A composite microbial composition and use thereof

Abstract

The application discloses a composite microbial composition and application thereof. The composite microbial composition contains Trichoderma harzianum, Penicillium bilaiae and Metarhizium pingshaense, and makes full use of the characteristics of the strains. The composite microbial composition can be prepared into dry powder type seed coating agents and suspension type seed coating agents, and the seed coating agents are simple to prepare and convenient to use, can effectively colonize the three kinds of microorganisms in seeds, maintain the activity and stability of the strains, and can be used with various chemical seed coating agents. The composite microbial composition has a significant effect on effectively inhibiting plant diseases (especially basal rot and large spot) and plant pests, and promoting plant growth, and has important application prospect and economic value.

Description

Technical Field

[0001] This invention belongs to the field of microbiology and relates to a microbial composition, specifically a composite microbial composition and its application. Background Technology

[0002] Seed coating is a specific process in which exogenous materials are coated onto the surface of seeds. A seed coating agent containing various components such as insecticides, fungicides, compound fertilizers, trace elements, plant growth regulators, slow-release agents, and film-forming agents is evenly coated onto the seed surface in a certain proportion, forming a smooth and durable medicinal film. The biological seed coating agent enters the soil with the seed. It absorbs water but does not dissolve. Through the pores in the spatial network structure of the film-forming agent on the seed surface, the seed coating agent and other seed coating substances it carries are slowly released into the roots. During seed germination and seedling growth, it is transported to all parts of the plant, allowing the biological agents to exert their effects continuously. Biological seed coating agents not only provide sufficient nutrients and protection for seeds and seedlings, but also improve seed germination rate, improve seedling quality, enhance seedling resistance, and play a role in insect control, disease prevention, and growth promotion. Compound microbial agents, due to the various interrelationships among different microorganisms such as mutualism, symbiosis, parasitism, and antagonism, require careful consideration of the seed coating agent formulation and composition to ensure its suitability for different strains. Furthermore, it is crucial to focus on the interactions between the strains to guarantee their activity, stability, and colonization ability on seeds and plants.

[0003] The successful development of microbial seed coating agents relies on several key technologies: functional strains, suitable formulations to ensure the activity and stability of the strains, good strain combinations, and broad compatibility with chemical pesticides to ensure their establishment in the soil environment or at the plant roots. This allows them to achieve multiple effects, such as disease resistance, control of underground pests, and regulation and supplementation of plant nutrition. Existing seed coating agents have different active ingredients; some are single agents, while others are compound formulations. Different active ingredients target different pests and diseases, but they primarily control pests and diseases during the plant's growth period. Regarding dosage forms, dry powder formulations require water-soluble processing, especially when used in combination with chemical drugs, which often causes inconvenience for users. Suspension formulations contain water, making it difficult for most bacteria to survive, with only a few able to survive stably. Therefore, the promotion and use of suspension formulations in actual microbial products is greatly limited. Compound microbial agents also need to consider the significant interactions between different strains. Compound microbial agents that can be prepared into different formulations such as dry powder seed coating agents and suspension seed coating agents can broaden the application forms of products in the market. Therefore, the selected compound microbial agents that can be prepared into both dry powder and suspension seed coating agents have significant market value and application prospects.

[0004] Trichoderma is a widely distributed biocontrol fungus in nature, mainly used to control soil-borne diseases of various plants, as well as some leaf and spike diseases. Trichoderma not only prevents disease but also promotes plant growth, improves nutrient utilization efficiency, enhances plant stress resistance, and helps remediate agrochemical-polluted environments (Harman GE et al. 2006). Penicillium is widely found in nature, with advantages such as rapid growth and reproduction, strong sporulation capacity, and abundant and inexpensive raw materials, making it more suitable for industrial production. It is a major species for the biological control of pathogenic fungi in crops (Zhang Nannan et al., 2017). Metarhizium is an important entomopathogenic fungus; approximately 200 species of pests worldwide can be infected and killed by this fungus. Many virulent strains of *Metarhizium anisopliae* isolated from indoor environments have been reported, but their control efficacy in actual field applications is poor. This has resulted in only a handful of commercially available *Metarhizium anisopliae* formulations being registered, and these products are primarily concentrated on *Metarhizium anisopliae* var. *scarabii*. Commercially available formulations of other *Metarhizium anisopliae* strains that can be widely applied and demonstrate good control efficacy against field pests are even rarer. The complex field environment contributes to the low and unstable efficacy of *Metarhizium anisopliae*. For large-scale field application, specific strains with rapid and high sporulation rates are required. However, the highest reported spore germination rate of the *Metarhizium anisopliae* strain cultured at 30°C for 48 hours was only 48%. Furthermore, the *Metarhizium anisopliae* strain WP08 produced zero sporulation on SDA medium, but 2.48 ± 0.36 × 10⁻⁶ sporulations on PPDA medium after day 14. 7 spores / cm 2 On day 14, the value on PDA medium was 1.72 ± 1.128 × 10⁻⁶. 7 spores / cm 2 .

[0005] The present invention aims to develop a compound seed dressing agent that can effectively utilize the effects of these three strains, effectively control plant diseases and pests, promote plant growth, and improve crop yield and product quality. Summary of the Invention

[0006] To address the aforementioned problems, the purpose of this invention is to provide a composite microbial composition that can simultaneously and effectively exert the effects of Trichoderma, Penicillium baiji, and Metarhizium pingshaense for the prevention and control of plant diseases and pests, promote plant growth, increase crop yield and product quality, and has strong compatibility with chemical pesticides.

[0007] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0008] A composite microbial composition comprising microorganisms and an agriculturally or horticulturally acceptable carrier, wherein the microorganisms include *Metarhizium pinghaense*, which is deposited at the Guangdong Provincial Microbial Culture Collection Center, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, on December 1, 2020, with accession number GDMCC NO.61333;

[0009] Preferably, the microorganisms further include: *Trichoderma harzianum* and *Penicillium sp.*; the *Trichoderma harzianum* is deposited at the China General Microbiological Culture Collection Center (CGMCC), address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, deposited on May 21, 2018, with accession number CGMCC No. 15679; the *Penicillium sp.* is deposited at the China General Microbiological Culture Collection Center (CGMCC), address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, deposited on July 12, 2016, with accession number CGMCC NO. 12767;

[0010] Preferably, the agriculturally acceptable carrier includes one or more stabilizers, one or more dispersants, one or more wetting agents, one or more colorants, one or more aqueous solvents, one or more non-aqueous cosolvents, and / or one or more film-forming agents;

[0011] Preferably, the agriculturally or horticulturally acceptable carrier improves the spreadability of the strain on seeds.

[0012] The Metarhizium anisopliae strain selected in this invention produces spores quickly and in large quantities. Experiments have shown that this strain can be used for field crops.

[0013] The three microbial strains used in this invention—Trichoderma harzianum, Penicillium barometz, and Metarhiziumpingshaense—possess the ability to synthesize IAA and secrete siderophores, thus promoting plant growth and improving crop yield and quality. They also have biocontrol potential: exhibiting inhibitory effects against Fusarium graminearum and Exserohilum turcicum, effectively controlling plant diseases caused by these pathogens. Furthermore, they possess insecticidal activity, effectively killing pests such as corn borers. Finally, they demonstrate strong compatibility with various chemical pesticides, allowing for direct use in combination with various seed dressing agents or application to soil environments with high pesticide residue levels to exert their efficacy. A composite microbial seed coating agent for seed coating was prepared by mixing these three microorganisms with the other components mentioned above in a certain mass fraction. The seed coating agent is a dry powder. This formulation and the three strains exhibit ideal and stable interactions, effectively enhancing the activity and stability of each microorganism, enabling them to effectively colonize seeds and plant roots. It can be effectively used for the prevention and control of plant diseases and pests, promoting plant growth, and increasing crop yield and product quality. Furthermore, its strong compatibility with chemical pesticides allows it to be used in soils with severe pesticide residues, improving the soil environment, or in combination with chemical pesticides to reduce pesticide usage, control diseases and pests, promote growth, and increase yield and income.

