Application of recombinant adeno-associated virus rAAV2 / Rec2 as a pancreatic targeting vector

Abstract

This invention relates to the field of biomedical technology, specifically to the application of recombinant adeno-associated virus (rAAV2 / Rec2) as a pancreatic-targeting vector. This invention provides an application of recombinant adeno-associated virus (rAAV2 / Rec2) as a pancreatic-targeting vector in the preparation of pancreatic-targeting drugs. Experiments have demonstrated that recombinant adeno-associated virus (rAAV2 / Rec2) has strong targeting specificity to the pancreas and can be used to treat pancreatic diseases and / or pancreatic-related metabolic diseases.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, specifically to the application of recombinant adeno-associated virus rAAV2 / Rec2 as a pancreatic targeting vector. Background Technology

[0002] Adeno-associated virus (AAV) is a single-stranded DNA virus. Because it is non-pathogenic, can integrate into chromosomes for sustained expression, and can efficiently infect most human cells, AAV has become a valuable tool for gene therapy as a viral vector. AAV, as a vector, possesses advantages such as high safety, low immunogenicity, broad host cell range, strong dispersibility, long in vivo expression duration, and diverse serotypes. It is commonly used in therapies in the fields of neurology and metabolism, primarily for in vivo research, and is considered one of the most promising vectors for gene research and gene therapy.

[0003] Recombinant adeno-associated virus (rAAV) vectors are gene vectors modified from non-pathogenic wild-type AAV. The rAAV used in studies is typically a hybrid viral vector resulting from the AAV2 genome and capsid proteins of different serotypes of AAV. The recombinant virus possesses stable expression and gene integration capabilities for AAV2, while also exhibiting tissue tropism for other serotypes of AAV, demonstrating a certain degree of organ-targeting specificity.

[0004] Pancreatic diseases pose serious health risks. AAV-pan is a recombinant adeno-associated virus vector that can target pancreatic tissue. AAV-pan is modified based on the AAV8 capsid protein. However, AAV-pan not only has good targeting ability for pancreatic tissue but also strong targeting ability for liver tissue. Since the liver tissue is a major organ that produces off-target effects, it is crucial to minimize its targeting effect on liver tissue.

[0005] Non-patent literature: Targeting Visceral Fat by Intraperitoneal Delivery of Novel AAV Serotype Vector Restricting Off-Target Transduction in Liver. (Huang W, Liu X, Queen NJ, Cao L. Mol Ther Methods Clin Dev. 2017 Jun 19; 6:68-78.) and non-patent literature: rAAV-Mediated Gene Delivery to Adipose Tissue. (Huang W, Queen NJ, Cao L., Methods Mol Biol. 2019; 1950:389-405.) disclose an rAAV2 / Rec2 recombinant viral vector, which is a hybrid viral vector produced by the AAV2 type genome and the capsid protein of the AAVRec serotype virus. Existing studies have found that the rAAV2 / Rec2 recombinant viral vector primarily targets white and brown adipose tissue and significantly reduces the transduction of Rec2 serotype in liver tissue. However, the tissue specificity and function of this recombinant viral vector are affected by the administration route and dosage. For example, oral administration leads to preferential transduction in brown adipose tissue, while oral doses below 2 × 10⁻⁶ result in lower transduction in brown adipose tissue. 10 When administered via vg / mouse, this vector does not transduce in the gastrointestinal tract; however, when administered intraperitoneally, it effectively transduces visceral white fat. In existing technologies, this vector is used at doses of 2 × 10⁶ per mouse. 10 Low doses of vg corrected leptin deficiency, obesity, and metabolic syndrome in type 2 diabetic mice. Summary of the Invention

[0006] This invention provides a novel application of recombinant adeno-associated virus (rAAV2 / Rec2). Experiments have demonstrated that rAAV2 / Rec2 exhibits strong targeting specificity to the pancreas and can be used to treat pancreatic diseases and / or pancreatic-related metabolic disorders. Specifically:

[0007] In a first aspect, the present invention provides the application of recombinant adeno-associated virus rAAV2 / Rec2 as a pancreatic-targeting vector in the preparation of pancreatic-targeting drugs.

