Polypeptide targeting protein phase separation of npat and application thereof

Abstract

The application discloses a kind of polypeptides for targeting NPAT protein phase separation and application thereof, and relates to the technical field of biological medicine.The polypeptide provided in the application is found in the mechanism of regulating histone matrix formation of NPAT protein.In cell transfection of the two polypeptides, the formation of histone matrix can be effectively inhibited, and the expression of histone gene is down-regulated.MTT experiment and colony formation experiment show that the polypeptide of the application has obvious effect of inhibiting tumor cell proliferation.In the polypeptide of the application, the most sequences are only 49 amino acid residues, the molecular weight is small, the permeability is high, and the polypeptide has certain application prospect in the field of medicine, and can provide design idea for the development of drug for inhibiting the growth of tumor cells with strong proliferation ability.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, specifically to a polypeptide targeting NPAT protein phase separation and its application. Background Technology

[0002] Normal cell cycle progression requires precise regulation of histone synthesis and transcription. Histone transcription is regulated by a membraneless organelle within the cell nucleus called the Histone Locus Body (HLB). The HLB structure is the key physical location for the transcription of histone genes within the cell. Recent research has revealed that phase separation / condensation of biomolecules is a crucial mechanism driving the formation of membraneless organelles and signaling bodies within cells. Phase separation refers to the process by which macromolecules such as proteins or nucleic acids, in a previously homogeneous environment, interact multivalently to create another phase with different physicochemical properties. Abnormal phase separation and dysregulation caused by gene mutations can lead to tumors, neurodegenerative diseases, and metabolic disorders. Therefore, targeting the phase separation of important proteins is of significant value for developing new therapeutic targets for diseases.

[0003] The formation and maintenance of histone matrix in membraneless organelles depend on NPAT (Nuclear Protein mapped to the ATM locus). Recent studies have found that the NPAT homolog Mxc in Drosophila can undergo phase separation to initiate the formation of histone matrix (Hur et al. CDK-Regulated Phase Separation Seeded by HistoneGenes Ensures Precise Growth and Function of Histone Locus Bodies. DevCell. 2020, 54: 379-394.), but whether NPAT undergoes phase separation in mammals has not been reported. NPAT can recruit molecules such as FLASH to initiate the formation of histone matrix structure and maintain its stability, thereby ensuring that histone genes can be transcribed normally (Wang Feiya, Cong Xiaoxia, Liu Yufen, et al. Regulatory mechanism of NPAT molecules [J]. Chinese Journal of Cell Biology, 2017, 39(6): 6. DOI: 10.11844 / cjcb.2017.06.0285.). Because NPAT plays a crucial role in regulating histone matrix formation and cell proliferation, its activity must be precisely regulated. Studies have found that NPAT gene mutations are closely related to the development and progression of tumors such as breast cancer and lymphoma. We believe that intervention targeting NPAT phase separation and histone matrix may be one of the potentially effective methods for developing lead drugs for cancer treatment.

[0004] All proteins are synthesized in ribosomes in the cytoplasm. Nuclear proteins (including NPAT), after synthesis, need to be transported into the nucleus to perform their biological functions. Targeted delivery of nuclear proteins involves a protein called the nuclear import receptor (Importin). Importin is a key protein mechanism determining the transport of cargo proteins into the nucleus. The Arm repeat sequence in the Importin sequence is the binding site for the cargo NLS and consists of 10 repeat sequences of approximately 42-43 amino acids, representing a relatively hydrophobic sequence.

[0005] However, no studies have been reported on the effects of proteins targeting the nuclear import receptor Importin on NPAT phase separation and histone matrix intervention. Summary of the Invention

[0006] The purpose of this invention is to provide a polypeptide that targets NPAT protein phase separation and its application. This polypeptide competes with endogenous Importin α4, preventing NPAT from entering the nucleus, thereby inhibiting NPAT phase separation in the nucleus and the formation of histone matrix, ultimately suppressing tumor cell proliferation.

[0007] To achieve the above objectives, the technical solution of the present invention is as follows:

[0008] This invention provides a polypeptide that targets the phase separation of NPAT protein, which is a truncated version of nuclear input protein α4, and the amino acid sequence is shown in SEQ ID No. 5-8.

[0009] The present invention also provides the application of the polypeptide in the preparation of antitumor drugs.

[0010] In some embodiments of the present invention, the tumor is breast cancer or lymphoma.

[0011] The present invention also provides a gene encoding the polypeptide.

