acid (βMCA) were dissolved in methanol to prepare a single-standard stock solution with a mass concentration of 1 mg / mL. Equal volumes of the single-standard stock solution were added to the same centrifuge tube and vortexed to obtain a mixed stock solution.

[0069] (2) 12α-HSDH enzyme treatment: Take 50 μL of the mixed stock solution prepared in step 1 as samples a and b. Sample b contains 125 μL of 12α-HSDH (10 mg / mL) and 50 μL of NAD. + The mixture was then diluted to 500 μL with potassium dihydrogen phosphate buffer (100 mM, pH 8). Sample a, which was used as a negative control, was free of 12α-HSDH. The reaction mixture was reacted at 40 °C for 12 h, and the resulting solution was extracted twice with twice the volume of ethyl acetate to remove salts and enzymes. The extracts were dried under nitrogen. The final residue was redissolved in 100 μL of 50% methanol and analyzed by LC-MS.

[0070] (3) 12α-HSDH-assisted LC-MS data acquisition: Under preset detection conditions, chromatographic and mass spectrometric analyses were performed on samples a and b to obtain the detection results.

[0071] Preferred chromatographic conditions: Column: Waters ACQUITY C18 column (2.1 × 100 mm, 1.7 μm); Mobile phase composition: water (A) and acetonitrile (B) containing 0.1% formic acid; Linear gradient elution conditions for mobile phase B: 5% (0.0–0.5 min), 5%–35% (0.5–2.0 min), 35%–65% (2.0–35.0 min), 65%–100% (35.0–36.0 min), 100% (36.0–44.0 min), 100%–5% (44.0–45.0 min), followed by a residence time of 5% for 5.0 min. Flow rate was set at 0.2 mL / min, column temperature at 35 °C, and injection volume at 2 μL.

[0072] Mass spectrometry conditions: In electrospray ionization (ESI) mode, a DDA-MS acquisition period of 874 ms was used, including MS1 accumulation time (100 ms, mass scan range 150-800 Da) and MS2 accumulation time (50 ms, mass scan range 50-800 Da). The ion source was operated in negative ion mode with the following settings: Ion spray voltage float (ISVF) -4500 V, ion source gas 1 (GS1) 55 psi, ion source gas 2 (GS2) 55 psi, curtain gas (CUR) 40 psi, ESI ion source temperature 550 °C, removal potential (DP) -90 V, collision energy (CE) -45 ± 15 V.

[0073] (4) 12α-HSDH-assisted LC-MS data analysis: After filtering noise and isotope peaks from the raw MS data of samples a and b, peak detection and matching were performed. Precise m / z, RT, and peak area were derived from the detected peaks. The chromatographic peaks were then normalized using the internal standard CA-D4 to calibrate the MS signal drift. The peak areas of samples a and b were aligned, and paired peaks were generated based on a retention time (RT) tolerance of 0.5 minutes. In principle, A... b (Peak area of ​​sample b) and A a The ratio of (peak area of ​​sample a) reflects the remaining amount after the reaction of 12HBA and 12α-HSDH, and correspondingly, (1-A b / A a The %) value represents the conversion rate of 12 HBA.

[0074] Finally, screening criteria for 12HBAs were established based on the conversion rate of the standard.

[0075] In addition, to exclude interfering molecules, candidate molecules were selected based on the following criteria: i) peak molecular weight in the range of 300-800 m / z based on the steroid nucleus and possible conjugation; ii) RT of 5-40 minutes.

[0076] Figure 2 Ion chromatograms of 31 BAs in two samples are described. Compared with sample a, the intensity of 12HBAs in sample b is significantly reduced, while the intensity of non-12HBAs remains almost unchanged.

[0077] like Figure 3 As shown, based on the average conversion results of the three parallel samples, (1-A) is obtained. b / A a All paired peaks with values ​​between 60% and 100% were 12 HBAs.

[0078] III. Verification of the reliability of 12α-HSDH-driven LC-MS recognition of 12HBAs in mouse serum matrix

[0079] a. Collection and preparation of mouse serum samples: Eight-week-old female C57BL / 6 mice (18-20 g, n=6) were purchased from the Experimental Animal Center of Yangzhou University. Serum samples were collected and stored at -80℃ immediately until analysis. 100 μL of serum was mixed with ice-cold methanol and stored at -20℃ for 12 hours to precipitate proteins. The mixture was centrifuged at 13,000 g and 4℃ for 15 minutes, and the supernatant was collected and dried under liquid nitrogen.

