Application of HDAC2 in Inhibitors of Porcine Reproductive and Respiratory Syndrome Virus
Patent Information
- Application Number
- CN202410245404.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-03-05
- Publication Date
- 2026-09-01
- Estimated Expiration
- 2044-03-05
AI Technical Summary
然而,由于PRRSV的高度抗原异质性,目前疫苗的使用有一些局限性
Smart Images

Figure HDA0004725703130000011 
Figure HDA0004725703130000012 
Figure HDA0004725703130000021
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of biomedicine and viral infection, specifically relating to the application of HDAC2 in the inhibitor of Nsp11 endonuclease-dependent porcine reproductive and respiratory syndrome virus. Background Technology
[0002] Porcine reproductive and respiratory syndrome virus (PRRSV) is an enveloped, single-stranded, positive-sense RNA virus belonging to the family Arteriviridae in the order Tudorvirales. It is a spherical, single-stranded, positive-sense RNA virus with an enveloped viral particle. The PRRSV genome is approximately 15 kb in length, containing more than 10 open reading frames (ORFs) encoding at least 12 non-structural proteins, including NSP1α, NSP1β, and NSP2, and 8 structural proteins, including GP5, M, and N, involved in viral replication and transcription. These structural proteins interact with specific cytokines within host cells, mediating PRRSV invasion of susceptible cells. PRRSV is the pathogen of porcine reproductive and respiratory syndrome (PRRS), characterized by reproductive failure in sows and severe respiratory symptoms in piglets and growing pigs. PRRS was first reported in the United States in 1987 and first discovered in Europe in 1990. Since then, the disease has spread to most pig-producing countries and has become an economically devastating disease in the global pig industry. Researchers have developed various vaccines to control this disease. However, due to the high antigenic heterogeneity of PRRSV, the use of current vaccines has some limitations. Therefore, understanding the interaction between PRRSV and the host can not only elucidate the infection process of the virus in host cells, but also help to discover antiviral factors and reveal related antiviral mechanisms, providing new prevention and control strategies for the spread of the virus.
[0003] The first line of defense against viral invasion is the host's innate immune system, which produces interferon (IFN) and various other cytokines. However, PRRSV has evolved sophisticated immune evasion strategies to establish infection. At least six PRRSV-encoded proteins, including nsp1α, nsp1β, nsp2, nsp4, nsp11, and N protein, have been shown to antagonize IFN production and signal transduction. In addition to acting as IFN antagonists, some PRRSV-encoded proteins can also promote viral infection by targeting host infection-limiting factors. For example, nsp4 cleaves ZC3HAV1 / ZAP and DCP1A to reduce their antagonistic activity against PRRSV; nsp3 inhibits its anti-PRRSV effect by degrading IFITM1 via the proteasome pathway; and the E protein degrades the host restriction factor porcine CH25H protein by inducing CH25H ubiquitination and DDX10 autophagy in a SQSTM1-dependent manner. Therefore, screening for new antiviral factors and elucidating the interaction between host antiviral factors and PRRSV is of great significance for the development of anti-PRRSV drugs.
[0004] Histone deacetylases (HDACs) are a family of host enzymes that catalyze the deacetylation of acetylated proteins. Acetylation is one of the most common post-translational modifications of proteins. It is present in various nuclear and cytoplasmic proteins and plays a crucial role in regulating gene expression, cell cycle, signal transduction, and innate immune responses. Acetylation and deacetylation are reversible processes controlled by histone acetyltransferases (HATs) and HDACs, respectively, and affect various host cellular processes, such as cell cycle, gene expression, signal transduction, and innate immune responses. However, there are currently no reports on the relationship between HDAC2 and PRRSV infection.