[0012] Preferably, the nucleotide sequence of the gene is shown in SEQ ID No. 9-12.

[0013] This invention provides the application of the gene in the preparation of antitumor drugs.

[0014] In some embodiments of the present invention, the tumor is breast cancer or lymphoma.

[0015] In some embodiments of the present invention, the gene is introduced into cancer cells to express the polypeptide.

[0016] The present invention also provides an expression vector for the gene.

[0017] The present invention also provides a pharmaceutical composition comprising the aforementioned polypeptide and a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier is selected from excipients, pharmacokinetic agents, fillers, sweeteners, disintegrants, humectants, and lubricants.

[0018] This invention is the first to discover that mammalian NPAT can undergo phase separation in a concentration-dependent manner to drive the formation of histone matrix. Protein phase separation requires a certain concentration to be maintained within the cell nucleus. Therefore, inhibiting NPAT entry into the nucleus and reducing its concentration therein can inhibit phase separation and histone matrix formation, thereby inhibiting tumor cell proliferation. This invention identifies Importin α4 as a key molecule for NPAT transport into the nucleus. Based on the ARM3-5 sequence of the NPAT-Importin α4 interaction, we designed several low-molecular-weight peptides and found that the ARM3-5 and ARM5 peptides can compete with endogenous Importin α4 to inhibit the NPAT-Importin α4 interaction, preventing NPAT from entering the nucleus. Therefore, these two peptides can inhibit NPAT phase separation and histone matrix formation in the cell nucleus, thereby inhibiting tumor cell proliferation.

[0019] The peptides provided in this invention were discovered during research on the mechanism by which NPAT protein regulates histone matrix formation. Transfection of these two peptides into cells effectively inhibits histone matrix formation and downregulates histone gene expression. MTT and clonogenic assays show that the peptides of this invention have a significant inhibitory effect on tumor cell proliferation. The peptides of this invention have a maximum sequence length of only 49 amino acid residues, a small molecular weight, and high permeability, making them promising for applications in the pharmaceutical field and providing design ideas for drug development to inhibit the growth of highly proliferating tumor cells. Attached Figure Description

[0020] Figure 1 To enable NPAT to undergo in vitro phase separation: A. In vitro phase separation experiment to detect the difference in phase separation of different concentrations of NPAT protein. B. In vitro phase separation experiment to detect the effect of different concentrations of the congestant PEG8000 on the phase separation of FLAG-NPAT. C. Detect the effect of 1,6-hexanediol treatment on the phase separation of NPAT protein. D. Detect the effect of different concentrations of NaCl on the phase separation of NPAT protein.

[0021] Figure 2 For Importin α4-mediated nuclear transport of NPAT: A. Importin α4 interacts with NPAT. B. Knockdown of Importin α4 leads to GFP-NPAT retention in the cytoplasm. C. Knockdown of Importin α4 reduces the formation of nuclear histone matrix. Scale bar = 10 μm.

[0022] Figure 3 The ARM5 fragment of Importin α4 inhibits histone matrix formation: A. Immunoprecipitation experiments showed that the C-terminal sequence of NPAT interacts with NPAT. B. Importin α4 interacts with NPAT through the ARM3-5 sequence. C. Immunofluorescence experiments showed that the ARM5 fragment, compared to the ARM3-5 fragment of Importin α4, had the most significant inhibitory effect on histone matrix formation. Scale bar = 10 μm.

[0023] Figure 4 The ARM5 fragment of Importin α4 inhibits histone gene transcription: Real-time PCR results showed that the ARM5 fragment of Importin α4 had the most significant effect on inhibiting histone gene expression in MCF7 and 293T cells compared to the ARM3-5 fragment of Importin α4.

[0024] Figure 5The Importin α4-derived ARM5 fragment can inhibit cell proliferation: A. MTT assay showed that the Importin α4-derived ARM5 fragment can inhibit the proliferation of MCF7 and 293T cells. B. Clonogenesis assay showed that the Importin α4-derived ARM5 fragment can inhibit the proliferation of MCF7 and 293T cells. Detailed Implementation

[0025] Example 1: NPAT in vitro phase separation experiment

[0026] 1. Plasmid transfection and protein purification:

[0027] 293T cells were seeded in 10cm culture dishes (DMEM high-glucose medium containing 10% FBS and antibiotics-free) and cultured for 24 hours until the cell density was controlled at approximately 90%. 15μg of pXJ40-FLAG-NPAT (amino acid sequence as shown in SEQ ID No. 3, nucleotide sequence as shown in SEQ ID) was then added. (As shown in No. 4) Add plasmid DNA to tube 1 containing 500 μl of OPTI-MEM medium and mix well; add 15 μl of plasmid transfection reagent to tube 2 containing 500 μl of OPTI-MEM medium, mix well, and incubate at room temperature for 5 minutes; mix the DNA suspension from tube 1 and the transfection reagent suspension from tube 2, and incubate at room temperature for 20 minutes; aspirate the medium from the 10 cm dish, add fresh antibiotic-free DMEM high-glucose medium containing 10% FBS; add the mixture from tubes 1 and 2 to the culture dish, mix gently, and place in an incubator; after 24 hours, remove the medium, wash with pre-cooled PBS; add 0.5 ml of HEPES lysis buffer (with protease inhibitor and phosphatase inhibitor) for cell lysis; transfer the cell lysis buffer to a 1.5 ml centrifuge tube, centrifuge at 14000×g for 5 minutes, transfer the supernatant to a new 1.5 ml centrifuge tube; add 20 μl of M2 Place the M2 beads in a shaker at 4°C and incubate for 2 hours; centrifuge at 2000 rpm for 30 seconds and discard the supernatant; wash the M2 beads 4 times with lysis buffer; add 100 μl of 200 μM 3×FLAG-peptide competitive elution buffer to the M2 beads and incubate at 4°C for 4 hours; centrifuge at 2000 rpm for 30 seconds, transfer the protein eluent (supernatant) to a 100 KD ultrafiltration tube, add 1 ml of PBS, and centrifuge at 4000 rpm for 5 min to wash, repeating 3 times; after centrifugation, collect the purified protein from the ultrafiltration tube into a new centrifuge tube.

[0028] 2. In vitro phase separation:

[0029] The purified target protein was added to phase separation buffer (50 mM Tris-HCl pH 7.5, 10% glycerol, 1 mM MTT). The protein concentration (6.25, 12.5, 25, 50 μM), PEG-8000 content (1%, 2%, 5%, 10% per unit volume of PEG-8000), NaCl concentration (50, 150, 300, 800 mM), 1,6-hexanediol content (0%, 0.25%, 0.5%, 1% per unit volume of 1,6-hexanediol), and phase separation time were adjusted to 60 min. The phase separation droplets were imaged using the DIC module of a confocal microscope.

[0030] The results showed that the purified NPAT protein could indeed undergo phase separation. Protein phase separation depends not only on protein concentration but also on solution crowding. As the concentration of NPAT protein increased, both the size and number of phase-separated droplets increased. Figure 1 A). Furthermore, increasing solution crowding with PEG-8000 can promote phase separation of NPAT. Figure 1 B). The driving force behind protein phase separation is multivalent interactions mediated by charge-particle and hydrophobic interactions. NaCl and 1,6-hexanediol can inhibit charge-particle and hydrophobic interactions, respectively. The results showed that 1,6-hexanediol can inhibit the phase separation of NPAT (NP-dependent protein esters). Figure 1 C), while salt ion concentration has no effect on the phase separation of NPAT ( Figure 1 D). These experimental data show that NPAT can undergo phase separation in a concentration-dependent manner through hydrophobic interactions in its sequence.

[0031] Example 2: Construction of an Importin α4-derived peptide expression vector targeting NPAT

[0032] Vectors for mammalian cells were constructed using the pXJ40-FLAG plasmid. Primers were designed based on the nucleotide sequence for cloning the target gene (see Table 1), and the corresponding cDNA library was amplified by PCR. After purification, the amplified products were double-digested with the pXJ40-FLAG plasmid vector using NEB endonucleases. The digestion system consisted of 20 μl of XhoI, 1 μl of NotI, 10 μl of PCR product, 2 μl of 10× buffer, and 8 μl of double-distilled water, at 37°C for 2 hours. After purification, the digested products were ligated using a 10 μl ligation system (1 μl of vector digestion product, 7.5 μl of target gene digestion product, 0.5 μl of T4 ligase, and 1 μl of T4 ligase buffer), at 22°C for 30 minutes. The ligation product was added to 200 μl of E. coli DH5α cells and incubated on ice for 30 minutes; then incubated in a 42°C water bath for 90 seconds, and rapidly cooled on ice for 5 minutes; the mixed bacterial culture was then spread onto AMP. + Incubate on LB bacterial culture plates overnight at 37°C; pick single colonies and inoculate into 5 ml of LB liquid medium, incubate at 37°C on a shaker for 5 hours, then send to Hangzhou Shangya Biotechnology Co., Ltd. for sequencing; the obtained correct clones are used for subsequent experiments. The five target gene fragments are as follows:

[0033] The amino acid sequence of Importin α4 is shown in SEQ ID No. 1, and the corresponding nucleotide sequence is shown in SEQ ID No. 2;

[0034] The amino acid sequence of ARM3-5 is shown in SEQ ID No. 6, and the corresponding nucleotide sequence is shown in SEQ ID No. 10;

[0035] The amino acid sequence of ARM3 is shown in SEQ ID No. 7, and the corresponding nucleotide sequence is shown in SEQ ID No. 11;

[0036] The amino acid sequence of ARM4 is shown in SEQ ID No. 8, and the corresponding nucleotide sequence is shown in SEQ ID No. 12;

[0037] The amino acid sequence of ARM5 is shown in SEQ ID No. 5, and the corresponding nucleotide sequence is shown in SEQ ID No. 9.

[0038] Table 1 Primer sequences

[0039] Importin α4 F CGCTCGAGATGGCCGAGAACCCCAGC Importin α4 R GCGCGCGGCCGCTTAAAAATTAAATTC Importin α4 ARM3-5 F CGCTCGAGACTCAAGCTGTTGTGCAG Importin α4 ARM3-5 R ATGCGGCCGCTTACTGTATCTGTTCATT Importin α4 ARM3 F CGCTCGAGACTCAAGCTGTTGTGCAG Importin α4 ARM3 R ATGCGGCCGCTTAAGGACCATCACCTAT Importin α4 ARM4 F CGCTCGAGCAATGTAGAGATTAT Importin α4 ARM4 R ATGCGGCCGCTTACCTGCAGAGATTGAC Importin α4 ARM5 F CGCTCGAGAATAAGGATCCCCCG Importin α4 ARM5 R ATGCGGCCGCTTACTGTATCTGTTCATT

[0040] Example 3

[0041] siRNA interference experiment:

[0042] MCF-7 cells were seeded into six-well cell culture plates. When the cell density reached 50-60%, siRNA transfection was performed. 50 nm of siRNA was added to centrifuge tube 1 containing 100 μl of OPTI-MEM medium. Simultaneously, 5 μl of RNAiMAX siRNA transfection reagent was mixed with 100 μl of OPTI-MEM medium in centrifuge tube 2 and allowed to stand for 5 min. The siRNA suspension from tube 1 was then mixed with the transfection reagent suspension from tube 2 and allowed to stand for 20 min. The mixture was added to the cell supernatant, and the cells were incubated at 37°C for 48-72 hours. The cells were then harvested for nucleocytoplasmic separation experiments.

[0043] To investigate whether importin protein is involved in regulating NPAT nuclear translocation, different Imponin α members (Importin α1, 3-8) plasmids (Importin α1 Gene Bank: 3838; Importin α3 Gene Bank: 3840; Importin α4 Gene Bank: 3839; Importin α5 Gene Bank: 3836; Importin α6 Gene Bank: 3841; Importin α7 Gene Bank: 23633; Importin α8 Gene Bank: 402569) were cloned and subjected to immunoprecipitation experiments with NPAT. It was found that only Importin α4 specifically bound to NPAT. Figure 2 A). To further confirm whether Importin α4 is involved in regulating NPAT nuclear translocation, we knocked down Importin α4 using siRNA interference (Importin α4 siRNA sequences are shown in Table 2), and performed nucleocytoplasmic separation experiments. We found that inhibiting Importin α4 led to NPAT retention in the cytoplasm. Figure 2 B). Consistent with this, knockdown of Importin α4 leads to a significant reduction in NPAT-positive histone matrix structures in the cell nucleus. Figure 2 C).

[0044] Table 2

[0045] Importin α4 siRNA-1 GGAAACAATGCGAAGACAT Importin α4 siRNA-2 CCACCGATTGATGACTTAA

[0046] Example 4: Immunoprecipitation assay for the interaction between NPAT and Importin α4 and its derived peptides

[0047] Immunoprecipitation analysis:

[0048] Cells were seeded in 6-well cell culture plates and transfected with a vector plasmid containing the target gene cDNA from Example 2. After overnight culture, cells were lysed with lysis buffer (1% sodium deoxycholate, 200 mM NaCl, 60 mM Tris-HCl pH 7.3, 0.75 mM EDTA, 25 mM phosphatase inhibitor, 1% Triton-X-100, 0.2% sodium fluoride, 5 mM sodium orthovanadate, and protease inhibitor), and centrifuged at 15,000 rpm. 15 μL of m²-FLAG beads were added to the supernatant, and after incubation for 2–4 hours, the beads were washed with cell lysis buffer. Loading buffer was added to the samples, and protein-protein interactions were detected by Western blot.