[0080] b. The 12α-HSDH enzyme treatment and data acquisition process is the same as in step two.

[0081] c. Using a 12α-HSDH-driven LC-MS method, with a conversion rate of 60% as the standard, 48 potential 12HBAs candidates were screened from mouse serum matrix.

[0082] Two validation principles were employed to verify these candidates: i) for free BAs, validation was performed using standards and characteristic fragments; ii) for conjugated BAs, validation was performed using standards. Taking free trihydroxy BAs with a mass-to-charge ratio of 407.2797 as an example, 22 peaks with a mass-to-charge ratio of 407.2797 were extracted from mouse serum samples. Figure 4 Among them, peaks 1, 4, 6-8, 11, and 17-21 (1-A) b / A a Values ​​above 60% are classified as 12HBAs.

[0083] The secondary mass spectra of peak 1 (conversion rate 87%) and peak 19 (conversion rate 94%) are shown below. Figure 5 As shown, [MH-CO2]- Or [MH-H2O-CH2O2] - These are their main fragments, which is consistent with the fragmentation pattern produced by free 12HBAs. Figure 6 Conversely, non-12HBAs do not exhibit this fragmentation mechanism; for example, peak 12 was verified by standards to be αMCA (3α,6β,7α-hydroxy). Figure 7 ).

[0084] The detailed classification and results of the 22 peaks with a mass-to-charge ratio of 407.2797 are as follows:

[0085]

[0086] As mentioned earlier, the unique fragmentation pattern only appears in free 12HBAs, while for conjugated 12HBAs, amide modification of the 24-carboxyl group hinders the effect fragmentation of the 12-hydroxyl group.

[0087] Application Example 1: Constructing a multidimensional BAs spectrum using a 12α-HSDH-driven LC-MS method

[0088] a. Quality control sample collection: i) Human samples: Serum, urine, and feces were collected from 8 healthy volunteers at Nanjing Maternal and Child Health Hospital. ii) Rat and mouse samples: 8-week-old female C57BL / 6 mice (18-20 g, n=6) and 6-week-old female Wistar rats (200-220 g, n=6) were purchased from the Experimental Animal Center of Yangzhou University. Liver, serum, cecal contents, ileal contents, bile, feces, and urine samples were then collected and immediately stored at -80°C until analysis.

[0089] b. Quality control sample preparation: i) Serum (100 μL) was mixed with 500 μL of ice-cold methanol and stored at -20°C for 12 hours to precipitate proteins. The mixture was then centrifuged at 13,000 g for 15 minutes at 4°C, and 500 μL of supernatant was collected; ii) Liver (100 mg), lung (100 mg), cecum (50 mg), ileum (50 mg), and feces (50 mg) were homogenized in 1 mL of ice-cold methanol, vortexed, and centrifuged at 13,000 g for 10 minutes to obtain 800 μL of supernatant; iii) Urine (50 μL) and bile (10 μL) were diluted with 1 mL of deionized water and then desalted using a Sep-Pak C18 SPE filter cartridge (Waters, Milford, USA). After pretreatment, the solid-phase extraction column was washed with 1 mL of H2O, followed by elution with 2 mL of methanol, and 2 mL of eluent was collected. Finally, all supernatants were dried with nitrogen and redissolved in 100 μL of methanol and centrifuged at 13,000 g for 15 minutes at 4 °C; iv) Matrix collection: Equal volumes of the extracts from each of the above samples were collected as quality control samples.

[0090] c.12 α-HSDH enzyme treatment and data acquisition steps are the same as step two in Example 1.

[0091] The d.12α-HSDH-driven LC-MS method adds a new annotation dimension by distinguishing between 12HBAs and non-12HBAs, thereby supporting the construction of more refined BA maps.

[0092] To cover as many bioassays as possible, we used a cross-species mixed biomatrix as quality control samples. Utilizing a theoretical database containing 2,450 bioassays, we initially matched 474 candidate bioassays. Among these candidates, 162 12HBAs were identified with (1-Ab / Aa)% values ​​≥60%. Furthermore, using the non-targeted screening function of 12α-HSDH-assisted LC-MS, we further extracted 48 12HBAs candidate compounds.

[0093] Application Example 2: Multidimensional BAs spectrum applied to the diagnosis of BAs in asthmatic mice.