[0008] Preferably, the pancreas-targeting drug is used to treat pancreatic diseases and / or pancreatic-related metabolic diseases.

[0009] More preferably, the pancreatic disease includes one or more of pancreatic cancer, pancreatitis, pancreatic cysts, or fatty pancreas; more preferably, the pancreatitis includes acute pancreatitis or chronic pancreatitis.

[0010] More preferably, the pancreas-related metabolic disease includes diabetes or metabolic-related fatty liver disease; more preferably, the diabetes includes type I diabetes or type II diabetes.

[0011] Preferably, the administration method of the pancreatic-targeting drug includes intraperitoneal injection.

[0012] Preferably, the viral titer of recombinant adeno-associated virus rAAV2 / Rec2 in the pancreatic-targeting drug is 1×10⁻⁶. 10 -5×10 12 Any value in vg, such as 1×10 10 2×10 10 2.5×10 10 3×10 10 4×10 10 5×10 10 6×10 10 7×10 10 8×10 10 9×10 10 1×10 11 1.67×10 11 2×10 11 2.5×10 11 3×10 11 4×10 11 5×10 11 6×10 11 7×10 11 8×10 11 9×10 11 1×10 12 2×10 12 3×10 12 4×10 12 Or 5×10 12 vg.

[0013] In one specific embodiment of the present invention, the pancreatic-targeting drug includes a recombinant adenovirus rAAV2 / Rec2, wherein the recombinant adenovirus rAAV2 / Rec2 or its genome contains (or carries) a sequence expressing or overexpressing a target gene, and / or, knocking out or knocking down a target gene sequence.

[0014] Preferably, the sequence of the target gene knockout or knockdown contains one or more of the following: materials required by the CRISPR system, materials required for tissue-specific knockout, or interfering RNA.

[0015] Preferably, the interfering RNA includes one or more of siRNA, dsRNA, shRNA, aiRNA, or miRNA.

[0016] In one specific embodiment of the present invention, the pancreatic-targeting drug comprises a recombinant adenovirus rAAV2 / Rec2 carrying a sequence of the Gremlin1 gene knocked out or knocked down.

[0017] Preferably, the target site sequence of the shRNA is SEQ ID NO: 1-3.

[0018] In one specific embodiment of the present invention, the target site sequence of the shRNA is SEQ ID NO: 1.

[0019] Preferably, the recombinant adeno-associated virus rAAV2 / Rec2 comprises the AAV2 genome and the capsid protein of the AAVRec2 serotype. More preferably, the recombinant adeno-associated virus rAAV2 / Rec2 is obtained by transfecting cells with plasmids.

[0020] The plasmids include the AAV2 genome plasmid and the AAVRec2 serotype plasmid (pAAV-Rec2). Preferably, the AAV2 genome plasmid includes the inverted repeat sequence (ITR) of the AAV2 genome and the target sequence.

[0021] Preferably, the recombinant adeno-associated virus rAAV2 / Rec2 is obtained by constructing a three-plasmid packaging system.

[0022] Preferably, the three-plasmid packaging system includes a core plasmid, a serum-type plasmid, and an auxiliary plasmid pHelper.

[0023] Preferably, the core plasmid contains the AAV2 genome (preferably containing an inverted repeat sequence (ITR) of the AAV2 genome), and preferably the core plasmid also contains a target sequence (e.g., a sequence expressing or overexpressing a target gene, and / or a sequence knocking out or knocking down a target gene).

[0024] Preferably, the core plasmid further contains transcriptional regulatory elements. Preferably, the transcriptional regulatory elements include one or more of a promoter, an enhancer, or a WPRE.

[0025] Preferably, the promoter includes the U6 promoter and the CMV promoter.

[0026] Preferably, the enhancer includes a CMV enhancer.