[0049] Immunoprecipitation experiments showed that the C-terminal sequence of NPAT is a key sequence mediating the interaction between Importin α4-NPAT. Figure 3 A)(The amino acid sequence of the N-region (labeled FLAG-N-region in the figure) of NPAT is as shown in SEQ ID No. 3, amino acid positions 1-430, and the corresponding nucleotide sequence is as shown in SEQ ID No. 4, amino acid positions 1-1290bp; the amino acid sequence of the M-region (labeled FLAG-M-region in the figure) is as shown in SEQ ID No. 3, amino acid positions 431-1030, and the corresponding nucleotide sequence is as shown in SEQ ID No. 4, amino acid positions 1291-3090bp; the amino acid sequence of the C-region (labeled FLAG-C-region in the figure) is as shown in SEQ ID No. 3, amino acid positions 1031-1427, and the corresponding nucleotide sequence is as shown in SEQ ID No. 4, amino acid positions 3091-4281bp). Importin α4 contains 10 ARM repeats. To further identify the key sequences in the Importin α4 sequence that interact with NPAT, we constructed three truncation mutations of Importin α4 containing different ARM repeats (where the amino acid sequence of ARM1-2 (labeled FLAG-ARM1-2 in the figure) is as shown in SEQ ID No. 1, amino acid positions 1-149, and the corresponding nucleotide sequence is as shown in SEQ ID No. 2, positions 1-447 bp; and the amino acid sequence of ARM6-10 (labeled FLAG-ARM6-10 in the figure) is as shown in SEQ ID No. 1, amino acid positions 279-521, and the corresponding nucleotide sequence is as shown in SEQ ID No. 2, positions 835-1563 bp). Immunoprecipitation experiments showed that the ARM3-5 sequence mediates the interaction between Importin α4 and NPAT. Figure 3 B).

[0050] Example 5: Immunofluorescence assay to detect the effect of Importin α4-derived peptides on histone matrix formation in MCF7 breast cancer cells.

[0051] Place coverslips into 24-well cell culture plates, seed cells, and culture overnight. Transfect the cells with a vector plasmid containing the target gene. The next day, wash the cells with PBS and fix them with fixative containing 3% paraformaldehyde. After 30 minutes, perforate the cells with PBS containing 0.1% saponin. Then, incubate with the specific primary antibodies (rabbit anti-FLAG monoclonal antibody, Wuhan Aibote Biotechnology Co., Ltd., catalog number: AE063; mouse anti-NPAT antibody, BD Biosciences Co., Ltd., catalog number: 611344) for 2-6 hours, and wash the cells 3 times. Then add the fluorescently labeled secondary antibody (goat anti-rabbit-Alexa Fluor 546, Thermo Fisher Scientific, catalog number: A-11035; goat anti-mouse-Alexa Fluor 488, Thermo Fisher Scientific, catalog number: A-11001) and incubate for 1 hour. After cleaning, use tweezers to remove the slide, invert it onto a glass slide, seal it with Fluoresafe reagent, and observe and photograph it under a confocal microscope.

[0052] The results are as follows Figure 3 As shown in C, ARM3-5, ARM3, ARM4, and ARM5 were transfected into MCF7 cells. Immunofluorescence analysis revealed that different truncated mutations could affect the formation of histone matrix, with the ARM5 fragment showing the strongest inhibitory effect. The ARM5 fragment was selected for further experiments.

[0053] Example 6: Detection of the effect of Importin α4-derived peptides on histone transcription in breast cancer cells MCF7 and human kidney epithelial cell line 293T by quantitative real-time PCR

[0054] Cells were cultured overnight in six-well cell culture dishes. The constructed plasmids were transfected into the cells using liposome transfection reagent, and the cells were incubated at 37°C and 5% CO2 for 1–2 days. RNA was extracted using the Abclonal AFT SpinTissue / Cell Fast RNA Extraction Kit, and the RNA concentration was measured. 1 μg of RNA was used for reverse transcription using the Abclonal ABScript III RT Master Mix for qPCR with gDNA Remover kit. The resulting sample was diluted to 100 μl with DEPC H2O. The reverse transcription product was then used as a template for real-time quantitative PCR using the Abclonal 2×Universal SYBR Green Fast qPCR Mix. The fluorescence signal of the PCR reaction was quantitatively detected using a Roche LightCycler 480II real-time fluorescence quantitative PCR instrument. Finally, the results were processed and analyzed using Excel and Graphpad Prism.