[0094] a. Establishment of an asthma mouse model: An asthma model was induced in 24 female C57BL / 6 mice using HDM (house dust mite, Greer Laboratory, UK). Days 0, 3, and 5 were the sensitization phases, and days 10, 12, and 14 were the challenge phases. Mice were first anesthetized with sodium pentobarbital (50 mg / kg), and then 50 μL of HDM solution (0.2 mg / mL) was instilled into the airway. Mice were sacrificed on day 16, and serum, feces, liver, bronchoalveolar lavage fluid (BALF), and lung tissue samples were collected and stored at -80°C.

[0095] like Figure 8 As shown, pathological analysis of lung tissue revealed significant alveolar damage, a small number of goblet cells proliferating, and extensive inflammatory cell infiltration around the bronchi in asthmatic mice.

[0096] Furthermore, asthmatic mice exhibited a Th2-type allergic inflammatory phenotype, characterized by an increased proportion of eosinophils and a decrease in macrophages. Figure 9 ).

[0097] Compared with the control group, asthmatic mice had higher IgE levels and more significant IL-4 release in their serum; correspondingly, the mRNA expression of IL-4, IL-5, and IL-13 in the lung tissue of asthmatic mice was also significantly increased (p<0.05). Figure 10 ).

[0098] The above results indicate that the asthma mouse model has been successfully established.

[0099] b. Sample preparation and BAs detection: The sample preparation steps for serum, liver, lung, and feces from mice in the control group and asthma model group were the same as step b in Application Example 1. The prepared samples were directly analyzed by LC-MS, and the data acquisition steps were the same as step two in Example 1.

[0100] c. The BAs profile established in this application was directly applied to BAs annotation in asthmatic mice to detect changes in BAs. Compared with normal mice, the ratio of 12HBAs / non-12HBAs in the serum of model mice was significantly increased ( Figure 11 ).

[0101] Similar to the serum trend, the ratio of 12HBAs / non-12HBAs was upregulated in the liver, lungs, and feces of asthmatic mice. Based on this, we further examined the mRNA expression of BA synthases in liver tissue. BAs are mainly synthesized in the liver via two pathways. The classical or neutral pathway involves the 7α-hydroxylation of cholesterol catalyzed by Cyp7a1, followed by further transformation of the steroid nucleus and oxidative cleavage of the side chain catalyzed by Cyp8b1. BAs produced via this pathway account for approximately 75% of total bile acids. The other pathway is the alternative pathway, also known as the acidic pathway, which involves the 27-hydroxylation of cholesterol catalyzed by Cyp27a1. This reaction is further catalyzed by 7α-hydroxylase (Cyp7b1). The alternative pathway produces non-12HBAs, primarily CDCA. In other words, Cyp7a1 and Cyp8b1 are key enzymes involved in 12HBAs synthesis, while Cyp27a1 and Cyp7b1 are responsible for the production of non-12HBAs.

[0102] Cyp8b1 mRNA expression was elevated in asthmatic mice, while Cyp7b1 was downregulated. Figure 12 This indicates that changes in the ratio of 12HBAs to non-12HBAs are closely related to asthma status. Subsequently, differential markers of BAs in the serum of mice in the control group and the asthma model group were screened. A t-test was used to identify 28 differentially expressed BAs with p-values ​​<0.05, as shown below:

[0103]

[0104]

[0105] Seventeen non-12HBAs and eleven 12HBAs significantly affected the ratio of 12HBAs to non-12HBAs. Therefore, this invention, from a holistic perspective, integrates these 28 indicators into a multivariate discriminant index for asthma (BAs) for the diagnosis and treatment of asthma.

[0106] The above description is merely an embodiment of the present invention and does not limit the patent scope of the present invention. Any equivalent structural or procedural transformations made based on the content of the present invention's specification and drawings, or direct or indirect applications in other related technical fields, are similarly included within the patent protection scope of the present invention.