[0014] In a preferred embodiment of the present invention, the fungus includes Trichoderma harzianum, Penicillium barometz, and Metarhizium pingshaense, wherein the mass ratio of Trichoderma harzianum, Penicillium barometz, and Metarhizium pingshaense is 1:1:1.

[0015] In a preferred embodiment of the present invention, the microorganism is the spore powder of the microorganism.

[0016] In a preferred embodiment of the present invention, the concentrations of Trichoderma harzianum, Penicillium barometz, and Metarhizium pingshaense fungal spore powders in the composite microbial composition are at least 2 billion CFU / mg or 2 billion CFU / mL, respectively.

[0017] When prepared as a suspension, the concentration of Trichoderma harzianum, Penicillium barometz, and Metarhizium anisopliae fungal spore powder is at least 2 billion CFU / mL; when prepared as a dry powder, the concentration of Trichoderma harzianum, Penicillium barometz, and Metarhizium anisopliae fungal spore powder is at least 2 billion CFU / g.

[0018] In a preferred embodiment of the present invention, the combination comprises the following components in weight percentage: 15-18% microbial spore powder, 8-10% dispersant, 5-8% wetting agent, 18-20% colorant, 3-5% film-forming agent, and 42%-45% one or more other carriers;

[0019] Preferably, the composition comprises the following components in weight percentages: 10% dispersant, 5% stretching powder, 20% colorant, 3% polyvinyl alcohol, 13% modified starch, 32% sugar powder, and 17% microbial spore powder.

[0020] Furthermore, the dispersant is preferably Dispersol BB4, the separating agent is preferably separating agent BX, the colorant is preferably a natural colorant, and the modified starch is preferably corn modified starch.

[0021] In a preferred embodiment of the present invention, the composition further includes a chemical seed coating agent; preferably, the chemical seed coating agent accounts for at least 50% of the composition by mass; preferably, the chemical seed coating agent is at least one selected from metalaxyl, fludioxonil, thiamethoxam and tebuconazole.

[0022] Tests have shown that the compound microbial seed coating agent of the present invention, when used in combination with various chemical drug seed coating agents, does not affect the microbial activity in the compound microbial seed coating agent of the present invention.

[0023] In a preferred embodiment of the present invention, the composition further includes one or more of the following: insecticides, phytonutrients, fertilizers, herbicides, fungicides, nematicides, insecticides, acaricides, and gastropod septics.

[0024] The combination of Trichoderma harzianum, Penicillium barometz, and Metarhizium anisopliae can enhance the insecticidal efficacy of Metarhizium anisopliae.

[0025] The present invention also provides a method of using the composition, wherein the composition is applied or coated onto at least a portion of the outer surface of the plant part or plant seed; preferably, the crops involved in the present invention include: field crops, potatoes, carrots, leafy vegetables, solanaceous vegetables, strawberries, grapes, citrus fruits, bananas, kiwifruit, dragon fruit, tomatoes, peppers, beans, ginger, Panax notoginseng, ginseng and other root and tuber crops; the seed is corn seed.

[0026] The present invention also claims protection for the plant products prepared by the method; preferably, the product is seeds.

[0027] The present invention also claims a method for increasing the disease resistance of crops or plants, the method comprising the steps of: (a) planting plant parts or seeds, applying the composition at least partially to the plant parts or seeds; and (b) the microbial strain promoting the growth of the plant parts or seeds.

[0028] As one use of the Metarhizium anisopliae or the composition described in this invention, the Metarhizium anisopliae or the composition is used to prepare seed coating agents or insecticides.

[0029] As another use of the Metarhizium anisopliae or the composition described in this invention, the Metarhizium anisopliae or the composition is used to improve crop or plant traits; preferably, to reduce or prevent or improve the severity or symptoms of plant diseases.

[0030] Preferably, the crop or plant is corn;

[0031] Preferably, the crop or plant has one or more of the following improved traits: increased yield, increased seed weight per plant, increased seed number, increased emergence rate, increased yield growth rate, increased ear weight, increased 100-grain weight, increased grain number per row, faster crop maturity, reduced symptoms caused by fungal diseases, and reduced symptoms caused by pests.

[0032] Preferably, the fungal disease includes at least one disease caused by Fusarium graminearum or Exserohilum turcium;

[0033] Preferably, the fungal disease includes at least one of: maize leaf spot and maize stalk rot;

[0034] Preferably, the pests include at least one of the following: corn borer, nematode, insect, large worm, small worm, and gastropod.

[0035] Preferably, the pathogen is selected from: *Colletotrichum capsici*, *Botrytis cinerea*, *Ralstonia solanacearum*, *Rhizoctonia solani*, *Fusarium graminearum*, *Fusarium oxysporum*, *Athelia rolfsii*, *Streptomyces scabies*, *Sclerotium rolfsii* (peanut rot), *Sclerotinias clerotiorum* (rapeseed sclerotium), and *Fusarium oxysporum sp. *cucumebrium* (cucumber wilt). Owen, wheat take-all pathogen (Gaeumannomycescritici), wheat scab (Fusarium graminearum), apple tree rot pathogen (Valsamali), apple anthracnose pathogen (Glomerella cingulata), rice sheath blight pathogen (Rhizoctonia solan), rice blast pathogen (Pyricularia grisea), tomato early blight pathogen (Alternaria solanani), maize large leaf spot pathogen (Exserohilum turcicum), maize small leaf spot pathogen (Bipolaria maydis), pepper phytophthora capsici, tobacco phytophthora icotianae, kiwifruit canker pathogen (Pseudomonas) The fungi causing the following diseases are listed: *Xanthomonas campestris* (bacterial blight of rice), *Erwinia carotorora* (soft rot of Chinese cabbage), *Xanthomonas campestris* (black spot of walnut) and / or *Erwinia carotovora* (soft rot of konjac), *Botrytis cirerea* (grass gray mold), *Phytophthorainfestans* (potato late blight), *Exserohilum turcicum* (maize large leaf spot), *Bipolaria maydis* (maize small leaf spot), *Fusarium oxysporum* f. sp. *niveum* (watermelon wilt), *Verticillium dahliae* (eggplant verticillium wilt), and *Fusarium oxysporum* f. sp. (cotton wilt).Phytophthora capsici, Phytophthora spp., Phytophthora cirrhosa, or any combination thereof.

[0036] In some embodiments, the plant is selected from Solanaceae, Poaceae, Fabaceae, Cucurbitaceae, Brassicaceae, Asteraceae, Apiaceae, and Orchidaceae.

[0037] In some embodiments, the plant has one or more characteristics selected from the following:

[0038] (1) The Solanaceae plants mentioned are selected from tomatoes, peppers, potatoes, eggplants, or any combination thereof;

[0039] (2) The grass plants mentioned are selected from corn, wheat, rice, sorghum, or any combination thereof;

[0040] (3) The legumes mentioned are selected from soybean, peanut, or any combination thereof;

[0041] (4) The Cucurbitaceae plants mentioned are selected from cucumber, winter melon, pumpkin, bitter melon, loofah, watermelon, monk fruit, or any combination thereof;

[0042] (5) The cruciferous plants mentioned are selected from Chinese cabbage, rapeseed, kale, radish, cauliflower, or any combination thereof;

[0043] (6) The orchid plants mentioned are selected from orchids.

[0044] The present invention also provides a method for preparing the composition, comprising the following steps: mixing the components in a specified ratio.

[0045] This invention provides a composite microbial composition in dry powder and suspension forms containing three microorganisms: *Trichoderma harzianum*, *Penicillium barometz*, and *Metarhiziumpingshaense*. Under this formulation and formulation, the three microorganisms exhibit ideal and stable interactions, promoting their activity and stability, and enabling them to produce synergistic effects while fully utilizing their individual functions. The seed coating agent is simple to prepare, convenient to use, and has stable formulation and effects. It can be used alone or in combination with various chemical seed coating agents, offering multiple applications: First, the three microorganisms can effectively colonize seeds and plant roots, promoting root length, root quantity, stem thickness, and increased chlorophyll, resulting in more plump grains, larger ears and horns, or more and larger fruits, thereby improving quality and yield. Second, it can effectively inhibit plant diseases (especially basal rot and large leaf spot) and plant pests such as corn borers, demonstrating significant application prospects and economic value. Attached Figure Description

[0046] Figure 1The results show the iron-carrying secretion test results of different strains; among them, Pb is Penicillium baicalensis, Th is Trichoderma harzianum, and Mp is Metarhizium pingshaense.