[0055] The results are as follows Figure 4 As shown, overexpression of the AMR5 sequence in MCF7 and 293T cells can significantly downregulate the expression of histone genes.

[0056] Example 7: Importin α4-derived ARM5 fragments can inhibit the proliferation of MCF7 and 293T cells.

[0057] 1. MTT Experiment

[0058] First, cells cultured for 24 hours in the logarithmic growth phase were digested, centrifuged, and counted. They were then diluted with culture medium to create 5-7 cell concentration gradients, with 4-6 replicates per group. After seeding, cells were cultured for 2-4 hours until adherence. 10 μL of CCK-8 reagent was added to every 100 μL of culture medium. After 1 hour of culture, the absorbance at 450 nm was measured using a microplate reader to create a standard curve. Simultaneously, 1000 cells each of the control group (transfected with FLAG-Vector plasmid) and the experimental group (transfected with FLAG-ARM3-5 or FLAG-ARM5 plasmid) were seeded into 96-well plates, with 100 μL of culture medium per well and 4-6 replicates per group. After 24, 48, 72, and 96 hours of culture, 10 μL of CCK-8 reagent was added to each well. After 1 hour of culture, the absorbance at 450 nm was measured using a microplate reader. Finally, the results were processed and analyzed using Excel and Graphpad Prism.

[0059] 2. Cloning experiment

[0060] Cells in the logarithmic growth phase were digested with 0.25% trypsin and pipetted to form single cells. The cells were then suspended in DMEM high-glucose medium containing 10% fetal bovine serum and counted. The cell suspension was serially diluted, and each group of cells was seeded at densities of 500 and 1000 cells per cell in culture dishes containing 5 mL of pre-warmed 37°C medium, with three replicates per group. The culture dishes were gently rotated to ensure even cell dispersion, and the cells were cultured in a cell culture incubator at 37°C, 5% CO2, and saturated humidity for 1-2 weeks. When visible clones appeared in the culture dishes, the supernatant was discarded, and the cells were carefully washed twice with PBS. Cells were fixed with 5 mL of 4% paraformaldehyde. After 15 minutes, the fixative was removed, and the cells were stained with crystal violet for 10-15 minutes. The cells were then washed three times with PBS and air-dried. The dried petri dishes were inverted on white agar plates for photographing, and the number of clones was counted visually. Finally, the results were processed and analyzed using Graphpad Prism.

[0061] The Importin α4-derived ARM5 fragment is a key sequence mediating NPAT-Importin α4. We predicted that this peptide could compete with endogenous Importin α4, inhibiting NPAT-Importin α4 interaction, preventing NPAT from entering the nucleus, and thus inhibiting phase separation of NPAT in the nucleus and the formation of histone matrix. We verified the effect of the Importin α4-derived ARM5 sequence on cell proliferation in 293T and MCF-7 breast cancer cells using MTT assays and colony formation assays. MTT assay (…) Figure 5 A) and clonogenic experiments ( Figure 5 B) It was also confirmed that the Importin α4-derived AMR5 peptide can inhibit cell proliferation. These data indicate that the Importin α4-derived AMR5 peptide can interfere with histone matrix formation, thereby inhibiting tumor cell proliferation and showing good potential for transformation.

Claims

1. A polypeptide targeting NPAT protein phase separation, characterized in that, It is a truncated version of nuclear input protein α4, and its amino acid sequence is shown in SEQ ID No.

5.

2. The use of the polypeptide as described in claim 1 in the preparation of an antitumor drug, wherein the tumor is breast cancer.

3. A gene encoding the polypeptide as described in claim 1.

4. The gene as described in claim 3, characterized in that, The nucleotide sequence of the gene is shown in SEQ ID No.

9.

5. The use of the gene as described in claim 3 or 4 in the preparation of an antitumor drug, wherein the tumor is breast cancer.

6. The application as described in claim 5, characterized in that, The gene is introduced into cancer cells to express the polypeptide, wherein the cancer cells are breast cancer cells.

7. An expression vector comprising the gene of claim 3 or 4.

8. A pharmaceutical composition, characterized in that, Includes the polypeptide of claim 1 and a pharmaceutically acceptable carrier.

Images