[0027] In one specific embodiment of the present invention, the structure of the core plasmid includes pAAV-U6-target sequence-CMV-EGFP-WPRE, wherein the target sequence can be shRNA, for example, the core plasmid structure is pAAV-U6-shRNA (preferably targeting Gremlin1)-CMV-EGFP-WPRE.

[0028] Preferably, the serotype plasmid pAAV-Rec2 includes the rep gene and the cap gene, wherein the rep gene encodes the replication protein (Rep), which is responsible for replicating the recombinant adeno-associated virus plasmid, and the cap gene encodes the cap protein (Cap), which is responsible for forming a viral capsid that can encapsulate the recombinant adeno-associated virus plasmid DNA.

[0029] Preferably, the helper plasmid pHelper contains genes related to adeno-associated virus that enhance viral replication, assembly, and cell release processes.

[0030] Preferably, the recombinant adeno-associated virus rAAV2 / Rec2 is obtained by transfecting cells with a core plasmid, a serotype plasmid, and a helper plasmid pHelper in a certain ratio, for example, by preparing the core plasmid, the serotype plasmid, and the helper plasmid pHelper in a ratio of (1-5):(1-5):(1-5).

[0031] In one specific embodiment of the present invention, the recombinant adeno-associated virus rAAV2 / Rec2 is prepared by mixing pAAV-U6-shRNA(Gremlin1)-CMV-EGFP-WPRE, serotype plasmid pAAV-Rec2 and helper plasmid pHelper in a ratio of 2:3:4, and then transfecting cells and culturing them.

[0032] In a second aspect, the present invention provides the use of recombinant adeno-associated virus rAAV2 / Rec2 as a pancreatic targeting vector.

[0033] A third aspect of the invention provides a method for treating pancreatic diseases or pancreatic-related diseases, the method comprising administering a pancreatic-targeting drug to a subject in need.

[0034] The pancreatic-targeting drug includes recombinant adeno-associated virus rAAV2 / Rec2, preferably carrying a therapeutic agent known in the art, such as a sequence of knockout or knockdown of the Gremlin1 gene.

[0035] Preferably, the sequence for knocking out or downregulating the Gremlin1 gene is an interfering RNA, such as shRNA. Preferably, the target site sequence of the shRNA is SEQ ID NO: 1-3. In one specific embodiment of the present invention, the target site sequence of the shRNA is SEQ ID NO: 1.

[0036] Preferably, the amount of pancreatic-targeting drug administered to the subject can be 1 × 10⁻⁶. 10 -5×10 12 Any value in vg, such as 1×10 10 2×10 10 2.5×10 10 3×10 10 4×10 10 5×10 10 6×10 10 7×10 10 8×10 10 9×10 10 1×10 11 1.67×10 11 2×10 11 2.5×10 11 3×10 11 4×10 11 5×10 11 6×10 11 7×10 11 8×10 11 9×10 11 1×10 12 2×10 12 3×10 12 4×10 12 Or 5×10 12 vg.

[0037] Preferably, the weight ratio of the active ingredient in the pancreatic-targeting drug is 0.01-99.5% (specifically, 0.01%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 99.5%).

[0038] Preferably, the relevant limitations regarding pancreatic diseases or pancreatic-related diseases are the same as those in the first aspect of the invention.

[0039] The term "treatment" as used in this invention refers to slowing down, interrupting, preventing, controlling, stopping, reducing, mitigating, or reversing a sign, symptom, disorder, condition, or progression or severity of a disease after it has begun to develop, but does not necessarily involve the complete elimination of all disease-related signs, symptoms, conditions, or disorders.

[0040] The "subject" described in this invention can be a human or a non-human mammal, or a cell, tissue, or organ of a human or non-human mammal. The non-human mammal can be a wild animal, a zoo animal, an economically important animal, a pet, a laboratory animal, etc. Preferably, the non-human mammal includes, but is not limited to, pigs, cattle, sheep, horses, donkeys, foxes, raccoon dogs, minks, camels, dogs, cats, rabbits, mice (e.g., rats, mice, guinea pigs, hamsters, gerbils, chinchillas, squirrels), or monkeys, etc.

