VdPGL1 and application thereof

Abstract

The application belongs to the technical field of biology and specifically relates to a Verticillium dahliae pathogenic protein VdPGL1 and a coding gene thereof. The application discloses the Verticillium dahliae pathogenic protein VdPGL1, and the amino acid sequence of the Verticillium dahliae pathogenic protein VdPGL1 is shown as SEQ ID NO.2. The protein sequence disclosed by the application can significantly reduce the pathogenicity of Verticillium dahliae cotton verticillium wilt.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a pathogenicity-related protein VdPGL1 of Verticillium dahliae and its encoding gene. Background Technology

[0002] Verticillium dahliae Kleb., a soil-borne filamentous fungus, is a typical soil-borne vascular disease of cotton that threatens the sustainable development of the cotton industry. Verticillium dahliae mainly infects through the underground parts of plants, and its microsclerotia can survive in the soil for decades. Therefore, traditional methods such as crop rotation and chemical control have little effect on controlling Verticillium dahliae, and the damage caused by Verticillium dahliae is increasing year by year.

[0003] Discovering the pathogenic genes of Verticillium dahliae and elucidating its pathogenic mechanism can provide RNAi candidate targets for the "cross-border RNAi-mediated innovation system of upland cotton germplasm against Verticillium wilt". Summary of the Invention

[0004] In view of this, the present invention discloses a pathogenic protein of Verticillium dahliae, VdPGL1, the amino acid sequence of which is shown in SEQ ID NO.2.

[0005] The present invention further discloses the gene of the pathogenic protein VdPGL1 of Verticillium dahliae, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0006] In a specific embodiment of the present invention, the application of the pathogenic protein VdPGL1 of Verticillium dahliae in reducing the pathogenicity of Verticillium dahliae is disclosed.

[0007] In a specific embodiment of the present invention, the present invention discloses the application of the gene of the pathogenic protein VdPGL1 of Verticillium dahliae in reducing the pathogenicity of Verticillium dahliae.

[0008] In a specific embodiment of the present invention, the application of the pathogenic protein VdPGL1 of Verticillium dahliae in reducing cotton Verticillium wilt is disclosed.

[0009] In a specific embodiment of the present invention, the present invention discloses the application of the gene of the pathogenic protein VdPGL1 of Verticillium dahliae in reducing cotton Verticillium wilt disease.

[0010] This invention also relates to the gene encoding the protein and the application of the gene and protein. Knocking out this gene in *Verticillium dahliae* reduces the pathogenicity of *Verticillium dahliae*. Compared to wild-type *Verticillium dahliae*, the *Verticillium dahliae* mutant with the knockout gene showed reduced incidence and disease index of cotton Verticillium wilt. Attached Figure Description

[0011] Figure 1 A comparison of the growth characteristics of wild-type strains, mutant strains, and complemented strains on PDA medium.

[0012] Figure 2 A comparison chart of the penetration capabilities of wild-type strains, mutant strains, and complement strains.

[0013] Figure 3 A comparison of the incidence rates of wild-type strains, mutant strains, and complement strains in cotton 25 days after infection. Detailed Implementation

[0014] The specific embodiments of the present invention will be described in more detail below with reference to the accompanying drawings and examples, so as to better understand the solution of the present invention and its advantages in various aspects. However, the specific embodiments and examples described below are for illustrative purposes only and are not intended to limit the present invention.

[0015] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0016] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0017] Example 1

[0018] Preparation of the pathogenic gene VdPGL1 from Verticillium dahliae

[0019] RNA was extracted from wild-type Verticillium dahliae strain V592 (strain 592), reverse transcribed into cDNA, and then used as a template for RT-PCR amplification with primers 1 and 2 as follows:

[0020] Primer 1: ATGCGCCTCTCAGTCGGACTC

[0021] Primer 2: GGCAATCTGCTGCACAAACTG

[0022] Cloning and sequencing of the PCR amplification product confirmed that the amplification product has the nucleic acid sequence shown in nucleotides 1-1218 of SEQ ID No. 1 in the sequence listing, encoding a protein with the amino acid residue sequence described in SEQ ID No. 2 in the sequence listing, totaling 406 amino acid residues. The protein with the amino acid residue sequence described in SEQ ID No. 2 in the sequence listing was named protein VdPGL1, and the gene encoding VdPGL1 protein was named gene VdPGL1.

[0023] Example 2

[0024] Functional verification of the pathogenic gene VdPGL1 of Verticillium dahliae

[0025] DNA was extracted from the wild-type strain V592 of Verticillium dahliae (strain 592). Using this DNA as a template, PCR amplification was performed using primers 3, 4, 5, and 6 as follows:

[0026] Primer 3: CTTGCTGAGGTCTTAATTAATATTACAAGAAACAGACAGAA

[0027] Primer 4: AGTGCTGAGGCATTAATTAATCGGGGTGGGTGTTTTGAAGAC

[0028] Primer 5: CCCGCTGAGGACTTAATTAAGCCTCCTTGGCTGAGAGTTTTG

[0029] Primer 6: CTCGCTGAGGGTTTAATTAATACTTTGACGACTTTCTTGTTA

[0030] Amplify fragments of approximately 1000 bp upstream and downstream of the VdPGL1 gene and homologously recombine them with the pGKO-HPT vector digested with Pac I to obtain the VdPGL1 gene knockout vector pGKO-VdPGL1.