[0005] The non-structural proteins of PRRSV are encoded by the open reading frame ORF1, including ORF1a and ORF1b, which encode the polyproteins pppa and pplab, respectively. pppa cleaves into nine non-structural proteins: NSP1a, NSP1β, and NSP2-NSP8. Ppplab cleaves into four non-structural proteins: NSP9, NSP10, NSP11, and NSP12. These non-structural proteins play important roles in viral genome replication, transcription, and interferon antagonism. NSP11 possesses ribonuclease activity and is essential for viral genome replication and subgenome synthesis. Studies have shown that overexpression of NSP11 can increase PRRSV titers and has functions such as suppressing the innate immune system of infected hosts. The endogenous protein encoded by the host p21 gene can inhibit PRRSV replication. After PRRSV infection, NSP11 can induce p21 degradation and promote viral replication in MARC-145 cells. After PRRSV infection, NSP11 is recognized and inhibited by host cell interferon regulatory factor 9 (IRF9), while activating the transcription factor complex IFN-stimulated gene factor 3 (ISGF3) formation and nuclear translocation, thereby blocking IFN-I signaling to antagonize the host's innate antiviral response. Further studies have shown that PRRSV nsp11 is an IFN antagonist that participates in inhibiting IFN production through different mechanisms, such as (I) nsp11 inhibits the transcription of type I IFNs by inhibiting the activation of transcription factors IRF3 and NF-κB, which directly activate the promoters of type I IFNs; (II) nsp11 removes the ubiquitin chain of IκBα, thereby inhibiting NF-κB activation; (III) nsp11 enhances its removal of NE targets by recruiting linear linkage specificity (OTULIN) through non-enzymatic combination. MO's ability to linearly ubiquitinate, thereby producing an additive effect that inhibits the production of type I IFN; (IV) nsp11 targets IRF9 to antagonize type I IFN signaling through the NendoU activity mechanism; (V) nsp11 mediates the degradation of cholesterol-25 hydroxylase (CH25H) through the lysosomal pathway; (VI) nsp11 reduces the transcript and protein levels of MAVS, RIG-I and ISG15; (VII) nsp11 can antagonize the antiviral activity of PCSK9 through endonuclease activity.
[0006] By studying the expression of HDAC2 protein, we can further investigate the mechanism of HDAC2 protein changes in porcine reproductive and respiratory syndrome (PRRS), ultimately identifying the root cause of PRRS virus infection and providing new strategies for the prevention and treatment of PRRS. Summary of the Invention
[0007] This invention investigated the role of histone deacetylase 2 (HDAC2) in PRRSV infection. The results showed that HDAC2 expression was reduced in PRRSV-infected cells. By screening structural and non-structural proteins of PRRSV, the most important virus-encoded protein involved in reducing HDAC2 levels, nsp11, was identified. Mutation analysis of PRRSV nsp11 indicated that nsp11 endonuclease activity is crucial for antagonizing the antiviral effect of HDAC2. Based on these findings, this invention was completed.
[0008] In a first aspect, the present invention provides the use of the histone deacetylase (HDAC2) gene or its expression product in the preparation of antiviral drugs.
[0009] Furthermore, the virus is an NSP11 endonuclease-dependent virus.
[0010] Furthermore, the virus is preferably from the Arteriviridae family.
[0011] Furthermore, the virus in question is porcine reproductive and respiratory syndrome virus (PRRSV).
[0012] In a second aspect, the present invention provides an agent for inhibiting viral replication, said agent containing the histone deacetylase (HDAC2) gene or its expression product.
[0013] The histone deacetylase (HDAC2) activates innate immune antiviral molecules through the type I IFN signaling pathway to inhibit viral replication.
[0014] Furthermore, the virus is an NSP11 endonuclease-dependent virus.
[0015] Furthermore, the virus is preferably from the Arteriviridae family.
[0016] Furthermore, the virus in question is porcine reproductive and respiratory syndrome virus (PRRSV).
[0017] Thirdly, the present invention provides the use of histone deacetylase (HDAC2) gene or its expression product in the preparation of antiviral antagonists.
[0018] Among them, the antiviral response of histone deacetylase (HDAC2) is achieved by reducing or inactivating the activity of NSP11 endonuclease.
[0019] Furthermore, the methods for reducing or inactivating NSP11 endonuclease activity include, but are not limited to, mutations in catalytic residues and / or active sites.
[0020] Furthermore, the catalytic residue may be His129, His144, and / or Lys173.
[0021] Furthermore, the active site is preferably the DUB active site (Cys112).
[0022] In one embodiment, the reduction or inactivation of the NSP11 endonuclease activity is achieved by constructing a mutant through mutation of the corresponding residue site to alanine.
[0023] Furthermore, the mutant is preferably H112A, H129A, H144A or K173A.
[0024] Furthermore, the sequences of the mutants H112A, H129A, H144A and K173A are shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4.
[0025] Fourthly, the present invention provides a method for screening candidate drugs that combat viral infections by promoting histone deacetylase (HDAC2) activity, wherein the virus is an arteriviridae virus, and the method includes:
[0026] (A) Treating infected cells, tissues or animals with the candidate substance, or treating cells, tissues or animals with the candidate substance and then infecting the cells, tissues or animals with a virus;
[0027] (B) Detect the level or activity of histone deacetylase (HDAC2) in the cells, tissues, or animals described; and
[0028] (C) If the detected level or activity of histone deacetylase (HDAC2) is higher than the level or activity of histone deacetylase (HDAC2) before treatment with the candidate substance or higher than the level or activity of histone deacetylase (HDAC2) in the normal control and the viral infection of the cells, tissues or animals is controlled or inhibited, then the candidate substance is a candidate drug for antiviral infection by promoting histone deacetylase (HDAC2).