[0041] The terms “comprising” or “including” in this invention are open-ended descriptions that include the specified ingredients or steps described, as well as other specified ingredients or steps that do not materially affect them.

[0042] The term "and / or" as used in this invention encompasses all combinations of items connected by the term, and should be considered as if each combination had been individually listed herein. For example, "A and / or B" includes "A", "A and B", and "B". As another example, "A, B and / or C" includes "A", "B", "C", "A and B", "A and C", "B and C", and "A and B and C".

[0043] The "metabolic fatty liver disease" described in this invention can also be called non-alcoholic fatty liver disease (NAFLD).

[0044] The beneficial effects of this invention are:

[0045] This invention provides a novel application of recombinant adeno-associated virus rAAV2 / Rec2. Experiments have demonstrated that recombinant adeno-associated virus rAAV2 / Rec2 has strong targeting ability to the pancreas. Furthermore, it has been verified that the recombinant adeno-associated virus rAAV2 / Rec2 not only has strong targeting ability to the pancreas in normal mice and for a short period of time, but also has strong targeting ability in disease model mice (such as NAFLD disease model) and can be sustained for a long period of time. It can be used to treat pancreatic diseases and / or pancreatic-related metabolic diseases. Attached Figure Description

[0046] The embodiments of the present invention will now be described in detail with reference to the accompanying drawings, wherein:

[0047] Figure 1 : The inhibitory effect of rAAV2 / Rec2 carrying three Gremlin1 shRNA targets;

[0048] Figure 2Pancreatic tissues from mice in the normal control group, NC control group, and Gremlin1 group;

[0049] Figure 3 Laser confocal microscopy results of heart, brain, kidney, spleen, lung, muscle tissue, liver, white adipose tissue, and pancreas tissue in healthy mice from the normal control group, NC control group, and Gremlin1 group;

[0050] Figure 4 Pancreatic tissues from mice in the normal control group, NAFLD control group, NAFLD+NC control group, and NAFLD+Gremlin1 group;

[0051] Figure 5 Laser confocal microscopy results of heart, brain, kidney, spleen, lung, muscle tissue, liver, white adipose tissue, and pancreas tissue in NAFLD mice from the normal control group, NC control group, and Gremlin1 group;

[0052] Figure 6 Interference vector spectrum. Detailed Implementation

[0053] To better understand the present invention, it is now further described with reference to the following embodiments and accompanying drawings. The embodiments are for illustrative purposes only and do not limit the invention in any way. In the embodiments, all original reagents and materials are commercially available, and experimental methods not specifically specified are conventional methods and conditions well known in the art, or according to the conditions recommended by the instrument manufacturer.

[0054] The primer synthesis, plasmid construction, virus packaging, and purification involved in this application were all outsourced to Heyuan Biotechnology Co., Ltd.

[0055] Example 1: Construction of a recombinant adeno-associated virus core plasmid with mouse Gremlin1 interference

[0056] Interference target design and primer synthesis: Based on the general principles of Mouse Gremlin1 gene transcript and shRNA design, shRNA targets for the Gremlin1 gene were designed as shown in SEQ ID NO: 1 (CCTTTCAGTCTTGCTCCTTCT), SEQ ID NO: 2 (CTGAAGCGAGATTGGTGCAAA), or SEQ ID NO: 3 (ATCATCAACCGCTTCTGTTAT).

[0057] The primers for synthesizing the shRNA target shown in SEQ ID NO: 1 are as follows:

[0058] Upstream primer: 5'-3'

[0059] ACCGCCTTTCAGTCTTGCTCCTTCTCGAGAGAAGGAGCAAGACTGAAAGGTTTTT TG (SEQ ID NO: 4).