[0047] Figure 2 The purpose of this study was to test the cultivation results of maize seeds with different coating treatments in a greenhouse pot experiment.

[0048] Figure 3 To test the growth of maize seeds with different coating treatments in a field experiment.

[0049] Figure 4 The results of plate confrontation tests between different strains of Fusarium graminearum are shown; where Fg is Fusarium graminearum, Pb is Penicillium barometz, Th is Trichoderma harzianum, and Mp is Metarhizium pingshaense.

[0050] Figure 5 The results of plate confrontation tests between different strains of *Metarhizium pingshaense* are shown; where Et is *Metarhizium pingshaense*, Pb is *Penicillium barometz*, Th is *Trichoderma harzianum*, and Mp is *Metarhizium pingshaense*.

[0051] Figure 6 The control of maize leaf spot disease under different coating treatments.

[0052] Figure 7 This shows the colonization of various strains of the compound microbial seed coating agent of the present invention on the maize root system.

[0053] Figure 8 This shows the colonization of Penicillium benzoate seed dressing agent on maize roots.

[0054] Figure 9 This shows the colonization of Trichoderma harzianum seed dressing agent on maize roots.

[0055] Figure 10 This shows the colonization of *Metarhizium anisopliae* seed dressing agent on maize roots.

[0056] Figure 11 The results of the field experiment on maize growth promotion for each treatment group on day 52 are shown.

[0057] Figure 12 The growth of *Metarhizium anisopliae* at different temperatures. Detailed Implementation

[0058] To better illustrate the purpose, technical solution, and advantages of the present invention, the present invention will be further described below in conjunction with the accompanying drawings and specific embodiments.

[0059] Information regarding the *Trichoderma harzianum* strain of this invention can be found in CN109022292B. The *Trichoderma harzianum* strain involved in this invention includes all the information disclosed in CN109022292B. Information regarding the *Penicillium baicalensis* strain of this invention can be found in CN107793263B. The *Penicillium baicalensis* strain involved in this invention includes all the information disclosed in CN107793263B.

[0060] This application screened for a strain of *Metarhizium pingshaense* that exhibits rapid and strong sporulation capacity. The experimental methods are as follows:

[0061] (I) Isolation, purification and identification of Metarhizium anisopliae

[0062] 1.1 Separation and purification

[0063] Soil weighing: After the agricultural soil collected from Jiangxi was dried, the soil sample was sieved to remove impurities, and 10g of the dried soil was weighed and put into a filter device.

[0064] Soil washing: Wash the soil with tap water for 10 minutes, allowing the soil particles to flow downwards through a 1mm brass mesh and two polypropylene filters. Collect the bottom layer of soil particles and place them in a sterile 50mL centrifuge tube. Add 50mL of sterile water and vortex to suspend them. Centrifuge at 10,000 rpm for 6 minutes, discard the supernatant, wash with sterile water, and centrifuge again. Repeat the centrifugation and washing process three times.

[0065] Dilute the precipitate: Add sterile sodium carboxymethyl cellulose solution at a ratio of 20:1 (v / v) of water / particles.

[0066] Spreading: Dilute the above precipitate suspension 10 times with sterile water, and use a pipette to transfer 100 μL onto a PDA (containing chloramphenicol and tetracycline hydrochloride) plate and spread it evenly. Incubate the plate in the dark at 28°C for 2–7 days.

[0067] Fungal purification: When a single white, flocculent colony grows on the culture medium, a small amount of hyphae is picked up with a sterile toothpick and transferred to a SDAY plate for further culture to obtain a purified strain.

[0068] 1.2 Morphological identification

[0069] The isolated Metarhizium anisopliae were inoculated onto SDAY agar plates and cultured at 28°C for 10–15 days. Colony morphology, sporulation structures, and spore size and shape were observed. After 4–5 days of culture, white mycelia were picked and prepared into slides for observation of mycelial and conidial morphology under a microscope. After sporulation, conidia were picked and prepared into slides for observation of conidial size and morphology.

[0070] 1.3 Molecular biological identification

[0071] Genomic DNA was extracted from the mycelium of the strain and used as a template for gene amplification. Multiple genes were amplified and sequenced. The genes to be amplified and the primers are as follows:

[0072] ITS:ITS4(5′-TCCTCCGCTTATTGATATGC-3′, SEQ ID NO:1)

[0073] and ITS5 (5′-GGAAGTAAAAGTCGTAACAAGG-3′, SEQ ID NO: 2)

[0074] BenA:Bt1F(5'-GGTCCCTTCGGTCAGCTCTTCC-3', SEQ ID NO:3)

[0075] and Bt1R (5'-CAGCCATCATGTTCTTAGGGTC-3', SEQ ID NO:4)

[0076] EF:983F(5'-GCYCCYGGHCAYCGTGAYTTYAT-3', SEQ ID NO:5)

[0077] and 2218R(5'-ATGACACCRACRGCRACRGTYTG-3', SEQ ID NO:6)

[0078] All primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0079] Template DNA extraction: Genomic DNA was extracted using the Biospin Fungus Genomic DNA Extraction Kit (BioFlux, Bioer Technology Co., Ltd.).

[0080] Gene amplification reaction system: Prepare the reaction system in the PCR tube as follows: 12 μL 2XTaq PCR Master Mix, 1 μL DMSO, 0.6 μL each of primer 1 and primer 2 (10 μmol / L), 10.8 μL ddH2O, and 2 μL template DNA.

[0081] Gene amplification conditions: pre-denaturation at 94℃ for 4 min; denaturation at 94℃ for 40 s, annealing at 55℃ for 40 s, extension at 72℃ for 1 min, repeating denaturation to extension for 35 cycles; extension at 72℃ for 10 min, followed by incubation at 10℃ for 5 min. PCR-generated samples were sent to Genewiz for sequencing.

[0082] The ITS sequencing results, BenA sequencing results, and EF sequencing results are as follows:

[0083] ITS:

[0084] (SEQ ID NO:7)

[0085] BenA:

[0086] CGTCAGCTCTTCCGTCCCGACAACTTCGTCTTTGGTCAGTCTGGTGCTGGCAACAATTGGGCCAAGGGTCACTACACTGAAGGTGCTGAGCTTGTCGACAATGTCCTTGATGTTGTCCGTCGCGAGGCGGAAGGTTGTGACTGCCTCCAGGGCTTCCAGATCACCCACTCTCTCGGTGGTGGTACCGGTGCTGGTATGGGTACTCTGTTGATCTCCAAGATCCGTGAAGAGTTTCCCGACCGAATGATGGCCACATTCTCCGTCGTTCCCTCTCCCAAGGTTTCCGACACCGTTGTCGAGCCCTACAACGCAACCCTCTCCGTCCATCAGCTCGTTGAGAACTCTGACGAGACTTTCTGCATCGACAATGAGGCTCTGTACGACATCTGCATGCGCACTCTCAAGCTGTCTAACCCTTCGTACGGTGACCTGAACTATCTCGTCTCTGCCGTCATGTCTGGCGTCACCACATGCTTGCGTTTCCCCGGTCAGTTGAACTCTGATCTGCGTAAGCTGGCTGTCAACATGGTCCCCTTCCCTCGTTTGCACTTCTTCATGGTCGGCTTCGCCCCCCTGACCAGCCGTGGTGCTCACTCTTCCGCGCTGTCAGCGTACCTGAGCTCACCCAGCAGATGTTCGACCCTAAG(SEQ ID NO:8)

[0087] EF:

[0088] GAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCATGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATTGTCGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGGCCCGTTACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTCGCCTTCGTCCCCATCTCCGGTTTCCACGGTGACAACATGCTTCAGGCCTCCACCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGGCTGGCAAGTCCACCGGCAAGACCCTCCTCGAGGCCATTGACGCCATTGAGCCCCCCAAGCGTCCCACCGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTGTACAAGATCGGCGGTATTGGAACTGTCCCTGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGTATGGTCGTTACCTTTGCTCCCTCCAACGTCACCACTGAAGTCAAGTCCGTGGAAATGCACCACGAGCAGCTTACCGAGGGTGTCCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGTAACGTTGCTGGTGACTCCAAGAACGACCCCCCCATGGGTGCCGCTTCCTTCGATGCCCAGGTCATCGTTCTCAACCACCCCGGCCAGGTCGGTGCTGGTTACGCTCCCGTCCTCGATTGCCACACCGCCCACATTGCCTGCAAGTTCTCTGAGATCAAGGAGAAGATTGACCGACGTACCGGTAAGGCTGTTGAGTCTGCCCCCAAGTTCATCAAGTCTGGTGACTCTGCCATCGTCAAGATGGTTCCCTCCAAGCCTATGTGCGTTGAGGCTTCACCGACTAC(SEQ ID NO:9)

[0089] 1.4 Results

[0090] The strain initially colonies on SDAY medium are white with a fluffy texture, and produce olive-green conidia when mature. The hyphae are septate; the conidia are single-celled, arranged in chains, oblong or columnar, and measure (6.50–8.94) μm × (2.18–2.82) μm.

[0091] The sequence obtained from sequencing was compared with the Metarhizium pingshaense strain sequence in the NCBI gene database. The strain was identified as Metarhizium pingshaense.

[0092] Phylogenetic trees based on multiple genes (ITS, BenA, and EF) are as follows: Figure 7 As shown, strain GDMCC 61333 is identified as Metarhizium pinghaense.

[0093] Preservation information: Metarhizium pinghaense, deposited at Guangdong Provincial Center for Microbial Culture Collection, accession number GDMCC 61333, deposited on December 1, 2020.

[0094] (II) Experimental determination of sporulation capacity of Metarhizium anisopliae:

[0095] 1.1 Effect of temperature on strain growth

[0096] The cultured Metarhizium anisopliae spores were washed with 0.1% Tween 80, and 10 μl was inoculated onto fresh SDAY medium. The medium was then incubated at five different temperatures: 20℃, 25℃, 28℃, 30℃, and 35℃. Colony diameter was measured daily, with three replicates per group. Results are shown below. Figure 11 .

[0097] 1.2 Determination of colony growth rate

[0098] Wash the cultured Metarhizium anisopliae spores with 0.1% Tween 80, take 10 μl and inoculate it onto a new SDAY medium. Perform 3 replicates, measure the diameter of the colonies at regular intervals every day and record the data, until the colonies cover the medium completely.

[0099] 1.3 Sporulation rate determination

[0100] 100 μl of spore suspension was spread onto SDAY agar plates and cultured at 28°C for 10–15 days. Then, 8 mm diameter mycelial discs were cut from the plates using a punch. The conidia on the discs were vibrated and washed into 10 mL of 0.1% Tween 80 using an ultrasonic homogenizer. The spore concentration was determined by counting with a hemocytometer and then converted to concentrations per cm³. 2Sporulation on plates. Three wells were punched on each plate for spore content determination, and the average value was taken as one replicate spore count. Each strain was measured three times.

[0101] 1.4 Spore germination rate determination

[0102] Spores from Metarhizium anisopliae cultured for 10–15 days were washed off using 0.1% Tween 80. 10 μl of the spores were inoculated onto 1 / 4 SDAY medium, with 3 inoculations per plate. The plates were then incubated in an incubator under the same conditions for 24 h. Random observations were made using a 400x microscope. The number of spores that germinated was determined to be greater than or equal to the diameter of the short axis of the spore. The germination rate was calculated.

[0103] 2. Results

[0104] The effect of temperature on the growth of the strain: As can be seen from the figure below, the optimal temperature for the growth of the strain is 20-30℃, with the best growth occurring at 25-28℃.

[0105] Sporulation yield and spore germination rate: cultured on SDAY medium By day 14, the sporulation yield can reach 0.66 × 10⁻⁶. 8 spore Child / cm 2 . High sporulation . The germination rate of spores can reach over 94% within 24 hours. All of the above demonstrates that this strain has simple nutritional requirements, rapid growth and reproduction, fast sporulation, and good biological characteristics.

[0106] Example 1: Coating effect of the dry powder composite microbial seed coating agent of the present invention

[0107] 1. Preparation of dry powder seed coating agents and suspension seed coating agents

[0108] (1) Prepare the dry powder seed coating agent according to the proportions in Table 1:

[0109] Formula 1: The compound microbial seed coating agent comprises the following components by weight percentage: 10% dispersant, 5% stretching powder, 20% colorant, 3% polyvinyl alcohol, 13% modified starch, 32% sugar powder, and 17% microbial complex.

[0110] Formula 2: The compound microbial seed coating agent includes the following components by weight percentage: 8% dispersant, 8% stretching powder, 18% colorant, 5% polyvinyl alcohol, 10% modified starch, 35% sugar powder and 16% microbial complex.

[0111] Formula 3: The compound microbial seed coating agent includes the following components by weight percentage: 9% dispersant, 6% stretching powder, 19% colorant, 4% polyvinyl alcohol, 11% modified starch, 33% sugar powder and 18% microbial complex.

[0112] Formula 4: The compound microbial seed coating agent includes the following components by weight percentage: 9% dispersant, 7% stretching powder, 19% colorant, 4% polyvinyl alcohol, 12% modified starch, 34% sugar powder and 15% microbial complex.

[0113] Table 1. Formulation of Dry Powder Seed Coating Agent

[0114]

[0115] The microorganisms in the dry powder seed coating agent formulation in Table 1 can be a single microorganism or a complex of multiple microorganisms. Correspondingly, the prepared dry powder seed coating agent can be a single microorganism seed coating agent or a complex microorganism seed coating agent.

[0116] In preparing the dry powder composite microbial seed coating agent, the microorganisms are a complex of Trichoderma harzianum, Penicillium basilaria, and Metarhizium pingshaense. These microorganisms are mixed evenly with other components of the seed coating agent in the form of fungal spore powder to form the dry powder composite microbial seed coating agent. The final concentration of the fungal spore powders of Trichoderma harzianum, Penicillium basilaria, and Metarhizium pingshaense is 2 billion CFU / g, and the mass ratio of Trichoderma harzianum, Penicillium basilaria, and Metarhizium pingshaense in the composite microbial seed coating agent is 1:1:1.

[0117] When preparing dry powder single-microbial seed coating agents, the final concentration of microbial fungal spore powder is 2 billion CFU / g.

[0118] Subsequent tests were all conducted using the optimal formulation for seed coating agent preparation.

[0119] (2) Prepare suspension seed coating agent according to the proportions in Table 2:

[0120] Table 2 Formulations of Suspension Seed Coating Agents

[0121]

[0122] The microorganisms in the suspension seed coating formulations in Table 2 can be single microorganisms or complexes of multiple microorganisms. Correspondingly, the prepared suspension seed coating can be a single microorganism seed coating or a complex microorganism seed coating.

[0123] In preparing the suspension-type composite microbial seed coating agent, the microorganisms are a complex of Trichoderma harzianum, Penicillium barometz, and Metarhizium pingshaense, which are mixed in a mass ratio of 1:1:1 in the form of fungal spore powder. Then, all components in the suspension-type seed coating agent formulation except for the fungal spore powder are first mixed to form a suspension. The suspension is then mixed with the fungal spore powder in a mass ratio to prepare the microbial suspension-type seed coating agent. The final concentration of Trichoderma harzianum, Penicillium barometz, and Metarhizium pingshaense fungal spore powder in the prepared suspension-type composite microbial seed coating agent is 2 billion CFU / g.

[0124] When preparing a suspension-type single-species microbial seed coating agent, the final concentration of the microbial fungal spore powder is 2 billion / g.

[0125] Subsequent tests were all conducted using the optimal formulation for seed coating agent preparation.