[0029] The method described herein is not a method for diagnosing or treating diseases.
[0030] Furthermore, the virus is an NSP11 endonuclease-dependent virus.
[0031] Furthermore, the virus is porcine reproductive and respiratory syndrome virus (PRRSV).
[0032] Fifthly, the present invention provides an antagonist, wherein the antagonist is a gene containing the NSP11 endonuclease or its expression product.
[0033] The antagonist antagonizes the antiviral response that depends on the NSP11 endonuclease activity by downregulating the expression of the HDAC2 protein.
[0034] Furthermore, the virus is preferably from the Arteriviridae family.
[0035] Furthermore, the virus is porcine reproductive and respiratory syndrome virus (PRRSV). Attached Figure Description
[0036] Figure 1 Downregulation of HDAC2 expression due to PRRSV infection (AB) PRRSV infection led to downregulation of HDAC2. PAMs were infected with PRRSV at an MOI of 0.1, and samples were obtained at different time points. HDAC2 mRNA and protein levels were determined by RT-qPCR and Western blotting. Results represent three independent experiments (mean ± SD). *, P < 0.05, **, P < 0.01, ***, P < 0.001. P-values were calculated using the Student t-test.
[0037] Figure 2 HDAC2 overexpression inhibits PRRSV replication. (A) HDAC2 overexpression in PAM cells. Immortalized PAM cells were transduced with a bicistronic lentiviral vector expressing ZsGreen alone (vector control) or HDAC2, as described in Materials and Methods. HDAC2-transduced cells or vector control cells were collected, and lysates were immunoblotted with indicated antibodies. (B) CCK8 assay was used to assess the proliferative capacity of HDAC2-overexpressing PAM cells. (C) PAM cells were infected with PRRSV after transfection with HDAC2 or vector control as described above, and cell samples were collected 24 hours later. PRRSVN protein was detected by Western blotting to determine the PRRSV replication level. (D) PRRSV was inoculated 24 hours after HDAC2 protein overexpression. Viral RNA levels were determined by RT-qPCR 24 hours after PRRSV infection. (E) PRRSV was inoculated 24 hours after HDAC2 overexpression, and viral samples were collected for quantification 24 hours after infection. Viral yield was measured by TCID50. Results represent three independent experiments (mean ± SD). *, P < 0.05, **, P < 0.01, ***, P < 0.001. Calculate the p-value using the Student t-test.
[0038] Figure 3HDAC2 knockdown promotes PRRSV transmission (AB). The targeting of HDAC2 by si-HDAC2 was validated using RT-qPCR (A) and Western blotting (B). (A) HDAC2 (si-HDAC2) and negative control siRNA (siControl) were transfected into PAM cells. Cell samples were collected 24 hours later, and total RNA was extracted for RT-qPCR. (B) PAM cells were transfected with si-HDAC2 or siControl, and the knockdown efficiency of HDAC2 was determined by Western blotting. (CE) Knockdown of endogenous HDAC2 expression promotes PRRSV infection. PAM cells were transfected with si-HDAC2 or siControl for 24 hours and then inoculated with PRRSV. Viral RNA levels were measured by RT-qPCR 24 hours later. (CD) PAM cells were transfected with si-HDAC2 or siControl for 24 hours and then infected with PRRSV. Samples were collected 24 hours later. As shown in the figure, lysed cell samples were subjected to Western blotting. (E) PAMs cells were transfected with si-HDAC2 or siControl for 24 hours, followed by PRRSV infection for 24 hours. Viral yield was determined by TCID50. Results represent three independent experiments (mean ± SD). *, P < 0.05, **, P < 0.01, ***, P < 0.001. P-values were calculated using the Student's t-test.
[0039] Figure 4 To induce HDAC2-induced elevation of ISG expression (AC) in host cells, PAMs cells were transfected with si-HDAC2 or siControl for 24 hours, followed by IFN-α treatment for an additional 12 hours of culture. RNA was then extracted from the harvested cells. The mRNA levels of the antiviral genes ISG15 (A), ISG54 (B), and ISG56 (C) were determined by RT-qPCR using primers listed in Table 1. Results represent three independent experiments (mean ± SD). *, P < 0.05, **, P < 0.01, ***, P < 0.001. P-values were calculated using the Student's t-test.