[0060] Downstream primer: 5'-3'

[0061] CTAGCAAAAAACCTTTCAGTCTTGCTCCTTCTCTCGAGAGAAGGAGCAAGACTGAA AGG (SEQ ID NO: 5).

[0062] The primers for synthesizing the shRNA target shown in SEQ ID NO: 2 are as follows:

[0063] Upstream primer: 5'-3'

[0064] ACCGCTGAAGCGAGATTGGTGCAAACTCGAGTTTGCACCAATTCGCTTCAGTT TTTTG (SEQ ID NO: 6).

[0065] Downstream primer: 5'-3'

[0066] CTAGCAAAAAACTGAAGCGAGATTGGTGCAAACTCGAGTTTTGCACCAATTCG CTTCAG (SEQ ID NO: 7).

[0067] The primers for synthesizing the shRNA target shown in SEQ ID NO: 3 are as follows:

[0068] Upstream primer: 5'-3'

[0069] ACCGATCATCAACCGCTTCTGTTATCTCGAGATAACAGAAGCGGTTGATGATTTTTTTG (SEQ ID NO: 8).

[0070] Downstream primer: 5'-3'

[0071] CTAGCAAAAAAATCATCAACCGCTTCTGTTATCTCGAGATAACAGAAGCGGTTG ATGAT (SEQ ID NO: 9).

[0072] Primer annealing to form double-stranded fragments with sticky ends: The synthesized oligo was dissolved in oligo annealing buffer to a concentration of 20 μM, and 30 μL of each complementary single strand was mixed. The oligo mixture was then heated in a water bath at 95 °C for 5 min, and then allowed to cool naturally to room temperature with the lid off to form double-stranded oligo fragments. 1 μL of this was used for subsequent ligation reactions.

[0073] Preparation of linearized expression vector: The vector backbone was digested with restriction endonucleases. The digestion reaction system was as follows: 2 μg plasmid, 5 μl 10x reaction buffer, 1 μl each restriction endonuclease, and deionized water to a final volume of 50 μl. The mixture was incubated in a 37°C water bath for at least 2 hours. The digestion products were analyzed by agarose gel electrophoresis to assess the digestion efficiency. The target vector band was excised from the agarose gel and recovered using the TaKaRa MiniBEST Agarose Gel DNA Extraction Kit Ver. 3.0. Specific procedures were followed according to the kit instructions.

[0074] The interfering fragment was ligated into the vector backbone. The ligation system was prepared according to Table 1, and ligation was carried out overnight at 16°C to obtain the mouse Gremlin1 interfering viral vector pAAV-U6-shRNA(Gremlin1)-CMV-EGFP-WPRE (vector map shown in Table 1). Figure 6 (As shown).

[0075] Table 1

[0076]

[0077] *The annealed double-stranded oligos added to the positive control were fragments that showed good results in preliminary experiments. They were the same length as the annealed double-stranded oligos added to the ligation group, but were unrelated to the target sequence.

[0078] Transformation of competent cells: For details on the transformation of DH5α competent cells, please refer to "A Concise Guide to Molecular Biology Experiments".

[0079] Colony PCR identification of positive transformants: Pick transformants grown on the plate and resuspend them in 10 μl of LB medium. Use 1 μl as a template for colony PCR identification. The reaction system (PCR reaction solution composition) and PCR cycling conditions (two-step or three-step method can be used) are shown in Table 2-3:

[0080] Table 2 Reaction System

[0081]

[0082] *Transformants resuspended in 10 μl LB medium.

[0083] Table 3 PCR

[0084]

[0085]

[0086] Positive clones are sent for sequencing: Positive clones obtained from colony identification are sent to a sequencing company for sequencing verification. The sequencing results are compared and analyzed using VectorNTI software.

[0087] Plasmid preparation: Positive clones that have been verified by sequencing are prepared for plasmid preparation.