Claims

1. An enzyme-assisted liquid chromatography-mass spectrometry (LC-MS) method for detecting 12α-hydroxybile acids, characterized in that, This method is based on 12α-HSDH encoded by the slow-moving Egerte strain DSM 2243, and the 12α-HSDH gene sequence is codon optimized. The optimized 12α-HSDH specifically catalyzes the dehydrogenation reaction of 12HBAs in vitro. The nucleotide sequence of the optimized full-length 12α-HSDH gene is shown in SEQ ID No:

1. The specific testing process is as follows: (1) Two identical bile acid samples a and b were used. 12α-HSDH solution and cofactor NAD+ were added to sample b, while 12α-HSDH was not added to sample a, which was used as a negative control. The reaction was carried out in potassium dihydrogen phosphate buffer or Tris-HCl buffer with a pH of 6-10. (2) Ethyl acetate was added to the reaction mixture for liquid extraction. After standing and layering, the organic layer was transferred out, dried, and the residue was redissolved in the internal standard solution. After centrifugation, the supernatant was entered into the instrument for analysis. (3) The supernatant was separated and detected by ultra-high performance liquid chromatography-tandem mass spectrometry: the samples a and b prepared in step (1) were separated by high performance liquid chromatography, and the mass-to-charge ratio of BAs in samples a and b was detected by mass spectrometry. (4) The data collected in step (3) are quantified relative to the isotope internal standard to obtain the peak area A of BAs in samples a and b. The conversion rate of BAs is defined as (1-A). b / A a )%, of which A b For sample b, the peak area, A a Let (1-A) be the peak area of ​​sample a. b / A a Paired peaks with values ​​between 60% and 100% are 12HBAs. Conversion indicators for 12α-hydroxycholesterol acids are established using BAs standards.

2. The enzyme-assisted liquid chromatography-mass spectrometry (LC-MS) detection method for recognizing 12α-hydroxybile acids as described in claim 1, characterized in that, In step (1), the reaction is carried out at 30-50°C for 6-24 hours.

3. The enzyme-assisted liquid chromatography-mass spectrometry (LC-MS) detection method for recognizing 12α-hydroxybile acids as described in claim 1, characterized in that, In step (2), the volume ratio of the reaction mixture to ethyl acetate is 1:1 to 4.

4. The enzyme-assisted liquid chromatography-mass spectrometry (LC-MS) detection method for recognizing 12α-hydroxybile acids as described in claim 1, characterized in that, In step (3), the high performance liquid chromatography (HPLC) conditions were as follows: column: Waters ACQUITY C18 column, 2.1 × 100 mm, 1.7 μm; mobile phase composition: water (A) containing 0.1% formic acid and acetonitrile (B); the linear gradient elution conditions for mobile phase B were as follows: 0.0-0.5 min, mobile phase B was 5%; 0.5-2.0 min, mobile phase B increased from 5% to 35%; 2.0-35.0 min, mobile phase B increased from 35% to 65%; 35.0-36.0 min, mobile phase B increased from 65% to 100%; 36.0-44.0 min, mobile phase B was 100%; 44.0-45.0 min, mobile phase B decreased from 100% to 5%; then the column was held at 5% for 5.0 min, the flow rate was set to 0.2 mL / min, the column temperature was 35℃, and the injection volume was 2 μL.

5. The enzyme-assisted liquid chromatography-mass spectrometry (LC-MS) detection method for recognizing 12α-hydroxybile acids as described in claim 1, characterized in that, In step (3), the mass spectrometry conditions are as follows: in electrospray ionization (ESI) mode, the DDA-MS acquisition period is 874 ms, including MS1 accumulation time of 100 ms and mass scan range of 150-800 Da; MS2 accumulation time of 50 ms and mass scan range of 50-800 Da. The ion source is operated in negative ion mode and is set as follows: Ion spray voltage float (ISVF) -4500V, ion source gas 1 (GS1) 55 psi, ion source gas 2 (GS2) 55 psi, curtain gas (CUR) 40 psi, electrospray ion source temperature 550℃, impurity removal potential (DP) -90 V, collision energy (CE) -45±15 V.

6. The enzyme-assisted liquid chromatography-mass spectrometry (LC-MS) detection method for recognizing 12α-hydroxybile acids as described in claim 1, characterized in that, The codon-optimized full-length 12α-HSDH gene was expressed and purified to obtain the target protein. The expression and purification process is as follows: 1) The gene shown in SEQ ID NO. 1 was cloned into an expression vector with an N-terminal 6×His tag to obtain a recombinant plasmid; 2) The recombinant plasmid was transformed into E. coli BL21(DE3) cells to obtain the recombinant expression transformant; 3) Induce expression of the recombinant expression transformant obtained in step 2) in the E. coli system; 4) Purify the target protein using a Ni-NTA agarose column.

7. The enzyme-assisted liquid chromatography-mass spectrometry (LC-MS) detection method for recognizing 12α-hydroxybile acids as described in claim 6, characterized in that, In step (1), the expression vector is the pET-22b(+) plasmid vector.

Images