[0040] Figure 5 To identify the key viral protein PRRSV nsp11 that induces a decrease in HDAC2 in cells, (A) HEK293T cells were co-transfected with the single protein encoded by PRRSV and HDAC2. Cells were collected 36 hours after transfection and assayed using indicated antibodies. (B) Marc-145 cells were co-transfected with HDAC2 and PRRSV nsp11 or an empty vector control, and HDAC2 expression levels were detected by Western blotting.
[0041] Figure 6The reduction of HDAC2 levels by PRRSV is achieved through nsp11-mediated ribonuclease activity, rather than a proteasome-mediated systemic and autophagy mechanism. (A) HEK293T cells were co-transfected with Nsp11 and HDAC2 and treated with the proteasome inhibitor MG132 (2 μM) or the vector control DMSO. Cell lysis samples were collected and subjected to SDS-PAGE and Western blotting. (B) HEK293T cells were co-transfected with Nsp11 and HDAC2 and treated with 3-MA (5 mM). Cells were lysed and Western blotting was performed 36 hours after transfection. (C) Schematic diagram of PRRSV nsp11 and mutants (C112A, H129A, H144A, or K173A). (D) HEK293T cells were co-transfected with HDAC2 and wild-type PRRSV nsp11 and its mutants (C112A, H129A, H144A, and K173A) or an empty vector. Thirty-six hours after transfection, cell samples were collected for Western blotting.
[0042] Figure 7 PRRSV nsp11 antagonizes the antiviral response of HDAC2 in a manner dependent on its endonuclease activity. (AC) Marc-145 cells were co-transfected with HDAC2 and nsp11 and their mutants (C112A, H129A, H144A, or K173A). After 24 hours, Marc-145 cells were infected with PRRSV, and the levels of viral PRRSVN mRNA (A), N protein expression (B), and viral titer (C) were measured. Results represent three independent experiments (mean ± SD). *, P < 0.05, **, P < 0.01, ***, P < 0.001. P-values were calculated using the Student t-test. Detailed Implementation
[0043] The specific embodiments of the present invention will be further described below. It should be noted that these descriptions are for the purpose of aiding understanding the present invention, but do not constitute a limitation thereof. Furthermore, the technical features involved in the embodiments described below can be combined with each other as long as they do not conflict with each other.
[0044] Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, and the experimental materials used in the following embodiments are all available through conventional commercial channels.
[0045] PRRSVnsp11 is a conserved NendoU in the Arteriviridae family, belonging to the XendoU superfamily of multi(U)-specific ribonucleases from Xenopus laevis, and plays an important role in nested virus replication and pathogenesis. It is speculated that the inhibition of HDAC2 protein levels mediated by nsp11 may be related to its ribonuclease activity. PRRSVNsp11 contains three ribonuclease catalytic residues (His129, His144, and Lys173) and one DUB active site (Cys112). The Nsp11 mutants involved in this invention are also based on mutations of the aforementioned catalytic residues and DUB active site.
[0046] Example 1: Materials and Methods
[0047] 1. Cell culture and virus propagation
[0048] Immortalized cell line PAM was cultured in RPMI-1640 medium (Gibco, USA) containing 10% fetal bovine serum (FBS, Hyclone, USA). Marc-145 and HEK-293T cells were maintained in DMEM medium (Gibco, USA) containing 10% FBS. HP-PRRSV strain HuN4 (GenBank ID EF635006) was grown and titrated in Marc145 cells (cells purchased from the ATCC Shanghai Resource Bank).
[0049] 2. Plasmids and antibodies
[0050] The gene coding sequence of the porcine HDAC2 protein was amplified from PAMs cDNA using the primers listed in Table 1, and then cloned into the eukaryotic expression vector pCAGGS with a C-terminal HA tag. Recombinant pCAGGS plasmids containing single PRRSV viral proteins (nsp1α, nsp1β, nsp4, nsp5, nsp7, nsp9-11, ORF2, ORF5, and ORF7) with Flag fusion tags were preserved in our laboratory. PRRSV nsp11 plasmids (C112A, H129A, H144A, and K173A) were mutagenized using a site-directed mutagenesis kit (TakaRa, China). The antibodies used in this study included Santa Cruz's HDAC2 mouse monoclonal antibody (mAb); mouse anti-Flag mAb, mouse anti-HA mAb, and mouse anti-β-actin mAb were purchased from Sigma; the IRDye-conjugated second antibody was purchased from Li-Cor Biosciences; and mouse anti-PRRSVN protein mAb was prepared and purified in our laboratory.