[0088] Example 2: Preparation of rAAV2 / Rec2 recombinant adeno-associated virus

[0089] Take the frozen HEK293T cells out of the liquid nitrogen container and quickly place them in a 37°C water bath for revival. After centrifugation, add fresh culture medium to the cells and culture them at 37°C and 5% CO2. Pass the cells every 2-3 days. Once the cells are growing normally, transfer them to 10cm culture dishes for adherent culture.

[0090] When the cell density reaches a confluence of approximately 80-90%, transfection can be performed. The three-plasmid transfection system (the core plasmid pAAV-U6-shRNA(Gremlin1)-CMV-EGFP-WPRE obtained in Example 1, the serum plasmid pAAV-Rec2, and the helper plasmid pHelper) is prepared in a ratio of 2:3:4, and transfection and culture are performed in a 1000 μL system per dish.

[0091] After 24 hours of culture, observe cell transfection using a fluorescence microscope. Generally, a transfection efficiency of over 80% is required. After 72 hours of culture, collect the viral supernatant. Centrifuge the viral culture supernatant at low temperature to remove cell debris, add an appropriate amount of nuclease, remove free nucleic acids at 37°C, and then add PEG8000 / NaCl solution for overnight coagulation.

[0092] The agglomerated virus was resuspended in PBS and subjected to density gradient centrifugation in an ultracentrifuge. After centrifugation, the solution of the corresponding viral layer was extracted and dialyzed overnight at 4°C using a dialysis bag. The dialysate was filtered at 0.22 μm the next day and concentrated and washed through a concentration tube to obtain the desired recombinant virus rAAV2 / Rec2-U6-shRNA(Gremlin1)-CMV-EGFP-WPRE.

[0093] Viral titers were detected using absolute quantitative PCR.

[0094] Example 3: In vivo application of rAAV2 / Rec2 recombinant adeno-associated virus

[0095] Eight-week-old male C57BL / 6 mice were randomly divided into three groups: a normal control group, a group containing an irrelevant rAAV2 / Rec2 recombinant virus (NC control group, target sequence CCTAAGGTTAAGTCGCCCTCG (SEQ ID NO: 10)), and a group containing shRNA-Gremlin1 rAAV2 / Rec2 recombinant virus (Gremlin1 group), with 10 mice in each group. All mice were given normal feed and drinking water.

[0096] The administration method was intraperitoneal injection, and the dosage was 1.67 × 10⁻⁶. 11 vg / mouse.

[0097] Four weeks after intraperitoneal injection, mice were sacrificed and various organs were harvested, including white adipose tissue, spleen, pancreas, liver, lungs, muscle, brain, heart, and kidneys. Tissue samples were fixed using OCT and frozen sectioned.

[0098] Preliminary experiments validated the inhibitory effects of three shRNA targets on Gremlin1. The results showed that all three shRNA targets significantly inhibited Gremlin1 expression compared to the NC control group (SEQ ID NO: 10), with SEQ ID NO: 1 showing the best inhibitory effect. (See attached figures). Figure 1 .

[0099] Subsequent validations all used SEQ ID NO: 1 as the target site for shRNA.

[0100] The results of observing the pancreatic tissue of mice are as follows: Figure 2 As shown, the pancreatic tissue of mice in the NC control group and Gremlin1 group was clearly yellow-green to the naked eye.

[0101] Further observation of green fluorescence in various tissues was conducted using a laser confocal microscope. The results showed that almost no green fluorescence was observed in the spleen, brain, heart, lungs, muscle tissue, and kidneys; weak green fluorescence was observed in white fat and liver; and extremely strong green fluorescence was observed in pancreatic tissue, significantly stronger than in white fat and liver (e.g., ...). Figure 3 (As shown).

[0102] Example 4: Application of rAAV2 / Rec2 recombinant adeno-associated virus in mice with metabolic-related liver disease, using a non-alcoholic fatty liver disease (NAFLD) model.