[0126] 2. Seed coating treatment and dilution of bacterial count after coating for plate spreading

[0127] Dilute the dry powder seed coating agent 3-5 times, then treat corn (Zhengdan 958) seeds at a agent-to-seed ratio of 1:80. Stir well and air dry. For each treatment, place 10 corn kernels in a 50mL centrifuge tube, add 20mL of sterile Tween water, vortex until homogeneous, and dilute to a final concentration of 1:10. -5 The concentrations are: stock solution, 10... -1 10 -2 10 -3 10 -4 10 -5 Take 100 μL of bacterial suspension for each concentration and place it on a PDA plate. Repeat the process three times for each concentration. Use sterile glass beads to evenly distribute the bacterial suspension on the culture medium. After drying, place the plate in a 28℃ constant temperature incubator. Observe the plate after 1 day and count the number of colonies on the plate (10-150 colonies on the plate is the effective counting range). Calculate the number of bacteria on the corn surface coating.

[0128] 3. Coating treatment results

[0129] To test the effects of seed coating agent formulations and formulations on the activity, stability, and colonization ability of microorganisms on seeds, seed coating treatments were conducted. The results of different seed coating agents on maize seeds are shown in Table 3 below. The compound microbial seed coating agent (dry powder and suspension concentrate) of this application was formulated at a concentration of 10... -4 The concentration range was used to calculate the number of colonies on the plate and to calculate the number of coated bacteria. The suspension seed coating agent for *Penicillium baicalensis* was at a concentration of 10... -4 The concentration range was used to calculate the number of colonies on the plate and the number of coated bacteria; Trichoderma harzianum was calculated at 10... -3Calculate the number of colonies on the plate and the number of coated bacteria within the concentration range; Metarhizium anisopliae is calculated at 10. -2 The concentration range is used to calculate the number of colonies on the plate and the number of coated bacteria.

[0130] Table 3. Number of coated bacteria in each treatment

[0131]

[0132]

[0133] As shown in Table 3, after coating with the four dry powder coating agents, the single-agent bacterial counts of *Penicillium baicalensis*, *Trichoderma harzianum*, and *Metarhizium anisopliae*, as well as the compound-agent bacterial counts, all reached 10. 5 Furthermore, the bacterial counts of both the single-agent and compound agents in Formula 1 are 7 × 10⁻⁶. 5 The cfu / granule concentration is higher than that of other formulations, therefore formulation 1 is the optimal formulation for the dry powder seed coating agent. Experiments show that the *Metarhizium pingshaense* of this application can also be prepared as a dry powder seed coating agent and a suspension seed coating agent independently.

[0134] Suspension coating agents were used to simultaneously coat three strains. *Penicillium bailey* showed a significant dominance on seeds, while *Trichoderma harzianum* and *Metarhizium anisopliae* showed significantly lower numbers. The bacterial counts of both single-agent and combined agents were consistent. Compared to dry powder coating, the dry powder coating resulted in higher bacterial counts on the seeds.

[0135] The composite microorganisms screened in this invention are suitable for both dry powder and suspension formulations of seed coating agents. Dry powder formulations require water-soluble processing, especially when used in combination with chemical drugs, which often causes inconvenience for users. Suspension formulations contain water, making it difficult for most bacteria to survive, with only a few surviving stably. Therefore, the widespread use of suspension formulations in actual microbial products is greatly limited. Composite microbial agents also need to consider the significant interactions between different strains. Composite microbial agents that can be prepared into different formulations such as dry powder and suspension formulations can broaden the application forms of products in the market. Therefore, the selected composite microbial agents that can be prepared into both dry powder and suspension formulations have significant market value and application prospects.

[0136] The coating effect of the composite seed coating agent prepared within the component range provided in Table 2 is basically consistent with the optimal ratio, and can effectively improve the activity and stability of the three bacteria.

[0137] Example 2: Experiment on the promotion of maize growth by the compound microbial seed coating agent of the present invention.

[0138] (1) IAA Test

[0139] The ability of *Trichoderma harzianum*, *Penicillium barometz*, and *Metarhizium pingshaense* to secrete IAA was tested:

[0140] Three bacterial strains were activated from glycerol tubes and transferred to potato dextrose agar (PDA) medium. They were incubated at 28°C, with three plates of each strain activated for later use. The three strains were then inoculated into their corresponding liquid media (PDB) and cultured on a shaker at 28°C. Three replicates were performed for each strain, with a blank medium (without inoculation) serving as a control. The cultures were centrifuged at 10,000 rpm at 4°C for 10 min. 1 mL of the supernatant was mixed with 1 mL of colorimetric reagent, incubated in the dark for 30 min, and then rapidly measured at 530 nm using a spectrophotometer to determine the absorbance. The IAA content was calculated using a standard curve based on the OD value (Yang Qiyao et al., 2012). The results are shown in the table below.

[0141] Table 4. IAA concentration of strains

[0142] 1 Trichoderma harzianum 0.077 1.925 2 Metarhizium anisopliae 0.029 0.781 3 Penicillium barometz 0.06 1.520

[0143] As shown in the table above, *Trichoderma harzianum*, *Penicillium barometz*, and *Metarhizium pingshaense* all possess the ability to synthesize indoleacetic acid. Experiments have shown that the *Metarhizium pingshaense* strain described in this application has the function of promoting crop growth.

[0144] (2) Test of siderophore secretion capacity

[0145] Siderophores are substances secreted by almost all aerobic and facultative anaerobic microorganisms, including bacteria and fungi, into the environment under iron stress. 3+ Small molecular weight iron chelates with extremely high affinity assist microorganisms in obtaining essential iron from the environment. In cases of iron deficiency, microorganisms produce specific siderophores within their bodies that bind with Fe. 3+ This forms a tight, soluble complex; simultaneously, it produces a receptor protein, namely an iron receptor protein, on the outer membrane of Gram-negative bacteria (G-), which specifically recognizes Fe. 3+Siderophores transport Fe3+ into cells. Current research indicates that siderophores are not only crucial for iron nutrition in microorganisms, but also a key mechanism by which rhizosphere growth-promoting bacteria (PGPR) suppress soil-borne diseases. Furthermore, siderophores play a role in various aspects, including the pathogenicity of certain plant and animal pathogens. These microorganisms with siderophore synthesis capabilities can improve their own nutritional status by competing for iron, and can also supply iron to plants or achieve biocontrol by competing with plant pathogens for iron. Experiments show that *Metarhiziumpingshaense*, the species described in this application, can also be prepared as a biocontrol agent with anti-plant pathogen functions.

[0146] The siderophore secretion capacity of Trichoderma harzianum, Penicillium barometz, and Metarhizium pingshaense was tested:

[0147] Iron starvation treatment: Scrape the test strain with an inoculation loop and inoculate it into a 50 mL centrifuge tube containing 10 mL of MKB iron-free medium. Incubate at 30°C with shaking at 200 rpm for 24–72 h. After cell production, centrifuge at 1000 rpm for 5 min and discard the supernatant. Wash the cells twice with 5 mL of sterile ultrapure water by centrifugation at 10,000 rpm for 5 min, and then dilute 10-fold with sterile ultrapure water to obtain a bacterial suspension.

[0148] CAS plate covering method: Inoculate 10 μL of bacterial suspension onto an iron-free MKB plate, or streak the suspension onto an iron-free MKB plate using an inoculation loop. Each strain should be in triplicate and incubated at 30°C for 2 days. After 2 days, distinct single colonies should appear on each plate. Pour a layer of CAS medium onto the plate where colonies have grown, and observe the color change of each plate after 1 hour. Observe again after 24 hours and record the results by photograph.

[0149] When biocontrol bacteria produce siderophores: Colonies of siderophore-producing biocontrol bacteria will show a visible halo on the siderophore detection plate; the siderophore halo is orange-red. During qualitative testing, the color changes of each colony on the siderophore detection plate, including changes in the color of the halo produced by the strain and the size of the halo increase, should be observed and recorded. In addition to visual observation of the halo, the solubility index, i.e., the halo ratio D / d, can be calculated. Using the solubility index as a reference, the ability of biocontrol bacteria to secrete siderophores can be analyzed and compared. The test results for each bacterium are shown in the table below. Figure 1 As shown.