[0051] The mutagenized sequence is shown below:
[0052] C112A(SEQ ID NO.1):
[0053] ATGGGGTCGAGCTCCCCGCTCCCCAAGGTCGCGCATAACTTGGGATTCTATTTCTCACC
[0054] TGATTTGACTCAGTTTGCTAAACTCCCGGCAGAACTTGCACCCCACTGGCCCGTGGTG
[0055] ACAACCCAGAACAATGAAAGGTGGCCAGATCGGCTGGTAGCCAGCCTTCGCCCTATCC
[0056] FATHERGCCGCGCGTGCATTGGTGCCGGCTATATGGTGGGCCCCTCGGTGTTTTTA
[0057] GGCACCCCTGGGGTTGTGTCATACTATCTCACAAAATTTGTTAGAGGCGAGGCTCAAAT
[0058] GCTTCCGGAGACAGTCTTCAGCACTGGCCGAATTGAGGTAGATGCTCGAGAGTATCTT
[0059] GATGATCGGGAGCGAGAAGTTGCTGAGTCCCTCCCACATGCCTTCATCGGCGATGTCA
[0060] AAGGTACCACCGTTGGGGGATGTCATCACGTTACCTCCAAATACCTTCCGCGCTTCCTT
[0061] CCCAAGGAATCAGTTGCGGTGGTCGGGGTTTCGAGCCCCGGGAAAGCCGCGAAAGCA
[0062] GTTTGCACATTGACGGATGTGTACCTCCCAGACCTTGAAGCGTACCTCCACCCAGAGA
[0063] CCCAGTCCAGGTGCTGGAAAGTGATGTTGGACTTTAAAGGAGGTTCGACTGATGGTATG
[0064] GAAGACAAGACGGCTATTTTCAACTTGAA
[0065] H129A(SEQ ID NO.2):
[0066] ATGGGGTCGAGCTCCCCGCTCCCCAAGGTCGCGCATAACTTGGGATTCTATTTCTCACC
[0067] TGATTTGACTCAGTTTGCTAAACTCCCGGCAGAACTTGCACCCCACTGGCCCGTGGTG
[0068] ACAACCCAGAACAATGAAAGGTGGCCAGATCGGCTGGTAGCCAGCCTTCGCCCTATCC
[0069] FATHERGCCGCGCGTGCATTGGTGCCGGCTATATGGTGGGCCCCTCGGTGTTTTTA
[0070] GGCACCCCTGGGGTTGTGTCATACTATCTCACAAAATTTGTTAGAGGCGAGGCTCAAAT
[0071] GCTTCCGGAGACAGTCTTCAGCACTGGCCGAATTGAGGTAGATTGCCGAGAGTATCTT
[0072] GATGATCGGGAGCGAGAAGTTGCTGAGTCCCTCCCAGCTGCCTTCATCGGCGATGTCA
[0073] AAGGTACCACCGTTGGGGGATGTCATCACGTTACCTCCAAATACCTTCCGCGCTTCCTT
[0074] CCCAAGGAATCAGTTGCGGTGGTCGGGGTTTCGAGCCCCGGGAAAGCCGCGAAAGCA
[0075] GTTTGCACATTGACGGATGTGTACCTCCCAGACCTTGAAGCGTACCTCCACCCAGAGA
[0076] CCCAGTCCAGGTGCTGGAAAGTGATGTTGGACTTTAAAGGAGGTTCGACTGATGGTATG
[0077] GAAGACAAGACGGCTATTTTCAACTTGAA
[0078] H144A(SEQ ID NO.3):
[0079] ATGGGGTCGAGCTCCCCGCTCCCCAAGGTCGCGCATAACTTGGGATTCTATTTCTCACC
[0080] TGATTTGACTCAGTTTGCTAAACTCCCGGCAGAACTTGCACCCCACTGGCCCGTGGTG
[0081] ACAACCCAGAACAATGAAAGGTGGCCAGATCGGCTGGTAGCCAGCCTTCGCCCTATCC
[0082] FATHERGCCGCGCGTGCATTGGTGCCGGCTATATGGTGGGCCCCTCGGTGTTTTTA
[0083] GGCACCCCTGGGGTTGTGTCATACTATCTCACAAAATTTGTTAGAGGCGAGGCTCAAAT
[0084] GCTTCCGGAGACAGTCTTCAGCACTGGCCGAATTGAGGTAGATTGCCGAGAGTATCTT
[0085] GATGATCGGGAGCGAGAAGTTGCTGAGTCCCTCCCACATGCCTTCATCGGCGATGTCA
[0086] AAGGTACCACCGTTGGGGGATGTGCTCACGTTACCTCCAAATACCTTCCGCGCTTCCTT
[0087] CCCAAGGAATCAGTTGCGGTGGTCGGGGTTTCGAGCCCCGGGAAAGCCGCGAAAGCA
[0088] GTTTGCACATTGACGGATGTGTACCTCCCAGACCTTGAAGCGTACCTCCACCCAGAGA
[0089] CCCAGTCCAGGTGCTGGAAAGTGATGTTGGACTTTAAAGGAGGTTCGACTGATGGTATG
[0090] GAAGACAAGACGGCTATTTTCAACTTGAA
[0091] H173A(SEQ ID NO.4):
[0092] ATGGGGTCGAGCTCCCCGCTCCCCAAGGTCGCGCATAACTTGGGATTCTATTTCTCACC
[0093] TGATTTGACTCAGTTTGCTAAACTCCCGGCAGAACTTGCACCCCACTGGCCCGTGGTG
[0094] ACAACCCAGAACAATGAAAGGTGGCCAGATCGGCTGGTAGCCAGCCTTCGCCCTATCC
[0095] FATHERGCCGCGCGTGCATTGGTGCCGGCTATATGGTGGGCCCCTCGGTGTTTTTA
[0096] GGCACCCCTGGGGTTGTGTCATACTATCTCACAAAATTTGTTAGAGGCGAGGCTCAAAT
[0097] GCTTCCGGAGACAGTCTTCAGCACTGGCCGAATTGAGGTAGATTGCCGAGAGTATCTT