[0103] Eight-week-old male C57BL / 6 mice were randomly divided into four groups: a normal control group, a NAFLD model group (NAFLD), a NAFLD model group receiving rAAV2 / Rec2 recombinant virus containing an irrelevant sequence (NAFLD+NC), and a NAFLD model group receiving rAAV2 / Rec2 recombinant virus containing the shRNA-Gremlin1 gene (NAFLD+Gremlin1). Ten mice were assigned to each group. The normal control group was fed a standard diet and provided with standard drinking water. The NAFLD, NAFLD+NC, and NAFLD+Gremlin1 groups were fed a Western diet (Harlan Teklad, catalog number TD.88137) and provided with drinking water containing 23.1 g / L fructose and 18.9 g / L glucose.

[0104] The NAFLD+NC and NAFLD+Gremlin1 groups received a single intraperitoneal injection of either rAAV2 / Rec2 recombinant virus containing an irrelevant sequence or rAAV2 / Rec2 recombinant virus containing the shRNA-Gremlin1 gene at week 8 after induction with a Western diet. The injection method was intraperitoneal injection, and the dose was 4 × 10⁻⁶. 11 vg / mouse.

[0105] The mice were induced to follow a Western diet. After 24 weeks of modeling, they were sacrificed and various organs were harvested, including white adipose tissue, spleen, pancreas, liver, lungs, muscle, brain, heart, and kidneys. Tissue samples were fixed using OCT and frozen sectioned.

[0106] The results of observing mouse pancreatic tissue are as follows: Figure 4 As shown, the pancreatic tissue of mice in the NAFLD+NC control group and the NAFLD+Gremlin1 group is clearly visible to the naked eye as a pale green color.

[0107] Green fluorescence in various tissues was observed under a laser confocal microscope. The results showed that almost no green fluorescence was observed in the spleen, brain, heart, lungs, muscle tissue, and kidneys; weak green fluorescence was observed in white fat and liver; and extremely strong green fluorescence was observed in pancreatic tissue, significantly stronger than in white fat and liver (e.g., ...). Figure 5 (As shown).

[0108] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.

Claims

1. Application of recombinant adeno-associated virus rAAV2 / Rec2 in the preparation of pancreatic-targeting vectors; The recombinant adeno-associated virus rAAV2 / Rec2 includes the inverted repeat sequence ITR of the AAV2 genome and the capsid protein of the AAVRec2 serotype; The recombinant adeno-associated virus rAAV2 / Rec2 was obtained by constructing a three-plasmid packaging system; The described three-plasmid packaging system includes a core plasmid, a serum-type plasmid, and an auxiliary plasmid pHelper; The core plasmid contains an inverted repeat sequence (ITR) of the AAV2 genome; The serotype plasmids mentioned include the rep gene and the cap gene.

2. Application of recombinant adeno-associated virus rAAV2 / Rec2 as a pancreatic-targeting vector in the preparation of pancreatic-targeting drugs; The recombinant adeno-associated virus rAAV2 / Rec2 includes the inverted repeat sequence ITR of the AAV2 genome and the capsid protein of the AAVRec2 serotype; The recombinant adeno-associated virus rAAV2 / Rec2 was obtained by constructing a three-plasmid packaging system; The described three-plasmid packaging system includes a core plasmid, a serum-type plasmid, and an auxiliary plasmid pHelper; The core plasmid contains an inverted repeat sequence (ITR) of the AAV2 genome; The serotype plasmid includes the rep gene and the cap gene; The pancreatic targeted drug therapy for non-alcoholic fatty liver disease; The pancreatic-targeting drugs include recombinant adeno-associated virus rAAV2 / Rec2 and shRNA; The target site sequence of the shRNA is SEQ ID NO: 1-3.

3. The application according to claim 2, characterized in that, The pancreatic-targeted drugs are administered via intraperitoneal injection.

4. The application according to claim 2, characterized in that, The recombinant adeno-associated virus rAAV2 / Rec2 was prepared by mixing pAAV-U6-shRNA-CMV-EGFP-WPRE, serotype plasmid pAAV-Rec2, and helper plasmid pHelper in a ratio of (1-5):(1-5):(1-5), and then transfecting and culturing the cells.

Images