[0150] Table 5. Iron carrier solubility index of each strain

[0151] Penicillium barometz 1.52 Trichoderma harzianum 1.45 Metarhizium pingshaense 1.38

[0152] Based on the test results (Table 5), Figure 1 All three strains possess the ability to produce siderophores, exhibiting potential for plant growth promotion and biocontrol. The *Metarhizium pingshaense* strain described in this application can also be prepared alone as a biocontrol agent and a plant / crop growth promoter, possessing both growth-promoting and anti-plant pathogen functions.

[0153] (3) Greenhouse pot experiment

[0154] The effects of different seed dressing agents on maize seed growth were tested through greenhouse pot experiments.

[0155] Healthy and uniformly sized corn seeds (Zhengdan 958) were selected and surface-sterilized, then randomly divided into 6 groups. Each group was treated with a different seed coating agent (see Table 6 below; single microbial seed coating agents had an effective viable count >2 billion CFU / g; the compound microbial seed coating agent dry powder prepared in Example 1 had an effective viable count >6 billion CFU / g; the adjuvant control was a dry powder seed coating agent in which the microbial component was replaced with an equal mass of maltodextrin, with the rest being the same as the compound microbial seed coating agent; the blank control was untreated naked seeds). The prepared seed coating agent was diluted 5 times with water, and then the corn seeds were coated with the agent at a ratio of 1:80, thoroughly stirred, and dried. The corn was planted in flowerpots (d=8.3cm, h=7cm), 3 plants / pot, 18 pots / treatment, with three replicates. Water and fertilizer management: watering was done during dry periods, and 0.1% NPK water-soluble fertilizer was applied once in between. After 28 days, the seedlings were harvested, the roots were washed, and the plant height, stem diameter, and dry weight of the above-ground and underground parts of the corn were measured. The results are shown in Table 6 below. Figure 2 .

[0156] Table 6. Effects of each treatment on maize growth indicators

[0157]

[0158] Note: Different letters in the same column indicate significant differences (P < 0.05).

[0159] From Table 6 and Figure 2 It can be seen that the various microbial agent coating treatments all have a certain growth-promoting effect on corn, among which:

[0160] The plant height of maize treated with Trichoderma harzianum and compound microbial seed dressing agent was significantly higher than that of untreated bare seeds and adjuvant control. The plant height of maize treated with Penicillium baicalensis and Metarhizium pingshaense was slightly higher than that of untreated bare seeds and adjuvant control group.

[0161] The corn stalk diameter of the group treated with Metarhizium pingshaense was significantly higher than that of the other groups, while the corn stalk diameter of the other microbial treatment groups was slightly higher than that of the untreated naked seed and adjuvant control groups.

[0162] In terms of the aboveground dry weight of individual plants, Trichoderma harzianum, Penicillium barometz, and Metarhizium anisopliae were significantly higher than the untreated bare seed and adjuvant control groups, and the compound microbial seed coating agent was also slightly higher than the untreated bare seed and adjuvant control groups.

[0163] In terms of single-plant underground dry weight, Trichoderma harzianum, Penicillium barometz, and compound microbial seed dressing agents were slightly higher than untreated naked seeds and adjuvant control groups, while Metarhizium pingshaense seed dressing agent was significantly higher than all other groups.

[0164] The maize plant height treated with the compound microbial seed dressing agent increased by 12.17%, stem diameter increased by 6.92%, and single-plant dry weight increased by 14.57% compared to the control, indicating that the compound microbial seed dressing agent has a good growth-promoting effect. The *Metarhizium pingshaense* of this application can also be prepared alone as a biocontrol agent for maize crops, and as a plant / crop growth promoter, possessing both growth-promoting and anti-plant pathogen functions.

[0165] (4) Effect of compound microbial seed coating agent on maize field growth promotion

[0166] Further field tests were conducted on the composite microbial seed coating agent samples of the present invention. The experiment was divided into 7 groups (refer to Table 7). In each group, the microbial seed coating agent was coated at a weight ratio of 1:80 (seed coating agent: corn) (effective viable bacteria count of a single microbial seed coating agent >2 billion CFU / g). The compound was the dry powder of the composite microbial seed coating agent of Example 1 (effective viable bacteria count >6 billion CFU / g). The adjuvant control was that the microbial part of the dry powder seed coating agent was replaced with an equal mass of maltodextrin, and the rest was the same as the composite microbial seed coating agent. The chemical agent group was a suspension composed of Ruisheng, Manyijia, Yipeiwei and Liangsui, coated with corn seeds at a weight ratio of 1:80. The blank control was uncoated naked seeds.

[0167] The maize variety tested was Juxin No. 2.

[0168] The experiment was conducted in Liming Village, Jianhua District, Qiqihar City, Heilongjiang Province (47.374934°N, 124.017567°E): Sowing was carried out using conventional methods on July 7, 2022, with a sowing depth of 3-4 cm. Seedlings emerged on July 14, and final seedling establishment was completed on August 1. A randomized block design with 3 replicates was used, with 8 rows / plot, a row length of 9.5 m, a row spacing of 65 cm, a plot area of ​​45 m² (5 m × 9 m), 39 plants / row, a plant spacing of 24 cm, and a 4-row protective perimeter. No walkways were provided between plots, but 50 cm walkways were provided between replicates. The effects of seed dressing agents on maize were observed during the maize growth period. The results are shown in Tables 7 and 8. Figure 3 .

[0169] Table 7. Effects of each treatment on maize growth period indicators

[0170]

[0171] Note: Different letters in the same column indicate significant differences (P < 0.05).

[0172] Table 7 shows that the emergence rate of each treatment group did not differ significantly, all reaching over 80%. The compound microbial seed dressing agent achieved the best emergence rate at 91.27%, an increase of 2.5% compared to the blank control and 3.6% compared to chemical pesticides. Plant height was measured on day 6 after sowing; the plant height of the compound microbial seed dressing agent was significantly higher than the blank control, increasing by 60.52% and 139.06% compared to chemical pesticides. On day 52 after sowing, the plant height of the compound microbial seed dressing agent was slightly higher than the blank control, increasing by 3.3% and 1.88% compared to chemical pesticides. Regarding yield per mu (a Chinese unit of area, approximately 0.067 hectares), the compound microbial seed dressing agent achieved 703.26 kg per mu, higher than other treatment groups, indicating a synergistic effect of the three strains combined. The *Metarhizium pingshaense* of this application can also be prepared alone as a biocontrol agent and a plant / crop growth promoter, capable of increasing yield per mu, crop emergence rate, and yield growth rate. The *Metarhizium pingshaense* of this application has growth-promoting and anti-plant pathogen functions.

[0173] Table 8. Effects of each treatment on maize ear indicators

[0174]

[0175] From Table 8 and Figure 3It can be seen that the ear weight and 100-kernel weight of maize treated with the compound seed dressing agent of the present invention are significantly higher than those of the blank control, while the ear length, number of rows per ear, and number of kernels per row are slightly higher than those of the blank control. The ear weight growth rate is 18.83%, the ear length growth rate is 10.71%, the number of rows per ear is 11.52%, the number of kernels per row is 15.84%, and the 100-kernel weight growth rate is 21.32%. The ear length of maize treated with the compound seed dressing agent is slightly higher than that of the treatment with the single microbial seed dressing agent and significantly higher than that of the adjuvant control group, the chemical drug group, and the blank control group. The number of kernels per row and 100-kernel weight of maize treated with the compound seed dressing agent are slightly higher than those of the treatment with the single microbial seed dressing agent.

[0176] Combination Figure 11 It can be seen that, Figure 11 This is the result of a field experiment on maize using a compound microbial seed dressing agent on day 52. ​​Based on observations on day 52 of the field experiment, compared to single-agent agents, the compound seed dressing agent caused the silks to darken earlier during the maize's growth period – the water-soaking stage. This indicates that the maize crop matures faster.