[0098] GATGATCGGGAGCGAGAAGTTGCTGAGTCCCTCCCACATGCCTTCATCGGCGATGTCA
[0099] AAGGTACCACCGTTGGGGGATGTCATCACGTTACCTCCAAATACCTTCCGCGCTTCCTT
[0100] CCCAAGGAATCAGTTGCGGTGGTCGGGGTTCGAGCCCCGGGAAAGCCGCGGCAGCA
[0101] GTTTGCACATTGACGGATGTGTAACCTCCCAGACCTTGAAGCGTAACCTCCACCCAGAGA
[0102] CCCAGTCCAGGTGCTGGAAAGTGATGTTGGACTTTAAGGAGGTTCGACTGATGGTATG
[0103] GAAAGACAAGACGGCCTATTTTCAACTTGAA
[0104] 3. Viral infection, drug treatment, and cell transfection
[0105] PAMs cell monolayers were infected with the PRRSV strain (isolated and preserved in our laboratory) at a multiple infection rate (MOI) of 0.1% at 37°C for 1 hour. Unbound virus was removed, and cells were maintained in complete culture medium at different time points until samples were collected. The target protein was overexpressed using direct transfection and the bicistronic lentiviral vector pLVX-IRES-ZsGreen1 (purchased from Clontech). Cells were transfected with the specified plasmid using the X-tremGENE transfection reagent according to the manufacturer's instructions (Roche, USA), followed by subsequent assays at specified time points. In some transfection assays, cell samples were treated with different concentrations of the proteasome inhibitor MG132 (Sigma), the autophagy inhibitor 3-methyladenine (3-MA, Sigma), or the vector control DMSO.
[0106] 4. RNA interference assay
[0107] Small interfering RNA (siRNA) targeting the porcine HDAC2 gene was designed and synthesized at Sigma. Cells were transfected with a 60 nM HDAC2-specific (siRNA) or negative control (siControl) duplex and transfected into target cells for 24 hours according to the manufacturer's instructions using Lipofectamine RNAiMAX reagent (Invitrogen, USA).
[0108] 5. Transfection
[0109] HEK293T cells were transfected with the indicated plasmid using the X-tremGENE transfection reagent, following the manufacturer's instructions (Roche, USA). Thirty-six hours post-transfection, cell samples were collected and lysed in RIPA buffer (Beyotime, China) for Western blot analysis of the target protein.
[0110] 6. Western blot for protein immunoblotting
[0111] Cells were collected and lysed with 1% RIPA solution. The treated sample was lysed in RIPA buffer containing a protease inhibitor (HaiGene, China), separated by SDS-PAGE, and transferred to a PVDF membrane (Merck Millipore, USA). After blocking, the membrane was incubated with a primary antibody, followed by incubation with a suitable IRDye-labeled secondary antibody (Li CorBiosciences, Lincoln, NE). The membrane was scanned using an Odyssey instrument (Li-CorBiosciences) according to the manufacturer's instructions.
[0112] 7. Quantitative reverse transcription polymerase chain reaction (RT-qPCR)
[0113] Total RNA was extracted from cells and RT-qPCR was performed using the specific primers listed in Table 1. Relative gene quantification was performed using the cycle threshold (ΔΔCT) method.