[0031] The pGKO-HPT vector (Wang S, Xing HY, Hua CL, Guo HS, Zhang J. An improved single-step cloning strategy simplifies the Agrobacterium tumefaciens-mediated transformation (ATMT)-based gene disruption method in Verticillium dahliae. Phytopathology. 2016, is publicly available from the Institute of Microbiology, Chinese Academy of Sciences for twenty years from the application date. This biological material is for the purpose of replicating experiments related to this invention and may not be used for other purposes)

[0032] PCR amplification was performed using primers 7 and 8 as follows:

[0033] Primer 7: CGGCCAGTGCCAAGCTTTTTGCATCAGGCAGACAGACC

[0034] Primer 8: GCAGCTTCTGCGAATTCGGCAATCTGCTGCACAAACTG

[0035] A fragment approximately 2000 bp upstream of the VdPGL1 gene, along with the full-length gene, was amplified and homologously recombinated with pSUL-NEO-olic-EKGFP-TrpC, which had been digested with BamHI / Hind III, to obtain the VdPGL1 gene complementation vector pSUL-NEO-olic-EKGFP-TrpC-VdPGL1.

[0036] The pSUL-NEO-olic-EKGFP-TrpC vector (Zhou TT, Zhao YL, Guo HS. Secretory proteins are delivered to the septin-organized penetration interface during root infection by Verticillium dahliae. PLoS pathogens. 2017; 13(3):e1006275.) is available to the public from the Institute of Microbiology, Chinese Academy of Sciences for twenty years from the date of application. This biological material is only for repeating the relevant experiments of this invention and may not be used for other purposes.

[0037] The successfully constructed gene knockout vector and complement vector were transformed with Agrobacterium tumefaciens to obtain the VdPGL1 knockout mutant strain VdΔPGL1 and the VdPGL1 complement strain VdΔPGL1 / VdPGL1.

[0038] Observe its phenotype, such as Figure 1 As shown, knocking out the mutant VdΔPGL1 does not affect the growth rate, and the mycelial growth is more vigorous. The reintroduced strain VdΔPGL1 / VdPGL1 restores the colony phenotype of wild-type V592.

[0039] The cellophane-induced penetration test results showed that the knockout mutant VdΔPGL1 and the complement strain VdΔPGL1 / VdPGL1 did not alter the cellophane penetration ability of *Verticillium dahliae*. Figure 2 As shown.

[0040] The pathogenicity of the virus was identified by infecting hydroponic cotton with the VdΔPGL1 knockout strain and the reinjection strain VdΔPGL1 / VdPGL1. Plump cotton seeds were selected, soaked in 15% sodium hypochlorite solution for 30 minutes, rinsed 2-3 times with sterile water, and then soaked in sterile water overnight to promote germination. The seeds were then spread flat in a germination box to maintain humidity. Once the sprouts reached 3 cm in length, they were planted in germination boxes. Seedlings with cotyledons were transferred to plastic containers (8-10 cm high) filled with water and cultured at 25°C under 16 hours of light and 8 hours of darkness. When true leaves emerged, the water was replaced with 1 / 3 MS medium. The medium was changed weekly, and inoculation was performed when one true leaf had fully expanded. Verticillium dahliae strain V592, VdPGL1 knockout strain VdΔPGL1, and VdPGL1 replenishment strain VdPGL1 / VdΔpgl1, stored at -80℃, were activated on PDA plates for 3-4 days. Colony blocks were picked from the edge and placed in Czapek's broth. The mixture was incubated at 25℃ and 220 rpm for 5 days. After filtration, the filtrate was centrifuged at 5000 rpm for 5 minutes. Spores were diluted with water, counted using a hemocytometer, and the concentration was adjusted to 1×10⁻⁶. 7 1 spore / ml. The adjusted spore suspension was added to an empty plastic container, and cotton seedlings were immersed in the solution for 40 minutes. Afterwards, the seedlings were cultured in 1 / 3 MS medium at 25°C under light for 16 hours, followed by 8 hours in the dark. Twelve seedlings were planted in each container, with three replicates per variety. Control seedlings were soaked in water for 40 minutes. Disease incidence was observed after 25 days.

[0041] V592 4 2 1 4 25 VdΔpgl1 26 3 2 3 2 VdPGL1 / VdΔpgl1 2 3 2 5 24

[0042] from Figure 3 It can be seen that compared with the wild type V592, the knockout strain VdΔPGL1 significantly reduced the pathogenicity of Verticillium dahliae, while the replenishment strain VdΔPGL1 / VdPGL1 restored the pathogenicity to that of the wild type.

[0043] Pathogenicity grading standards:

[0044] Level 0 plants are healthy and show no symptoms;

[0045] Grade 1: 0.1%-25% of leaves wilting;

[0046] Grade 2: 25%-50% of leaves wilted;

[0047] Grade 3: 50%-75% of leaves are wilted;

[0048] Grade 4: 75%-100% of the leaves wilt or die;

[0049] The results of the above methods show that the incidence, disease index, and disease severity of cotton infected with the knockout mutant VdΔPGL1 were significantly lower than those of cotton infected with wild-type Verticillium dahliae V592, indicating that the VdPGL1 gene is associated with the pathogenicity of Verticillium dahliae.

Claims

1. The application of knocking out the VdPGL1 gene of Verticillium dahliae in reducing the pathogenicity of Verticillium dahliae, wherein the nucleotide sequence of the VdPGL1 gene is shown in SEQ ID NO.

1.

2. The application of knocking out the VdPGL1 gene of Verticillium dahliae in reducing cotton Verticillium wilt disease, wherein the nucleotide sequence of the VdPGL1 gene is shown in SEQ ID NO.1.

Images