[0177] In summary, in maize field trials, except for plant height, the compound microbial seed dressing agent showed better results than single microbial seed dressing agents in terms of emergence rate, yield, and overall ear quality. This means that the compound seed dressing agent not only promotes growth but also improves crop yield and product quality.

[0178] The Metarhizium pingshaense of this application can also be prepared as a seed dressing agent on its own, and it has shown good effects on emergence rate, yield and overall quality of corn ears. It not only promotes growth, but also improves crop yield and product quality.

[0179] Example 3: Control Test of Corn Stalk Base Rot

[0180] (1) Inhibitory effect on the fungal pathogen Fusarium graminearum

[0181] The plate confrontation method was used. The fungal pathogen *Fusarium graminearum* was inoculated in the center of Luria-Bertani agar plates. The biocontrol fungi to be tested—*Trichoderma harzianum*, *Penicillium barometz*, and *Metarhizium pingshaense*—were inoculated to one side or around the pathogen, 2 cm away from the pathogen. Three replicates were performed for each fungus. Plates inoculated only with the pathogen served as controls. The plates were incubated at 28°C for 4–5 days, and the inhibition rate and inhibition band width were calculated.

[0182] Inhibition rate (%) = (Control colony diameter (radius) - Treated colony diameter (radius)) / Control colony diameter (radius) × 100%.

[0183] The test results are shown in the table below.

[0184] Table 9. Inhibition rate and inhibition band width of each strain

[0185] Penicillium barometz 78.67 0.5 Trichoderma harzianum 50.1 0 Metarhizium pingshaense 70.5 0.2

[0186] As can be seen from the test results (Table 9), Figure 4 The three strains all exhibited inhibitory effects on the growth of Fusarium graminearum, with significant antibacterial efficacy. Among them, *Penicillium baicalensis* showed the highest inhibition rate at 78.67%, with an inhibition zone width of 0.5 cm. *Metarhizium pingshaense* also achieved an inhibition rate exceeding 70%, with an inhibition zone width of 0.2 cm, while *Trichoderma harzianum* showed an inhibition rate of 50.1%. *Metarhizium pingshaense* of this application can also be prepared as a biocontrol agent to inhibit fungal pathogens and be used for the control of fungal diseases.

[0187] (2) Control test for corn stalk rot

[0188] The composite microbial seed dressing agent of this invention was tested in the laboratory for maize stalk rot: Fusarium graminearum was cultured on PDA medium for 3-5 days until it covered the plate, then the culture was broken into mycelial cakes (d=1cm) and inoculated on CMC medium. After culturing for 5-8 days, the spore suspension was adjusted to 10 using a hemocytometer. 5 ~10 6 The spore suspension was mixed with sterilized soil at cfu / mL, and then the coated corn was planted in flower pots with pot dimensions (d = 8.3 cm, h = 7 cm), 3 plants / pot, 18 pots / treatment, and three replicates.

[0189] Corn seeds were coated with different treatments (see Table 9 for each treatment group). Except for the chemical treatment group, the treatments for the other groups were the same as in Example 2. The chemical treatment was metalaxyl-fludioxonil suspension seed coating agent.

[0190] Water daily to maintain soil moisture content at 50-80%. Harvest seedlings after 2 weeks and check for disease incidence. Results are shown in Table 10.

[0191] Table 10 shows the control effect of each treatment on maize stalk rot.

[0192] Penicillium barometz 37.04 58.33 Trichoderma harzianum 33.33 62.50 complex 29.63 66.67 Metarhizium pingshaense 42.59 52.08 Additives comparison 79.63 10.42 Chemical drugs 22.22 75.00 Blank control 88.89 /

[0193] As shown in Table 10, the compound microbial seed dressing agent resulted in the lowest maize disease incidence rate at 29.63%, and the best relative control efficacy against maize stalk rot at 66.67%. In contrast, the disease index of maize treated with chemical seed dressing agents was 22.22%, with a relative control efficacy of 75%. Therefore, the compound microbial seed dressing agent of this invention has a significant control effect on maize stalk rot.

[0194] The Metarhizium pingshaense described in this application can also be prepared as a seed dressing agent, which can inhibit fungal pathogens and be used for the control of fungal diseases. It has a significant control effect on maize stalk rot.

[0195] Example 4: Control Test of Maize Large Leaf Spot Disease

[0196] (1) Plate confrontation test of Exserohilum turcicum

[0197] The plate confrontation method was used. The fungal pathogen *Helicobacter convexum* was inoculated in the center of a PDA agar plate. The biocontrol fungi to be tested, *Trichoderma harzianum*, *Penicillium baicalensis*, and *Metarhizium pingshaense*, were inoculated to one side or around the pathogen, 2 cm away. Each fungus was inoculated in triplicate. Plates inoculated only with the pathogen served as controls. The plates were incubated at 28°C for 4–5 days, and the inhibition rate and inhibition zone width were calculated.

[0198] Inhibition rate (%) = (Control colony diameter (radius) - Treated colony diameter (radius)) / Control colony diameter (radius) × 100%.

[0199] The test results are shown in the table below.

[0200] Table 11. Inhibition rate and inhibition band width of each strain against *Helicobacter convulsus*

[0201] Penicillium barometz 73.35 0.31 Trichoderma harzianum 81.28 0 Metarhizium pingshaense 59.68 0.26

[0202] Based on the test results (Table 11), Figure 5 All three strains showed some inhibitory effect on the growth of *Helicobacter convexum*, and the antibacterial effect was significant. Among them, *Trichoderma harzianum* had the highest inhibition rate of 81.28%, *Penicillium barometz* also achieved an inhibition rate of over 70% with an inhibition zone width of 0.31 cm, and *Metarhizium pingshaense* had an inhibition rate of nearly 58.68% with an inhibition zone width of 0.26 cm.

[0203] The Metarhizium pingshaense of this application can also be prepared as a biocontrol agent or pesticide formulation, which can inhibit fungal pathogens and be used for the prevention and control of fungal diseases.

[0204] (2) Control effect of maize leaf spot disease

[0205] In Example 2, a survey of maize leaf spot disease was conducted during the late milk stage of maize.

[0206] During the investigation, the disease status of each group of samples was visually assessed. The focus of the investigation was on the upper leaves and the three lower leaves of the corn ear. Based on the description of the disease symptoms, each sample was investigated and the disease level was recorded. The disease levels are as follows: Level 0: No lesions on any leaves; Level 0.5: Scattered lesions on all leaves, covering about 1% of the leaf area; Level 1: A small number of lesions on all leaves, covering 5%-10% of the leaf area; Level 2: Moderate lesions on all leaves, covering 10-25% of the leaf area; Level 3: Numerous lesions on the lower leaves, covering more than 50% of the leaf area, with large areas of necrosis; moderate lesions on the upper and middle leaves, covering 10-25% of the leaf area; Level 4: Lower leaves withered; numerous lesions on the middle leaves, with large areas of necrosis; moderate lesions on the upper leaves; Level 5: The entire plant is basically dead.

[0207] The results of the maize leaf spot survey for each treatment group are shown in the table below. Figure 6 As shown.

[0208] Table 12. Control effects of different treatments on maize leaf spot disease

[0209] Penicillium barometz 19.67±0.88d 65.69 Trichoderma harzianum 20±1d 65.11 complex 18.67±1.2d 67.43 Metarhizium pingshaense 35.33±0.88c 38.37 Additives comparison 54±4.04ab 5.81 Chemical drugs 46.33±0.67b 19.19 Blank control 57.33±4.91a /

[0210] From Table 12 and Figure 6 It can be seen that the compound microbial seed dressing agent had the lowest disease index of corn at 18.67%, and the best relative control efficacy against corn leaf blight at 67.43%. In contrast, the disease index of corn treated with chemical seed dressing agents was 46.33%, with a relative control efficacy of 19.19%. Therefore, the compound microbial seed dressing agent of this invention has a significant control effect on corn leaf blight.

[0211] The Metarhizium pingshaense described in this application can also be prepared alone as a seed dressing agent, biocontrol agent, and pesticide formulation, capable of inhibiting fungal pathogens and used for the control of fungal diseases. It has a significant control effect on maize leaf spot.