[0114] Table 1 Primers used in this study
[0115] HDAC2-F TTTGGTACCATGGCGTACAGTCAGGGAGGCGG HDAC2-R TTTCTCGAGTCAAGGGTTGCTGAGCTGTTCTGA qHDAC2-F CTTGCCATCCTTGAGTTA qHDAC2-R TTTAGCGTGACCTTTGAC qPRRSV-ORF7-F AGATCATCGCCCAACAAAAAC qPRRSV-ORF7-R GACACAATTGCCGCTCACTA qISG15-F CCTGTTGATGGTGCAAAGCT qISG15-R TGCACATAGGCTTGAGGTCA qISG54-F CATTGACCCTCTGAGGCAAG qISG54-R AGCGTGTCCTATTAGTTCC qISG56-F CATACATTTCCACTATGG qISG56-R TACTCCAGGGCTTCATTCA qβ-actin-F CTTCCTGGGCATGGAGTCC qβ-actin-R GGCGCGATGATCTTGATCTTC
[0116] 8. Determination of TCID50 content
[0117] The collected virus samples were frozen and thawed three times, and clarified by centrifugation at 8000×g for 10 min before titration. TCID50 was measured in Marc-145 cells. In short, cell monolayers were seeded with serial dilutions of each viral stock solution and incubated for 4–5 days before observing cytopathic effects.
[0118] 9. CCK-8 assay
[0119] The cytotoxic effects of HDAC2 overexpression were determined using a CCK-8 assay kit (Dojindo, Japan). In short, immortalized PAM monolayers in 96-well plates were infected with lentivirus. Twenty-four hours after infection, 10 μl of CCK-8 solution was added to each well of the plate, and the plates were incubated at 37°C for another 3 hours. Measurements were then taken at 450 nm using a spectrophotometer.
[0120] 10. Statistical Analysis
[0121] All statistical analyses were performed using GraphPad Prism (GraphPad Software). Data are expressed as ± SD.A. P < 0.05 indicates statistical significance.
[0122] Example 2 Experimental Results
[0123] 1. Analysis of HDAC2 mRNA and protein levels in virus-infected PAM cells
[0124] RT-qPCR results showed that HDAC2 mRNA levels were downregulated in PRRSV-infected PAM cells at different time points (Figure 1A). HDAC2 protein level results also showed that HDAC2 protein levels were downregulated in PRRSV-infected PAM cells. Figure 1 B). Therefore, this experiment shows that PRRSV infection reduces HDAC2 expression.
[0125] 2. Effect of HDAC2 overexpression on PRRSV replication
[0126] To assess the effect of HDAC2 overexpression on PRRSV replication, immortalized PAM cells were transduced with a lentiviral vector expressing porcine HDAC2. Western blotting confirmed the overexpression of HDAC2 in immortalized PAM cells. Figure 2 A), and the results of CCK8 assays showed that HDAC2 overexpression did not affect the proliferation of immortalized PAM (A). Figure 2 B). Following PRRSV infection, Western blotting showed that PRRSV infectivity was suppressed in HDAC2-overexpressing PAM cells compared to parental control cells. Figure 2 C). Consistent with protein levels, RT-qPCR results showed that viral RNA levels were reduced in HDAC2-overexpressing PAM cells. Figure 2 D). Furthermore, TCID50 assays confirmed a decrease in progeny virus titers in HDAC2-overexpressing PAM cells compared to control cells. Figure 2 E). Data indicate that ectopic expression of HDAC2 can inhibit PRRSV replication in PAMs cells.
[0127] 3. The effect of endogenous HDAC2 knockout on PRRSV infection
[0128] Cells were transfected with siRNA targeting the porcine HDAC2 gene (si-HDAC2) and a negative control siRNA (siControl). RT-qPCR and Western blot analysis were performed 24 hours later. The results showed that si-HDAC2 significantly reduced HDAC2 expression levels compared to cells transfected with siControl. Figure 3 (A and B). Therefore, in the following experiments, si-HDAC3 is used to knock down HDAC2.
[0129] Subsequently, 24 hours after siRNA transfection, PAM cells were inoculated with PRRSV for another 24 hours. Compared with the control group, the viral RNA level in si-HDAC2 transfected cells increased ( Figure 3 C). Western blot analysis showed increased PRRSVN protein expression, indicating that HDAC2 knockdown promotes PRRSV proliferation. Figure 3 D). Similarly, compared to the negative control obtained by TCID50 assay, si-HDAC2 knockdown of HDAC2 resulted in a significant increase in viral titer ( Figure 3 E). These results of overexpression and knockout together demonstrate that HDAC2 can significantly inhibit PRRSV replication.
[0130] 4. Research on the molecular mechanism of HDAC2
[0131] Given that HDAC2 can reduce PRRSV infection, its molecular mechanism was further investigated. Target cells were transfected with si-HDAC2 before IFN-α administration, and the transcriptional levels of innate immune antiviral molecules such as ISG15, ISG54, and ISG56 were assessed by RT-qPCR. At 24 hpi, the mRNA levels of these antiviral molecules were significantly downregulated in si-HDAC2-transfected target cells compared to those in siControl-transfected cells. Figure 4 AC), indicating that HDAC2 can positively regulate the conduction of the type I IFN signal.
[0132] 5. The role of PRRSV nsp11 in regulating HDAC2 expression
[0133] To identify which PRRSV viral protein reduces HDAC2 expression, HEK293T cells were co-transfected with HDAC2 and a protein encoded by each PRRSV strain. Thirty-six hours post-transfection, cell samples were collected and lysed to detect HDAC2 expression. Several PRRSV viral proteins, such as nsp1β and nsp11, were involved in reducing HDAC2 expression to varying degrees. Compared to other viral proteins, nsp11 significantly downregulated HDAC2 protein expression. Figure 5A). Experiments have shown that PRRSV nsp11 is a key viral protein that reduces HDAC2.
[0134] To further confirm the nsp11-induced reduction in HDAC2, Marc-145 cells were co-transfected with HDAC2 and PRRSV nsp11, and cells were harvested to assess HDAC2 expression levels by Western blot analysis. PRRSV nsp11-transfected cells induced HDAC2 downregulation (…). Figure 5 B).
[0135] 6. PRRSV nsp11 mechanism for reducing HDAC2
[0136] To determine the possible mechanism by which PRRSVnsp11 reduces HDAC2, we examined the expression level of HDAC2 protein after treating cells with the protease inhibitor MG132. Figure 6 As shown in Figure A, MG132 treatment could not block the downregulation of HDAC2 in HEK293T cells co-transfected with HDAC2 and nsp11, indicating that PRRSV nsp11 is not a proteasome pathway that induces HDAC2 degradation.
[0137] Subsequently, the potential role of the autophagy signaling pathway in nsp11-induced HDAC2 reduction was examined by treating cells with 3-MA. The results showed that in HEK293T cells co-transfected with HDAC2 and nsp11, 3-MA treatment did not inhibit the downregulation of HDAC2. Figure 6 Therefore, PRRSVnsp11-induced downregulation of HDAC2 is not mediated through the ubiquitin-proteasome system and autophagy pathway.
[0138] To determine whether the PRRSV nsp11 endonuclease activity also requires amino acid residues, we mutated the corresponding residue of PRRSV nsp11 to alanine to construct four mutants (C112A, H129A, H144A, and K173A). Figure 6 C). After detecting HDAC2 by Western blotting, HEK293T cells were co-transfected with HDAC2 along with nsp11 or mutants. The results showed that nsp11 and the C112A mutant significantly reduced HDAC2 expression levels after transfection. Conversely, when HEK293T cells were co-transfected with HDAC2 and the remaining mutants (H129A, H144A, and K173A), the reduction in HDAC2 expression was blocked, indicating that the residues of H129, H144, and K173 are crucial for the ribonuclease activity of PRRSV nsp11. Figure 6 D). The ribonuclease (EndoU) activity of PRRSVnsp11 is involved in the reduction of HDAC2.
[0139] 7. PRRSVnsp11 antagonizes the antiviral response of HDAC2 through its endonuclease activity.
[0140] To further investigate whether PRRSV nsp11 antagonizes the antiviral function of HDAC2, Marc-145 cells were co-transfected with HDAC2 and nsp11 or an nsp11 mutant for 24 hours, followed by PRRSV infection. In cells transfected with nsp11 and nsp11-C112A, viral RNA, PRRSVN protein expression levels, and viral titer were significantly increased. In cells transfected with ribonuclease catalytic residue mutants H129A, H144A, or K173A, no increase in viral titer was observed. Figure 7 These results indicate that PRRSV nsp11 antagonizes the antiviral response of HDAC2 through its endonuclease activity to promote PRRSV replication.
Claims
1. The application of a porcine histone deacetylase 2 gene or its expression product in the preparation of a drug against porcine reproductive and respiratory syndrome virus.
2. The application of a porcine histone deacetylase 2 gene or its expression product in the preparation of an anti-porcine reproductive and respiratory syndrome virus antagonist, wherein, The antiviral response is achieved by overexpressing porcine histone deacetylase 2.