[0212] Example 5: Indoor insecticidal effect of compound microbial seed dressing agent on corn borer

[0213] Corn leaves with similar growth and development in each treatment group were collected from the field in Example 2. Samples were taken from 5 points in each plot, with 3 plants per point and 2 leaves per plant. Fresh leaves were placed in 10cm diameter glass petri dishes, with 20 newly hatched corn borer larvae of uniform size and activity in each dish, in triplicate. Sufficient leaves were ensured during the experiment. Larval survival rate was recorded after 10 days, and the relative control effect was calculated.

[0214] Control efficacy (%) = [1 - (number of live insects in the treated area after treatment × number of live insects in the control area before treatment) / (number of live insects in the treated area before treatment × number of live insects in the control area after treatment)] × 100%.

[0215] The indoor control efficacy of each group against corn borer is shown in the table below.

[0216] Table 13 Indoor control efficacy of different treatments against corn borer

[0217]

[0218] The results showed that *Metarhizium pingshaense* and the microbial compound inoculant had significant effects on the control of corn borers. The microbial compound inoculant was slightly more effective than the *Metarhizium pingshaense* group, achieving a control efficacy of 79.78%. The control efficacies of *Penicillium baicalensis*, *Trichoderma harzianum*, and the adjuvant were 2.25%, 1.16%, and 1.93%, respectively. Considering the differences in vigor and environmental adaptability among individual corn borers, these three treatments were deemed ineffective against corn borers. These results indicate that the three strains in the compound microbial seed dressing agent have better control efficacy than *Metarhizium pingshaense* alone, suggesting that this compound seed dressing agent has the potential to control corn borers.

[0219] The Metarhizium pingshaense of this application can also be prepared as an insecticide and pesticide formulation to suppress field pests such as corn borers.

[0220] Example 6: Field insecticidal effect of compound microbial seed dressing agent on corn pests

[0221] Further investigation was conducted after the corn harvest to assess the damage to the corn plants and the number of surviving corn pests. Samples were taken from 5 points in each plot, with 20 plants sampled at each point. The results are shown in the table below.

[0222] Table 14 Damage rate (%) of maize under different treatments

[0223]

[0224] Field surveys showed a reduction in pest numbers in all treatments compared to the control group. Results indicated that *Metarhizium pingshaense* and the microbial compound inoculant were significantly effective against corn pests, with the microbial compound inoculant achieving a control efficacy of 69.81% against the corn borer. In contrast, the control efficiencies of *Penicillium baicalensis*, *Trichoderma harzianum*, and the adjuvant treatments relative to the control group were 9.43%, 3.78%, and -9.43%, respectively. Based on factors similar to those observed in indoor insecticide experiments, these three treatments were deemed ineffective against corn pests. These results demonstrate that the compound microbial seed dressing agent has the potential to control corn pests, and that the three microorganisms used in the compound microbial seed dressing agent of this invention synergistically enhance the control effect against corn pests compared to using *Metarhizium pingshaense* alone.

[0225] The Metarhizium pingshaense of this application can also be prepared alone as a seed dressing agent, biological control agent, and pesticide formulation, which can inhibit corn pests in the field and has a significant control effect.

[0226] Example 7: Colonization of the compound microbial seed coating agent on maize roots

[0227] Corn roots treated with the compound microbial seed dressing agent in Example 2 were collected on the 6th day after sowing (July 13th), the 52nd day (September 8th), and the 98th day (October 13th, at harvest). Under laboratory conditions, bacterial isolation and identification—dilution plating—were performed to test the colonization of each bacterial strain in the corn roots. The experimental results are as follows: Figures 7-10 As shown.

[0228] The experimental results showed that all three strains of the compound microbial seed dressing agent could colonize the corn root system, with a root strain content of 10%. 4 ~10 6 The cfu / g root formulation stably colonizes the maize root system and continues to exert its effects throughout the entire growth period. The bacterial strain content in maize roots treated with a single microbial seed dressing agent is comparable to that of a compound microbial seed dressing agent.

[0229] Example 8: Compatibility of Compound Microbial Seed Coating Agent with Chemical Drugs

[0230] The compound microbial seed coating agent prepared in Example 1 was mixed 1:1 with common chemical seed coating agents for corn (such as metalaxyl, fludioxonil, thiamethoxam, and tebuconazole). The bacterial count changes at 0, 2, 6, and 24 hours after dilution and plating were calculated to test the compatibility of this invention with chemical seed coating agents. The results are shown in the table below.

[0231] Table 14. Changes in the number of strains over time in different combinations of chemical drugs.

[0232]

[0233] The experimental results showed that the survival rate of the three strains in the dry powder compound microbial seed coating agent after coexisting with the chemical drugs metalaxyl, fludioxonil, thiamethoxam and tebuconazole for 24 hours was all above 93.31%, and the activity of each strain was high. Therefore, the dry powder compound microbial seed coating agent of the present invention can be used in combination with the above chemical drugs or directly applied to soil environments where the above chemical drug residues exist and exert its effect.

[0234] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. A seed coating agent, characterized in that, Contains microbial and agriculturally acceptable carriers. The microorganism is selected from at least one of Penicillium barometz and Trichoderma harzianum; The *Penicillium bailai* described is deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, on July 12, 2016, with accession number CGMCC NO. 12767. The *Trichoderma harzianum* described is deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, on May 21, 2018, with accession number CGMCC No. 15679. The seed coating agent is composed of the following components in weight percentage: 15%-18% microorganisms, 3%-5% polyvinyl alcohol, 5%-8% BX (a type of microbial powder), 8%-10% Dispersol BB4, 10%-13% corn starch, 18%-20% colorant, and 32%-35% powdered sugar.

2. The seed coating agent as described in claim 1, characterized in that, The microorganism is the spore powder of the microorganism.

3. The seed coating agent as described in claim 1, characterized in that, The concentration of Trichoderma harzianum or Penicillium barometz spore powder in the seed coating agent is at least 2 billion CFU / g or 2 billion CFU / mL.

4. The seed coating agent as described in claim 1, characterized in that, It also includes chemical seed coating agents; the chemical seed coating agent is at least one of metalaxyl, fludioxonil, thiamethoxam and tebuconazole.

5. The seed coating agent as described in claim 4, characterized in that, The chemical seed coating agent accounts for at least 50% of the mass of the seed coating agent.

6. The seed coating agent as described in claim 1, characterized in that, It also includes at least one of the following: plant nutrients and fertilizers.

7. The method of using the seed coating agent as described in claim 1, characterized in that, The seed coating agent is applied to at least a portion of the outer surface of a plant seed.

8. The method of using the seed coating agent as described in claim 2, characterized in that, The seed coating agent is applied to at least a portion of the outer surface of a plant seed.

9. The method of using the seed coating agent as described in claim 3, characterized in that, The seed coating agent is applied to at least a portion of the outer surface of a plant seed.

10. The method of using the seed coating agent as described in claim 4, characterized in that, The seed coating agent is applied to at least a portion of the outer surface of a plant seed.

11. The method of using the seed coating agent as described in claim 5, characterized in that, The seed coating agent is applied to at least a portion of the outer surface of a plant seed.

12. The method of using the seed coating agent as described in claim 6, characterized in that, The seed coating agent is applied to at least a portion of the outer surface of a plant seed.

13. The method of using the seed coating agent as described in claim 7, characterized in that, The plant seed is a corn seed.

14. The method of using the seed coating agent as described in any one of claims 8-12, characterized in that, The plant seed is a corn seed.

15. The use of the seed coating agent according to any one of claims 1-6, characterized in that, The seed dressing agent is used to prevent or treat plant diseases or improve plant disease symptoms. The plant is corn, and the plant has one or more of the following improved traits: increased yield, increased ear weight, increased 100-kernel weight, increased number of kernels per row, and reduced symptoms caused by fungal diseases, including at least one of corn leaf blight and corn stalk rot.

16. The method for preparing the seed coating agent as described in claim 1, characterized in that, The process includes the following steps: mixing the components according to the specified ratio.

Images